Notice of Pre-AIA or AIA Status
1. The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Claim Status
2. Claims 1-15 are under consideration.
Information Disclosure Statement
3. The information disclosure statement (IDS) submitted on 28 November 2023 and 10 September 2025 were filed after the mailing date of the Instant Application on 30 May 2023. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
Claim Interpretation
4. The plasmid pGagPol-RRE-NES-cINT is being interpreted in light of the specification as a construct made by inserting the GagPol and Rev genes into an pcDNA5 base plasmid (Page 7, L17-21). In addition, in accordance with MPEP 2111.03.IV, the word ‘has’ is open to interpretation in light of the specification. As the specification does not define this term, Examiner is interpreting ‘has’ in claims 3 and 4 to be open claim language. The indefinite article ‘a’ allows for the interpretation of reading upon the full-length sequence or a fragment thereof. Therefore, Examiner is interpreting the sequences in claims 3 and 4 read upon the full-length or fragment thereof and may include additional amino acids/nucleotides not disclosed in the claimed SEQ ID NO’s.
It is noted that any interpretation of the claims set forth does not relieve Applicant of the responsibility of responding to this Office Action. If the actual interpretation of the claims is different than that posited by the Examiner, additional rejections and art may be readily applied in a subsequent final Office Action.
Claim Rejections - 35 USC § 112
5. The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
6. Claims 5-9 and 12-15 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding claims 5, 7-9 and 12-15, the claim language ‘preferably’ renders the limitations thereafter to have no patentable weight because it is unclear if the claim specifically requires such limitation(s) or not.
A broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). The claim(s) are considered indefinite because there is a question or doubt as to whether the feature introduced by such narrower language is (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claims.
Regarding claim 6, the limitation “i.e., stable lentivirus packaging cell lines” is indefinite since the usage of “i.e.,” is interpreted as “or the like”. Moreover, the phrase "i.e.," renders the claim(s) indefinite because the claim(s) include(s) elements not actually disclosed (those encompassed by "i.e.,"), thereby rendering the scope of the claim(s) unascertainable.
Claims 7-9, which depend from claim 6, do not remedy this deficiency and are similarly rejected.
Regarding claim 8, it is unclear if “both used in an amount” means that both plasmids must be the same concentration or if they can be two different numbers within the claimed range.
Regarding claim 15, it is unclear if “the enhancing agent is sodium butyrate” and “the time for collecting the lentivirus is 45-50 hours” are both mandatory limitations because of the ‘preferably’ limitations between the two.
Claim Rejections - 35 USC § 103
7. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
8. Claims 1, 5-6, 10-11, and 14 are rejected under 35 U.S.C. 103 as being unpatentable over Stewart (US 20190211358 A1; Published 11 July 2019) (See IDS filed 28 November 2023) in view of Milani (EMBO Mol. Med., 23 August 2017, 9(11): 1558-1573) (See PTO-892: Notice of References Cited).
Regarding claims 1, 5, and 10, Stewart teaches a stable cell line where HEK293T cells are transfected with a pPuro-coTeR plasmid (¶ [0366] and ¶ [0374]). Stewart also teaches a specific example with three separate plasmids for the GagPol, VSV-G, and Rev genes being transfected into the HEK293T-TeR cells (Example 5, ¶ [0371] and ¶ [0374]), but also teaches various plasmid constructions, with Figure 5 and Table 1 showing a set of plasmids with GagPol and Rev on one plasmid and VSV-G on another. Stewart also teaches that it is advantageous to codon optimize the vectors (¶ [0215]-[0217]). Stewart does not teach the GagPol and Rev genes on an pcDNA5 plasmid, as claimed.
However, Milani discloses GagPol and Rev on two separate pcDNA5/TO plasmids (Plasmid Construction).
