Prosecution Insights
Last updated: August 06, 2026
Application No. 18/038,900

PRODUCTS AND METHODS FOR INHIBITION OF EXPRESSION OF PERIPHERAL MYELIN PROTEIN-22

Non-Final OA §103§112
Filed
May 25, 2023
Priority
Dec 01, 2020 — provisional 63/120,190 +2 more
Examiner
TRAN, CHRISTINA L
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
The Cyprus Institute
OA Round
1 (Non-Final)
48%
Grant Probability
Moderate
1-2
OA Rounds
10m
Est. Remaining
94%
With Interview

Examiner Intelligence

Grants 48% of resolved cases
48%
Career Allowance Rate
27 granted / 56 resolved
-11.8% vs TC avg
Strong +46% interview lift
Without
With
+45.5%
Interview Lift
resolved cases with interview
Typical timeline
4y 0m
Avg Prosecution
51 currently pending
Career history
110
Total Applications
across all art units

Statute-Specific Performance

§101
6.2%
-33.8% vs TC avg
§103
31.8%
-8.2% vs TC avg
§102
13.3%
-26.7% vs TC avg
§112
36.5%
-3.5% vs TC avg
Black line = Tech Center average estimate • Based on career data from 56 resolved cases

Office Action

§103 §112
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . DETAILED ACTION Applicant's preliminary amendment filed on April 13, 2026 is acknowledged. Claim 1 was amended. Claims 1-31 are pending. Election/Restrictions Applicant's election with traverse of Group I (claims 1-27) in the reply filed on April 13, 2026 is acknowledged. The traversal is on the ground(s) that Hung et al. SEQ ID NO: 16 only has a 72.7% Query Match with 75.0% Best Local Similarity over only 16 nucleotides with the sequence of SEQ ID NO: 20. Further, the partial match to a small portion of the instant sequences does not anticipate the claimed template nucleic acids or artificial inhibitory RNAs as complete constructs nor does it anticipate a nucleic acid encoding a PMP22 antisense guide strand comprising at least 80% identity to the polynucleotide sequence of SEQ ID NO: 20 as recited in amended claim 1. Applicant also asserts that Hung et al. teaches chemically modified antisense oligonucleotides that are administered directly and work via RNase H-mediated degradation; whereas, the instant claims are directed to viral vector-delivered gene therapy constructs encoding artificial inhibitory RNAs. Applicant amended claim 1 and thus Applicant’s arguments are found persuasive. However, the technical feature of the nucleic acid of claim 1 linking groups I and II is not a special technical feature because the shared technical feature is taught by Swayze et al. (US 2023/0374519) in view of Choi et al. (US 2018/0066257; reference cited by Applicant). Swayze et al. teaches compounds and pharmaceutical compositions for reducing the amount or activity of PMP22 RNA in a cell or animal, and in certain instances reducing the amount of PMP22 protein in a cell or animal [abstract]. Swayze et al. SEQ ID NO: 597 (designated as Db) has a match to instant SEQ ID NO: 20 (designated as Qy) as shown in the alignment below. SEQ ID NO: 597 is an antisense strand targeting human PMP22 [page 67]. Query Match 92.7%; Score 20.4; Length 23; Best Local Similarity 95.5%; Matches 21; Conservative 0; Mismatches 1; Indels 0; Gaps 0; Qy 1 AUCUUCAAUCAACAGCAAUCCC 22 |||||||||||||||||| ||| Db 1 AUCUUCAAUCAACAGCAACCCC 22 Choi et al. teaches an siRNA for specifically targeting a PMP22 mutant gene and a pharmaceutical composition for preventing or treating Charcot Marie Tooth disease [abstract]. Further, the expression inhibitor may be a small interfering RNA (siRNA), a short hairpin RNA (shRNA), or an aptamer, which specifically binds to the Pmp22 mutant gene [0015]. Choi et al. teaches a recombinant vector including the siRNA [0021]. Choi et al. also teaches that the shRNA is transfected into cells using a vector containing a U6 promoter [0051]. It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to make a nucleic acid encoding a PMP22 antisense guide strand because Swayze et al. taught an oligomeric duplex comprising a first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides wherein the nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NO: 597 and taught that SEQ ID NO: 597 is an antisense strand sequence targeting human PMP22 and Choi et al. taught an siRNA for specifically targeting a PMP22 mutant gene, a recombinant vector including the siRNA, and also taught that shRNA is transfected into cells using a vector. One of ordinary skill in the art would have made such a modification because it would have amounted to a simple substitution of one known element for another to obtain predictable results. Thus, groups I and II lack unity. The requirement is still deemed proper and is therefore made FINAL. Applicant's election with traverse of the following species (SEQ ID NO: 2) in the reply filed on April 13, 2026 is acknowledged. Upon further consideration and in the interest of compact prosecution, the species election requirement as set forth in the Office action mailed on February 20, 2026 has been withdrawn. Claims 28-31 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected invention, there being no allowable generic or linking claim. Applicant timely traversed the restriction (election) requirement in the reply filed on April 13, 2026. Claims 1-27 are examined on the merits herein. Priority PNG media_image1.png 46 446 media_image1.png Greyscale Information Disclosure Statement The information disclosure statement (IDS) submitted on July 28, 2023, July 31, 2025, November 24, 2025, and May 26, 2026 is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statements are being considered by the examiner. The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered. Drawings The drawings were received on May 25, 2023. The drawings are objected to because 37 CFR 1.84 (u)(1) states “View numbers must be preceded by the abbreviation "FIG."”. In addition, Figure 5 refers to colors but color drawings were not filed. Figure 7 is blurry and hard to decipher. Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance. Color photographs and color drawings are not accepted in utility applications unless a petition filed under 37 CFR 1.84(a)(2) is granted. Any such petition must be accompanied by the appropriate fee set forth in 37 CFR 1.17(h), one set of color drawings or color photographs, as appropriate, if submitted via the USPTO patent electronic filing system or three sets of color drawings or color photographs, as appropriate, if not submitted via the via USPTO patent electronic filing system, and, unless already present, an amendment to include the following language as the first paragraph of the brief description of the drawings section of the specification: The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. Color photographs will be accepted if the conditions for accepting color drawings and black and white photographs have been satisfied. See 37 CFR 1.84(b)(2). Specification The substitute specification filed on January 25, 2024 has been entered. The disclosure is objected to because of the following informalities: Paragraphs [32], [47], [48], and [49] of the specification filed on 01/25/2024 refer to the figures by color; however, color drawings were not submitted with the application. Paragraph [48] reads in part “Figure 17A-D” and should read “Figure 17A-G” (emphasis added). Paragraph [93] reads in part “Figure 62” and should read “Figure 62A-B”. It appears that paragraphs [157] through [186] are missing or paragraphs [187] and [188] are mislabeled and should be labeled as [157] and [158], respectively. Appropriate correction is required. Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Written Description Claims 1-27 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. Claims 1-13 are drawn to the provision of a genus of nucleic acids with at least 70% identity to the polynucleotide sequence set forth in any one of SEQ ID NOS: 9-16 that encodes a PMP22 artificial inhibitory RNA. Thus, the claims encompass a broad genus of nucleic acids encoding a PMP22 artificial inhibitory RNA which comprises at least 70% identity to any polynucleotide sequence set forth in any one of SEQ ID NOS: 9-16. Claims 14-27 are drawn to the provision of a genus of nucleic acids encoding an artificial inhibitory RNA that binds a segment of a mRNA encoded by a human PMP22 gene. Thus, the claims encompass a broad genus of nucleic acids encoding any inhibitory RNA sequence that must be capable of binding to a segment of a mRNA encoded by a human PMP22 gene. To provide adequate written description and evidence of possession of a claimed genus, the specification must provide sufficient distinguishing identifying characteristics of the genus. The factors to be considered include disclosure of a complete or partial structure, physical and/or chemical properties, functional characteristics, structure/function correlation, and any combination thereof. The specification discloses that the miPMP22-868 DNA template sequence is SEQ ID NO: 1 which encodes the full length RNA sequence SEQ ID NO: 9 [124], the miPMP22-871 DNA template sequence is SEQ ID NO: 2 which encodes the full length RNA sequence SEQ ID NO: 10 [126], the miPMP22-869 DNA template sequence is SEQ ID NO: 3 which encodes the full length RNA sequence SEQ ID NO: 11 [128], the miPMP22-872 DNA template sequence is SEQ ID NO: 4 which encodes the full length RNA sequence SEQ ID NO: 12 [129], the miPMP22-1706 DNA template sequence is SEQ ID NO: 5 which encodes the full length RNA sequence SEQ ID NO: 13 [130], the miPMP22-1740 DNA template sequence is SEQ ID NO: 6 which encodes the full length RNA sequence SEQ ID NO: 14 [131], the miPMP22-1741 DNA template sequence is SEQ ID NO: 7 which encodes the full length RNA sequence SEQ ID NO: 15 [132], and the miPMP22-1834 DNA template sequence is SEQ ID NO: 8 which encodes the full length RNA sequence SEQ ID NO: 16 [133]. The specification envisions the following: PNG media_image2.png 586 790 media_image2.png Greyscale Even if one accepts that the examples described in the specification meet the claim limitations of the rejected claims with regard to structure and function, the examples are only representative of nucleic acids encoding a PMP22 artificial inhibitory RNA set forth in any one of SEQ ID NOS: 9-16. The results are not necessarily predictive of other nucleic acids falling within the broadly claimed genus. Thus, it is impossible for one to extrapolate from the examples described herein those nucleic acids that would necessarily meet the structural/functional characteristics of the rejected claims. With respect to the artificial inhibitory RNAs, the specification discloses the following: PNG media_image3.png 290 790 media_image3.png Greyscale The specification envisions the following: PNG media_image4.png 126 786 media_image4.png Greyscale The specification further envisions that the miPMP22s (artificial inhibitory RNAs) are small regulatory sequences that act post-transcriptionally by targeting, for example, the 3’ UTR of PMP22 mRNA in a reverse complementary manner resulting in reduced PMP22 mRNA and protein levels [11]. Even if one accepts that the example described in the specification meets the