Therefore, it would have been obvious to one of ordinary skill at the time of filing to take the genes and methods for lentivirus production of Stewart and further using the base plasmid of Milani with the GagPol and Rev genes to arrive at the three plasmids, as claimed. The combination of familiar elements is likely to be obvious when it does no more than yield predictable results. See KSR International Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395 – 97 (2007) (see MPEP § 2143, A.). A rationale to support a conclusion that a claim would have been obvious is that all the claimed elements were known in the prior art and one skilled in the art could have combined the elements as claimed by known methods with no change in their respective functions, and the combination would have yielded nothing more than predictable results to one of ordinary skill in the art. See KSR International Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395 (2007) (see MPEP §§ 2143, A. and 2143.02). One of ordinary skill in the art would have had a reasonable expectation of success for combining known lentivirus production and packaging genes into various common plasmid bases. There would have been a reasonable expectation of success given the underlying materials and methods are known, successfully demonstrated, and commonly used as evidenced by the applied prior art.
Regarding claim 6, Stewart further teaches that the HEK293T-TeR cells were made by transfecting linearized pPuro-coTeR plasmid and then using puromycin media (0.6 ug/ml) to select for the transfectants (¶ [0366]). The HEK293T-TeR cells were then transfected with linearized GagPol, Rev, and VSV-G plasmids, and the appropriate antibiotics were used to select for the transfectants (¶ [0368]). Stewart does not specifically teach the pPuro-coTeR and pVSVG plasmids being transfected at the same time.
However, it would have been obvious to one of ordinary skill at the time of filing to do the first transfection with or without pVSVG as changing the order of steps would have been obvious as the only thing it would affect is the combination of antibiotics in each media. This is supported by Ex parte Rubin, 128 USPQ 440 (Bd. App. 1959) (Prior art reference disclosing a process of making a laminated sheet wherein a base sheet is first coated with a metallic film and thereafter impregnated with a thermosetting material was held to render prima facie obvious claims directed to a process of making a laminated sheet by reversing the order of the prior art process steps.). See also In reBurhans, 154 F.2d 690, 69 USPQ 330 (CCPA 1946) (selection of any order of performing process steps is prima facie obvious in the absence of new or unexpected results); In reGibson, 39 F.2d 975, 5 USPQ 230 (CCPA 1930) (Selection of any order of mixing ingredients is prima facie obvious.).
Regarding claims 11 and 14, Stewart further teaches that doxycycline can be used to induce lentivirus production post-transfection (¶ [0376]).
9. Claim 2 is rejected under 35 U.S.C. 103 as being unpatentable over Stewart (Supra) and Milani (Supra) as applied to claims 1, 5-6, 10-11, and 14 above, and further in view of Johnson (US 20170145388 A1; Published 25 May 2017) (See IDS filed 28 November 2023).
Regarding claim 2, Stewart in view of Milani make the limitations of claim 1 obvious, as seen above in section 8. Stewart further teaches the GagPol, VSV-G, and Rev plasmids having two tetracycline operator sequences (¶ [0374]), each expression cassette having its own polyA region (¶ [0119]), as well as some common retroviral vector elements that can be included, such as CMV and SV40 promoters (¶ [0230]) and puromycin, bleomycin (part of Zeocin™), and hygromycin resistance genes (¶ [0279]). Stewart does not teach the chimeric intron, cPPT/CTS element, and RRE elements.
However, Johnson teaches that the nucleic acid vector can include a chimeric intron (¶ [0045]), cPPT sequence (¶ [0072]), and RRE sequence (¶ [0078]).
Therefore, it would have been obvious to one of ordinary skill at the time of filing to take the known vector element options of Stewart and Johnson and combine them. The combination of familiar elements is likely to be obvious when it does no more than yield predictable results. See KSR International Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395 – 97 (2007) (see MPEP § 2143, A.). A rationale to support a conclusion that a claim would have been obvious is that all the claimed elements were known in the prior art and one skilled in the art could have combined the elements as claimed by known methods with no change in their respective functions, and the combination would have yielded nothing more than predictable results to one of ordinary skill in the art. See KSR International Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395 (2007) (see MPEP §§ 2143, A. and 2143.02). One of ordinary skill in the art would have had a reasonable expectation of success for combining known vector components and genes. There would have been a reasonable expectation of success given the underlying materials and methods are known, successfully demonstrated, and commonly used as evidenced by the applied prior art.