claim limitations of the rejected claims with regard to structure and function, the example is only representative of a miPMP22 that specifically binds to a mRNA segment that is complementary to a sequence within nucleotides 1412-1433 or 1415-1436 of SEQ ID NO: 25. The result is not necessarily predictive of other nucleic acids falling within the broadly claimed genus. Thus, it is impossible for one to extrapolate from the examples described herein those nucleic acids that would necessarily meet the structural/functional characteristics of the rejected claims. Although post-filing, Chausova et al. (International Journal of Molecular Sciences 2026) discloses that pathogenic variants in the PMP22 gene can lead to hereditary peripheral demyelinating neuropathies of varying severity, including hereditary neuropathy with liability to pressure palsies (HNPP), Charcot–Marie–Tooth disease types 1A and 1E (CMT1A, CMT1E), Roussy–Lévy syndrome, and Dejerine–Sottas disease (DSS) [abstract]. The prior art does not appear to offset the deficiencies of the instant specification in that it does not describe a set of nucleic acids with at least 70% identity to the polynucleotide sequence set forth in any one of SEQ ID NOS: 9-16 that encodes a PMP22 artificial inhibitory RNA. The prior art also does not appear to offset the deficiencies of the instant specification in that it does not describe a set of nucleic acids encoding any inhibitory RNA sequence that binds a segment of a mRNA encoded by a human PMP22 gene. Therefore, the skilled artisan would have reasonably concluded applicants were not in possession of the claimed invention for claims 1-27. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim 1 is rejected under 35 U.S.C. 103 as being unpatentable over Swayze et al. (US 2023/0374519) in view of Choi et al. (US 2018/0066257; reference cited by Applicant). Regarding claim 1, Swayze et al. teaches compounds and pharmaceutical compositions for reducing the amount or activity of PMP22 RNA in a cell or animal, and in certain instances reducing the amount of PMP22 protein in a cell or animal [abstract]. Swayze et al. teaches that “RNAi agent” means an antisense agent that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and/or protein encoded by a target nucleic acid which includes double-stranded siRNA and single-stranded RNAi (ssRNAi) [0059]. Swayze et al. also teaches that oligomeric compounds comprise an oligonucleotide, having a nucleobase sequence complementary to that of a target nucleic acid. In certain embodiments, an oligomeric compound is paired with a second oligomeric compound to form an oligomeric duplex [0453]. Further, Swayze et al. teaches that an oligomeric duplex comprises: a first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides wherein the nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NOS: 322-632. In certain embodiments, the first oligomeric compound is an antisense compound [0457]. Swayze et al. SEQ ID NO: 597 (designated as Db) has a match to instant SEQ ID NO: 20 (designated as Qy) as shown in the alignment below. SEQ ID NO: 597 is an antisense strand targeting human PMP22 [page 67]. Query Match 92.7%; Score 20.4; Length 23; Best Local Similarity 95.5%; Matches 21; Conservative 0; Mismatches 1; Indels 0; Gaps 0; Qy 1 AUCUUCAAUCAACAGCAAUCCC 22 |||||||||||||||||| ||| Db 1 AUCUUCAAUCAACAGCAACCCC 22 However, Swayze et al. does not teach a nucleic acid encoding a PMP22 antisense guide strand. Choi et al. teaches an siRNA for specifically targeting a PMP22 mutant gene and a pharmaceutical composition for preventing or treating Charcot Marie Tooth disease [abstract]. Further, the expression inhibitor may be a small interfering RNA (siRNA), a short hairpin RNA (shRNA), or an aptamer, which specifically binds to the Pmp22 mutant gene [0015]. Choi et al. teaches a recombinant vector including the siRNA [0021]. Choi et al. also teaches that the shRNA is transfected into cells using a vector containing a U6 promoter [0051]. It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to make a nucleic acid encoding a PMP22 antisense guide strand because Swayze et al. taught an oligomeric duplex comprising a first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides wherein the nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NO: 597 and taught that SEQ ID NO: 597 is an antisense strand sequence targeting human PMP22 and Choi et al. taught an siRNA for specifically targeting a PMP22 mutant gene, a recombinant vector including the siRNA, and also taught that shRNA is transfected into cells using a vector. One of ordinary skill in the art would have made such a modification because it would have amounted to a simple substitution of one known element for another to obtain predictable results. Claims 2-8, 11-14, 18-24, and 27 are rejected under 35 U.S.C. 103 as being unpatentable over Swayze et al. (US 2023/0374519) in view of Choi et al. (US 2018/0066257; reference cited by Applicant) as applied to claim 1 above, and further in view of Harper et al. (US 9,469,851). Regarding claims 2-8, 11-14, 18-24, and 27, the teachings of Swayze et al. and Choi et al. are discussed above. However, Swayze et al. and Choi et al. do not teach a viral vector comprising the nucleic acid of claim 1 wherein the viral vector is an rAAV and lacks rep and cap genes. Swayze et al. and Choi et al. do not teach that the AAV has a capsid serotype of AAV-9. Swayze et al. and Choi et al. also do not teach that the expression of the nucleic acid is under the control of a U6 promoter. Swayze et al. and Choi et al. do not teach a composition comprising the nucleic acid of claim 1 or the viral vector of claim 4 and a pharmaceutically acceptable carrier. Regarding claims 2-6 and 18-22, Harper et al. teaches a composition comprising a rAAV encoding a DUX4 miRNA wherein the rAAV lacks rep and cap genes [column 4, lines 32-35]. Regarding claims 7, 8, 23, and 24, Harper et al. teaches that AAV DNA in the rAAV genomes may be from any AAV serotype for which a recombinant virus can be derived including AAV-9. Regarding claims 11 and 27, Harper et al. teaches in Figure 5 (reproduced below) a U6 promoter for mi405 AAV.miDUX4. Regarding claims 12-14, Harper et al. also teaches compositions comprising rAAV in a pharmaceutically acceptable carrier. Further, the compositions may also comprise other ingredients such as diluents and adjuvants [column 6, last paragraph]. PNG media_image5.png 122 428 media_image5.png Greyscale It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the vector of Harper et al. wherein the vector comprises a nucleic acid encoding a PMP22 antisense strand because Harper et al. taught a composition comprising a rAAV encoding a DUX4 miRNA wherein the rAAV lacks rep and cap genes and taught a composition comprising rAAV in a pharmaceutically acceptable carrier, Swayze et al. taught an oligomeric duplex comprising a first oligomeric compound comprising a first modified oligonucleotide consisting of 23 linked nucleosides wherein the nucleobase sequence of the first modified oligonucleotide comprises the nucleobase sequence of any of SEQ ID NO: 597 and taught that SEQ ID NO: 597 is an antisense strand sequence targeting human PMP22, and Choi et al. taught an siRNA for specifically targeting a PMP22 mutant gene, a recombinant vector including the siRNA, and also taught that shRNA is transfected into cells using a