10. Claim 3 is rejected under 35 U.S.C. 103 as being unpatentable over Stewart (Supra) and Milani (Supra) as applied to claims 1, 5-6, 10-11, and 14 above, and further in view of Bhinder (GB 2540786 A; published 1 February 2017) (See PTO-892: Notice of References Cited), Ohlmann (US 20190055288 A1; Priority to 20 October 2015) (See PTO-892: Notice of References Cited), Cawood (WO 2019058108 A1; Published 28 March 2019) (See PTO-892: Notice of References Cited), and Nie (CN 105602935 A; Published 25 May 2016) (See PTO-892: Notice of References Cited).
Regarding claim 3, Stewart in view of Milani make the limitations of claim 1 obvious, as seen above in section 8. Stewart nor Milani teaches the specific SEQ ID NOs for the genes used in the plasmids.
However, Bhinder teaches SEQ ID NO: 3 (‘Db’), a codon optimized TetR sequence, which matches SEQ ID NO: 1 of the Instant Application (‘Qy’):
Query Match 100.0%; Score 624; Length 624;
Best Local Similarity 100.0%;
Matches 624; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 ATGTCTAGGCTGGACAAGTCCAAGGTGATCAACTCCGCCCTGGAGCTCCTTAACGAGGTG 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 ATGTCTAGGCTGGACAAGTCCAAGGTGATCAACTCCGCCCTGGAGCTCCTTAACGAGGTG 60
Qy 61 GGGATTGAAGGGTTGACTACCCGGAAACTGGCTCAGAAACTGGGCGTCGAACAGCCAACC 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 61 GGGATTGAAGGGTTGACTACCCGGAAACTGGCTCAGAAACTGGGCGTCGAACAGCCAACC 120
Qy 121 CTGTACTGGCACGTGAAGAACAAGCGCGCTTTGCTGGATGCACTTGCCATCGAGATGCTG 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 121 CTGTACTGGCACGTGAAGAACAAGCGCGCTTTGCTGGATGCACTTGCCATCGAGATGCTG 180
Qy 181 GACAGGCACCACACACACTTTTGCCCCTTGGAGGGCGAATCCTGGCAGGACTTCCTGAGG 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 181 GACAGGCACCACACACACTTTTGCCCCTTGGAGGGCGAATCCTGGCAGGACTTCCTGAGG 240
Qy 241 AACAACGCCAAGAGTTTCCGCTGTGCCCTGTTGAGTCACAGGGACGGAGCAAAGGTTCAC 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 241 AACAACGCCAAGAGTTTCCGCTGTGCCCTGTTGAGTCACAGGGACGGAGCAAAGGTTCAC 300
Qy 301 CTTGGAACCAGACCCACCGAGAAGCAGTACGAGACTCTGGAGAACCAGCTGGCCTTCCTG 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 301 CTTGGAACCAGACCCACCGAGAAGCAGTACGAGACTCTGGAGAACCAGCTGGCCTTCCTG 360
Qy 361 TGTCAGCAGGGCTTTAGCCTGGAGAACGCTCTGTACGCACTGTCTGCCGTTGGCCACTTT 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 361 TGTCAGCAGGGCTTTAGCCTGGAGAACGCTCTGTACGCACTGTCTGCCGTTGGCCACTTT 420
Qy 421 ACACTCGGATGCGTGCTGGAAGACCAGGAGCATCAGGTTGCCAAGGAAGAGAGGGAGACC 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 421 ACACTCGGATGCGTGCTGGAAGACCAGGAGCATCAGGTTGCCAAGGAAGAGAGGGAGACC 480
Qy 481 CCTACCACTGACAGCATGCCTCCACTTCTGAGACAGGCCATCGAGCTCTTTGACCACCAG 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 481 CCTACCACTGACAGCATGCCTCCACTTCTGAGACAGGCCATCGAGCTCTTTGACCACCAG 540
Qy 541 GGAGCAGAACCCGCTTTCCTCTTCGGGCTGGAACTGATCATCTGCGGCCTCGAAAAGCAG 600
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 541 GGAGCAGAACCCGCTTTCCTCTTCGGGCTGGAACTGATCATCTGCGGCCTCGAAAAGCAG 600
Qy 601 CTCAAGTGCGAAAGCGGCAGCTGA 624
||||||||||||||||||||||||
Db 601 CTCAAGTGCGAAAGCGGCAGCTGA 624