vector. One of ordinary skill in the art would have made such a modification because it would have amounted to a simple substitution of one known element for another to obtain predictable results. Claims 9, 10, 25, and 26 are rejected under 35 U.S.C. 103 as being unpatentable over Swayze et al. (US 2023/0374519) in view of Choi et al. (US 2018/0066257; reference cited by Applicant) and Harper et al. (US 9,469,851) as applied to claims 1, 2-8, 11-14, 18-24, and 27 above, and further in view of Urnov et al. (WO 2015/153760). Regarding claims 9, 10, 25, and 26, the teachings of Swayze et al., Choi et al., and Harper et al. are discussed above. However, Swayze et al., Choi et al., and Harper et al. do not teach that the AAV is a pseudotyped AAV, specifically AAV2/8. Urnov et al. teaches compositions for nervous system (NS) disorders [abstract]. Urnov et al. teaches that recombinant adeno-associated virus vectors (rAAV) may also be used to deliver the compositions. In addition, pseudotyped AAV such as AAV2/8, AAV2/5 and AAV2/6 and all variants thereof, can also be used [0176]. It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the viral vector and composition of Swayze et al., Choi et al., and Harper et al. wherein the AAV is a pseudotyped AAV such as AAV2/8 because Swayze et al., Choi et al., and Harper et al. taught compositions comprising rAAV in a pharmaceutically acceptable carrier and Urnov et al. taught that recombinant adeno-associated virus vectors (rAAV) and pseudotyped AAV such as AAV2/8 may be used to deliver compositions for nervous system disorders. One of ordinary skill in the art would have made such a modification because it would have amounted to a simple substitution of one known element for another to obtain predictable results. Claims 16 and 17 are rejected under 35 U.S.C. 103 as being unpatentable over Swayze et al. (US 2023/0374519) in view of Choi et al. (US 2018/0066257; reference cited by Applicant) and Harper et al. (US 9,469,851) as applied to claims 1, 2-8, 11-14, 18-24, and 27 above, and further in view of Nelles et al. (US 2021/0009987). Regarding claims 16 and 17, the teachings of Swayze et al., Choi et al., and Harper et al. are discussed above. However, Swayze et al., Choi et al., and Harper et al. do not teach wherein the mRNA segment is complementary to a sequence within nucleotides 1-2423 of SEQ ID NO: 25 or wherein the mRNA segment is complementary to a sequence within nucleotides 1412-1433 or 1415-1436 of SEQ ID NO: 25. Nelles et al. teaches compositions comprising a gRNA comprising a spacer sequence that specifically binds to a target sequence of an RNA molecule encoding PMP22 protein comprising or consisting of about 20-30 nucleotides of the sequence of SEQ ID NO: 316 [0449]. Nelles et al. teaches SEQ ID NO: 316 (designated as Db) which is complementary to instant SEQ ID NO: 25 (designated as Qy) as shown in the alignment below. Query Match 68.3%; Score 1655.2; Length 1828; Best Local Similarity 99.5%; Matches 1660; Conservative 0; Mismatches 8; Indels 0; Gaps 0; Qy 750 GTTCCTTTGGGCTGCAGAAACTCCGCTGAGCAGAACTTGCCGCCAGAATGCTCCTCCTGT 809 | | || | ||||||||||||||||||||||||||||||||||||||||||||||| Db 1668 GCTGTTTGGCCGGGCAGAAACTCCGCTGAGCAGAACTTGCCGCCAGAATGCTCCTCCTGT 1609 Qy 810 TGCTGAGTATCATCGTCCTCCACGTCGCGGTGCTGGTGCTGCTGTTCGTCTCCACGATCG 869 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1608 TGCTGAGTATCATCGTCCTCCACGTCGCGGTGCTGGTGCTGCTGTTCGTCTCCACGATCG 1549 Qy 870 TCAGCCAATGGATCGTGGGCAATGGACACGCAACTGATCTCTGGCAGAACTGTAGCACCT 929 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1548 TCAGCCAATGGATCGTGGGCAATGGACACGCAACTGATCTCTGGCAGAACTGTAGCACCT 1489 Qy 930 CTTCCTCAGGAAATGTCCACCACTGTTTCTCATCATCACCAAACGAATGGCTGCAGTCTG 989 