Ohlmann teaches SEQ ID NO: 28 (‘Db’), a VSVG protein sequence, which matches SEQ ID NO: 2 (‘Qy’) of the Instant Application:
Query Match 100.0%; Score 1536; Length 1536;
Best Local Similarity 100.0%;
Matches 1536; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
The sequence alignment has been omitted due to its long length.
Cawood teaches SEQ ID NO: 5 (‘Db’), a HIV GagPol gene, which matches SEQ ID NO: 3 of the Instant Application (‘Qy’):
Query Match 100.0%; Score 4307; Length 4307;
Best Local Similarity 100.0%;
Matches 4307; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
The sequence alignment has been omitted due to its long length.
Nie teaches SEQ ID NO: 5 (‘Db’), a HIV 1 Rev gene, which matches SEQ ID NO: 4 of the Instant Application (‘Qy’):
Query Match 100.0%; Score 30; Length 30;
Best Local Similarity 100.0%;
Matches 30; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 CTACCACCGCTTGAGAGACTTACTCTTGAT 30
||||||||||||||||||||||||||||||
Db 1 CTACCACCGCTTGAGAGACTTACTCTTGAT 30
Although all the sequences are from different references, one of ordinary skill at the time of filing would have been able to insert these genes into the respective plasmids arrived at by the combined teachings of Steward and Milani and as described in claims 1and 3. It is standard and known within the art to insert and optimize gene sequences into base plasmids. This combination of genes is also well-known in the art to be used together for lentivirus packaging cell lines. The combination of familiar elements is likely to be obvious when it does no more than yield predictable results. See KSR International Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395 – 97 (2007) (see MPEP § 2143, A.). A rationale to support a conclusion that a claim would have been obvious is that all the claimed elements were known in the prior art and one skilled in the art could have combined the elements as claimed by known methods with no change in their respective functions, and the combination would have yielded nothing more than predictable results to one of ordinary skill in the art. See KSR International Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395 (2007) (see MPEP §§ 2143, A. and 2143.02). One of ordinary skill in the art would have had a reasonable expectation of success for combining known vector components and genes. There would have been a reasonable expectation of success given the underlying materials and methods are known, successfully demonstrated, and commonly used as evidenced by the applied prior art.
11. Claim 4 is rejected under 35 U.S.C. 103 as being unpatentable over Stewart (Supra) and Milani (Supra) as applied to claims 1, 5-6, 10-11, and 14 above, and further in view of Reiser (Addgene plasmid #18659; http://n2t.net/addgene:18659; RRID:Addgene_18659; Published 2005, Accessed 02 January 2026), Weinburg1 (Addgene plasmid #8454; http://n2t.net/addgene:8454; RRID:Addgene_8454; Published 2003, Accessed 02 January 2026), and Weinburg2 (Addgene plasmid #8455; http://n2t.net/addgene:8455; RRID:Addgene_8455; Published 2003, Accessed 02 January 2026).