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1488 CTTCCTCAGGAAATGTCCACCACTGTTTCTCATCATCACCAAACGAATGGCTGCAGTCTG 1429 Qy 990 TCCAGGCCACCATGATCCTGTCGATCATCTTCAGCATTCTGTCTCTGTTCCTGTTCTTCT 1049 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1428 TCCAGGCCACCATGATCCTGTCGATCATCTTCAGCATTCTGTCTCTGTTCCTGTTCTTCT 1369 Qy 1050 GCCAACTCTTCACCCTCACCAAGGGGGGCAGGTTTTACATCACTGGAATCTTCCAAATTC 1109 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1368 GCCAACTCTTCACCCTCACCAAGGGGGGCAGGTTTTACATCACTGGAATCTTCCAAATTC 1309 Qy 1110 TTGCTGGTCTGTGCGTGATGAGTGCTGCGGCCATCTACACGGTGAGGCACCCGGAGTGGC 1169 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1308 TTGCTGGTCTGTGCGTGATGAGTGCTGCGGCCATCTACACGGTGAGGCACCCGGAGTGGC 1249 Qy 1170 ATCTCAACTCGGATTACTCCTACGGTTTCGCCTACATCCTGGCCTGGGTGGCCTTCCCCC 1229 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1248 ATCTCAACTCGGATTACTCCTACGGTTTCGCCTACATCCTGGCCTGGGTGGCCTTCCCCC 1189 Qy 1230 TGGCCCTTCTCAGCGGTGTCATCTATGTGATCTTGCGGAAACGCGAATGAGGCGCCCAGA 1289 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1188 TGGCCCTTCTCAGCGGTGTCATCTATGTGATCTTGCGGAAACGCGAATGAGGCGCCCAGA 1129 Qy 1290 CGGTCTGTCTGAGGCTCTGAGCGTACATAGGGAAGGGAGGAAGGGAAAACAGAAAGCAGA 1349 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1128 CGGTCTGTCTGAGGCTCTGAGCGTACATAGGGAAGGGAGGAAGGGAAAACAGAAAGCAGA 1069 Qy 1350 CAAAGAAAAAAGAGCTAGCCCAAAATCCCAAACTCAAACCAAACCAAACAGAAAGCAGTG 1409 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1068 CAAAGAAAAAAGAGCTAGCCCAAAATCCCAAACTCAAACCAAACCAAACAGAAAGCAGTG 1009 Qy 1410 GAGGTGGGGGTTGCTGTTGATTGAAGATGTATATAATATCTCCGGTTTATAAAACCTATT 1469 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1008 GAGGTGGGGGTTGCTGTTGATTGAAGATGTATATAATATCTCCGGTTTATAAAACCTATT 949 Qy 1470 TATAACACTTTTTACATATATGTACATAGTATTGTTTGCTTTTTATGTTGACCATCAGCC 1529 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 948 TATAACACTTTTTACATATATGTACATAGTATTGTTTGCTTTTTATGTTGACCATCAGCC 889 Qy 1530 TCGTGTTGAGCCTTAAAGAAGTAGCTAAGGAACTTTACATCCTAACAGTATAATCCAGCT 1589 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 888 TCGTGTTGAGCCTTAAAGAAGTAGCTAAGGAACTTTACATCCTAACAGTATAATCCAGCT 829 Qy 1590 CAGTATTTTTGTTTTGTTTTTTGTTTGTTTGTTTTGTTTTACCCAGAAATAAGATAACTC 1649 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 828 CAGTATTTTTGTTTTGTTTTTTGTTTGTTTGTTTTGTTTTACCCAGAAATAAGATAACTC 769 Qy 1650 CATCTCGCCCCTTCCCTTTCATCTGAAAGAAGATACCTCCCTCCCAGTCCACCTCATTTA 1709 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 768 CATCTCGCCCCTTCCCTTTCATCTGAAAGAAGATACCTCCCTCCCAGTCCACCTCATTTA 709 Qy 1710 GAAAACCAAAGTGTGGGTAGAAACCCCAAATGTCCAAAAGCCCTTTTCTGGTGGGTGACC 1769 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 708 GAAAACCAAAGTGTGGGTAGAAACCCCAAATGTCCAAAAGCCCTTTTCTGGTGGGTGACC 649 Qy 1770 CAGTGCATCCAACAGAAACAGCCGCTGCCCGAACCTCTGTGTGAAGCTTTACGCGCACAC 1829 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 648 CAGTGCATCCAACAGAAACAGCCGCTGCCCGAACCTCTGTGTGAAGCTTTACGCGCACAC 589 Qy 1830 GGACAAAATGCCCAAACTGGAGCCCTTGCAAAAACACGGCTTGTGGCATTGGCATACTTG 1889 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 588 GGACAAAATGCCCAAACTGGAGCCCTTGCAAAAACACGGCTTGTGGCATTGGCATACTTG 529 Qy 1890 CCCTTACAGGTGGAGTATCTTCGTCACACATCTAAATGAGAAATCAGTGACAACAAGTCT 1949 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 528 CCCTTACAGGTGGAGTATCTTCGTCACACATCTAAATGAGAAATCAGTGACAACAAGTCT 469 Qy 1950 TTGAAATGGTGCTATGGATTTACCATTCCTTATTATCACTAATCATCTAAACAACTCACT 2009 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 468 TTGAAATGGTGCTATGGATTTACCATTCCTTATTATCACTAATCATCTAAACAACTCACT 409 Qy 2010 GGAAATCCAATTAACAATTTTACAACATAAGATAGAATGGAGACCTGAATAATTCTGTGT 2069 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 408 GGAAATCCAATTAACAATTTTACAACATAAGATAGAATGGAGACCTGAATAATTCTGTGT 349 Qy 2070 AATATAAATGGTTTATAACTGCTTTTGTACCTAGCTAGGCTGCTATTATTACTATAATGA 2129 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 348 AATATAAATGGTTTATAACTGCTTTTGTACCTAGCTAGGCTGCTATTATTACTATAATGA 289 Qy 2130 GTAAATCATAAAGCCTTCATCACTCCCACATTTTTCTTACGGTCGGAGCATCAGAACAAG 2189 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 288 GTAAATCATAAAGCCTTCATCACTCCCACATTTTTCTTACGGTCGGAGCATCAGAACAAG 229 Qy 2190 CGTCTAGACTCCTTGGGACCGTGAGTTCCTAGAGCTTGGCTGGGTCTAGGCTGTTCTGTG 2249 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 228 CGTCTAGACTCCTTGGGACCGTGAGTTCCTAGAGCTTGGCTGGGTCTAGGCTGTTCTGTG 169 Qy 2250 CCTCCAAGGACTGTCTGGCAATGACTTGTATTGGCCACCAACTGTAGATGTATATATGGT 2309 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 168 CCTCCAAGGACTGTCTGGCAATGACTTGTATTGGCCACCAACTGTAGATGTATATATGGT 109 Qy 2310 GCCCTTCTGATGCTAAGACTCCAGACCTTTTGTTTTTGCTTTGCATTTTCTGATTTTATA 2369 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 108 GCCCTTCTGATGCTAAGACTCCAGACCTTTTGTTTTTGCTTTGCATTTTCTGATTTTATA 49 Qy 2370 CCAACTGTGTGGACTAAGATGCATTAAAATAAACATCAGAGTAACTCA 2417 |||||||||||||||||||||||||||||||||||||||||||||||| Db 48 CCAACTGTGTGGACTAAGATGCATTAAAATAAACATCAGAGTAACTCA 1 Nelles et al. teaches that gRNA spacer sequences that specifically bind to a target sequence of an RNA molecule encoding a PMP22 protein may comprise or consist of a nucleic acid having a sequence selected from any one of any one of SEQ ID NO: 4318 to SEQ ID NO: 6120 [0450]. Nelles et al. teaches SEQ ID NO: 5299 (designated as Db) which is complementary to positions 1412 through 1436 of instant SEQ ID NO: 25 (designated as Qy) as shown in the alignment below. Query Match 100.0%; Score 25; Length 26; Best Local Similarity 100.0%; Matches 25; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GGTGGGGGTTGCTGTTGATTGAAGA 25 ||||||||||||||||||||||||| Db 25 GGTGGGGGTTGCTGTTGATTGAAGA 1 It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the composition of Swayze et al., Choi et al., and Harper et al. wherein the mRNA segment is complementary to a sequence at specific positions of SEQ ID NO: 25 because Swayze et al., Choi et al., and Harper et al. taught compositions comprising rAAV in a pharmaceutically acceptable carrier and Nelles et al. taught sequences that specifically bind to a target sequence of an RNA molecule encoding a PMP22 protein. One of ordinary skill in the art would have made such a modification because it would have amounted to combining known prior art elements to yield predictable results. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to CHRISTINA TRAN whose telephone number is (571)270-0550. The examiner can normally be reached M-F 7:30 - 5:00pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /C.T./ Examiner, Art Unit 1637 /Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637
Read full office action

Prosecution Timeline

May 25, 2023
Application Filed
Jul 15, 2026
Non-Final Rejection mailed — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12649004
HIGHLY EFFICIENT TRANSDUCTION AND LATERAL SPREAD IN THE RETINA BY A NOVEL AAV VIRUS ENHANCED BY RATIONAL DESIGN
4y 10m to grant Granted Jun 09, 2026
Patent 12624362
MUTANT REVERSE TETRACYCLINE TRANSACTIVATORS FOR EXPRESSION OF GENES
5y 1m to grant Granted May 12, 2026
Patent 12584126
MICRORNA INHIBITORS FOR USE IN TREATING METABOLIC DISEASES
5y 3m to grant Granted Mar 24, 2026
Patent 12570707
CODON-OPTIMISED COMPLEMENT FACTOR I
4y 8m to grant Granted Mar 10, 2026
Patent 12545893
RECOMBINANT NERVOUS SYSTEM CELLS AND METHODS TO GENERATE THEM
4y 10m to grant Granted Feb 10, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
48%
Grant Probability
94%
With Interview (+45.5%)
4y 0m (~10m remaining)
Median Time to Grant
Low
PTA Risk
Based on 56 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month