Regarding claim 4, Stewart in view of Milani make the limitations of claim 1 obvious, as seen above in section 8, including codon optimizing the vector components. Stewart nor Milani teaches the specific sequences for the plasmids described.
However, Resier teaches a pNL-EGFP/TREPittdU3 lentivirus plasmid, which contains a TetR gene and partially matches SEQ ID NO: 5 of the Instant Application:
Query Match 32.8%; Score 1976.2; DB 1; Length 9159;
Best Local Similarity 99.8%;
Matches 1989; Conservative 0; Mismatches 3; Indels 1; Gaps 1;
The sequence alignment has been omitted due to its long length.
Weinburg1 teaches a pCMV-VSV-G lentivirus envelope plasmid, which partially matches SEQ ID NO: 6 of the Instant Application, that is to be used in conjunction with a transfer plasmid (such as pCMV-dR8.2 dvpr below):
Query Match 32.3%; Score 2136.4; DB 1; Length 6507;
Best Local Similarity 99.8%;
Matches 2150; Conservative 0; Mismatches 1; Indels 3; Gaps 1;
The sequence alignment has been omitted due to its long length.
Weinburg2 is part of the same study as Weinburg1 and teaches a pCMV-dR8.2 dvpr lentivirus packaging plasmid with GagPol and Rev that is meant to be used in conjunction with the pCMV-VSV-G envelope plasmid above:
Query Match 40.6%; Score 5199; DB 1; Length 13380;
Best Local Similarity 89.0%;
Matches 5958; Conservative 0; Mismatches 10; Indels 723; Gaps 3;
The sequence alignment has been omitted due to its long length.
Therefore, it would have been obvious to one of ordinary skill at the time of filing to take the methods of Stewart and Milani and further use the specific plasmid sequences as taught in Resier and Weinburg1 & 2. The combination of familiar elements is likely to be obvious when it does no more than yield predictable results. See KSR International Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395 – 97 (2007) (see MPEP § 2143, A.). A rationale to support a conclusion that a claim would have been obvious is that all the claimed elements were known in the prior art and one skilled in the art could have combined the elements as claimed by known methods with no change in their respective functions, and the combination would have yielded nothing more than predictable results to one of ordinary skill in the art. See KSR International Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395 (2007) (see MPEP §§ 2143, A. and 2143.02). One of ordinary skill in the art would have had a reasonable expectation of success for combining known vector components and genes. There would have been a reasonable expectation of success given the underlying materials and methods are known, successfully demonstrated, and commonly used as evidenced by the applied prior art.
12. Claims 7-8 and 12-13 are rejected under 35 U.S.C. 103 as being unpatentable over Stewart (Supra) and Milani (Supra) as applied to claims 1, 5-6, 10-11, and 14 above, and further in view of Tang (Oncol Lett., 7 November 2014, 9(1): 55-62) (See PTO-892: Notice of References Cited).
Regarding claims 7-8 and 12-13, Stewart in view of Milani make the limitations of claim 1 obvious, as seen above in section 8. Stewart further teaches that PEI can be used during the transfection process (¶ [0323]). Stewart nor Milani teaches the specific ratios of plasmids to cells or plasmids to PEI.
However, Tang teaches optimizing the plasmid DNA concentration for PEI-mediated lentivirus production, which did not result a significant difference in lentivirus titer (Optimization of DNA quality for PEI-mediated LvV production).
It would further be obvious that the ratio of plasmids to cells and plasmids to PEI are clearly a result effective parameter that a person of ordinary skill in the art would routinely optimize. Optimization of parameters is a routine practice that would be obvious for a person of ordinary skill in the art to employ. It would have been customary for an artisan of ordinary skill to determine the optimal amount of each ingredient needed to achieve the desired results. The principle of law states from MPEP 2144.05: "The normal desire of scientists or artisans to improve upon what is already generally known provides the motivation to determine where in a disclosed set of percentage ranges is the optimum combination of percentages." (Peterson, 315 F.3d at 1330, 65 USPQ2d at 1382); Generally, differences in concentration or temperature will not support the patentability of subject matter encompassed by the prior art unless there is evidence indicating such concentration or temperature is critical. "[W]here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation." (In re Aller, 220 F.2d 454, 456, 105 USPQ 2).
13. Claim 9 is rejected under 35 U.S.C. 103 as being unpatentable over Stewart (Supra) and Milani (Supra) as applied to claims 1, 5-6, 10-11, and 14 above, and further in view of ThermoFisher (Zeocin Protocol, Wayback Machine to 22 April 2019) (See PTO-892: Notice of References Cited).
Regarding claim 9, Stewart in view of Milani make the limitations of claim 1 and 6 obvious, as seen above in section 8. Stewart further teaches using a puromycin concentration of 0.6 ug/mL (¶ [0366]) and Zeocin™ (¶ [0368]), but does not specify the concentration. However, ThermoFisher teaches that Zeocin™ is part of the bleomycin/phleomycin family (Overview) and can be used in mammalian cell selection, wherein the concentration ranges from 50 to 1000 ug/mL, with the average concentration being 250 to 400 ug/mL (Zeocin™ Selection in Mammalian Cells, Introduction). This average concentration range is fully within the 300-500 ug/mL of bleomycin that is claimed.
As for the concentration of puromycin, antibiotic concentrations in the media for screening are result-effective and the claimed range can be achieved through routine optimization. It would further be obvious that the amount of puromycin used in the screening media is clearly a result effective parameter that a person of ordinary skill in the art would routinely optimize. Optimization of parameters is a routine practice that would be obvious for a person of ordinary skill in the art to employ. It would have been customary for an artisan of ordinary skill to determine the optimal amount of each ingredient needed to achieve the desired results. The principle of law states from MPEP 2144.05: "The normal desire of scientists or artisans to improve upon what is already generally known provides the motivation to determine where in a disclosed set of percentage ranges is the optimum combination of percentages." (Peterson, 315 F.3d at 1330, 65 USPQ2d at 1382); Generally, differences in concentration or temperature will not support the patentability of subject matter encompassed by the prior art unless there is evidence indicating such concentration or temperature is critical. "[W]here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation." (In re Aller, 220 F.2d 454, 456, 105 USPQ 2).
Therefore, it would be obvious to one of ordinary skill at the time of filing to take the methods of Stewart and Milani and further optimize the concentration of puromycin to select for the HEK293-TetR cells, then use the recommended concentration of Zeocin™ from ThermoFisher to select for the packaging cell lines.
14. Claim 15 is rejected under 35 U.S.C. 103 as being unpatentable over Stewart (Supra) and Milani (Supra) as applied to claims 1, 5-6, 10-11, and 14 above, and further in view of Cribbs (BMC Biotechnol., 12 November 2013, 13:98) (See PTO-892: Notice of References Cited).
Regarding claim 15, Stewart in view of Milani make the limitations of claim 1 and 10 obvious, as seen above in section 8. Stewart further teaches that sodium butyrate was added post-transfection (¶ [0373]) but does not discuss the importance of adding it. However, Cribbs teaches that sodium butyrate has been shown to function as an enhancer of mammalian cell transfection efficiency (Results and Discussion, ¶ 1). Therefore, one of ordinary skill at the time of filing would have known to add sodium butyrate to the teachings of Stewart and Milani in order to enhance lentiviral expression.
Conclusion
15. No claim is allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to KRISTINA E LY whose telephone number is (571)272-5169. The examiner can normally be reached Monday - Thursday, 8:00 am - 5:00 pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Michael Allen can be reached at (571) 270-3497. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/KRISTINA E. LY/Examiner, Art Unit 1671
/BENJAMIN P BLUMEL/Primary Examiner, Art Unit 1671