Prosecution Insights
Last updated: April 19, 2026
Application No. 18/039,687

NOVEL REPLICATION DEFICIENT INFLUENZA A VIRUS INDUCING HIGH LEVELS OF TYPE I INTERFERON

Non-Final OA §103
Filed
May 31, 2023
Examiner
ALAM, DANYAL HASSAN
Art Unit
1672
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Bluesky Immunotherapies GmbH
OA Round
1 (Non-Final)
100%
Grant Probability
Favorable
1-2
OA Rounds
3y 2m
To Grant
0%
With Interview

Examiner Intelligence

Grants 100% — above average
100%
Career Allow Rate
1 granted / 1 resolved
+40.0% vs TC avg
Minimal -100% lift
Without
With
+-100.0%
Interview Lift
resolved cases with interview
Typical timeline
3y 2m
Avg Prosecution
21 currently pending
Career history
22
Total Applications
across all art units

Statute-Specific Performance

§101
9.1%
-30.9% vs TC avg
§103
43.9%
+3.9% vs TC avg
§102
10.6%
-29.4% vs TC avg
§112
30.3%
-9.7% vs TC avg
Black line = Tech Center average estimate • Based on career data from 1 resolved cases

Office Action

§103
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Priority This is a National Stage Entry under 35 U.S.C. 371 of International Patent Application No. PCT/EP2021/083534, filed November 30, 2021, which claims foreign priority to EP20210630.8, filed November 30, 2020. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 1-5, 12, 13, 17, 18, 20, 21 and 22 are rejected under 35 U.S.C. 103 as being unpatentable over Wolschek et al. (U.S. Application No. US 2010/0136052A1, hereinafter, “Wolschek”). Regarding claims 1 - 3, 17, and 18, Wolschek teaches a replicant deficient influenza virus with a NS1 protein corresponding with at least 10 amino acids modified, which can include deletion, in the first 74 amino acids of the N terminus (Page 58, Col 1, Claim 1 – 2). The overlapping sequence from Wolschek ("Db" in figure below), designated “deINS1-IL-2-10 segment” (Page 25, Col 2, Para 0025), and instant SEQ ID NO:2 (“Qy” in figure below) share 84.6% identity with a deletion of at least N-terminal 80 amino acids satisfying instant claim 1’s recitation of a deletion of at least 15 of the first 80 N-terminal amino acids of the NS1 protein. The sequence deletion taught by Wolschek overlaps with the recited deletion in instant claims 2 and 3. Regarding claims 17 and 18 Wolschek teaches the nucleic acid sequence that codes for the same amino acids sequence claimed in the instant application. Query Match 61.6%; Score 547.8; Length 1101; Best Local Similarity 99.6%; Matches 549; Conservative 0; Mismatches 2; Indels 0; Gaps 0; Qy 340 TCATACCCAAGCAGAAAGTGGCAGGCCCTCTTTGTATCAGAATGGACCAGGCGATCATGG 399 | ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 551 TGATAACCAAGCAGAAAGTGGCAGGCCCTCTTTGTATCAGAATGGACCAGGCGATCATGG 610 Qy 400 ATAAGAACATCATACTGAAAGCGAACTTCAGTGTGATTTTTGACCGGCTGGAGACTCTAA 459 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 611 ATAAGAACATCATACTGAAAGCGAACTTCAGTGTGATTTTTGACCGGCTGGAGACTCTAA 670 Qy 460 TATTGCTAAGGGCTTTCACCGAAGAGGGAGCAATTGTTGGCGAAATTTCACCATTGCCTT 519 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 671 TATTGCTAAGGGCTTTCACCGAAGAGGGAGCAATTGTTGGCGAAATTTCACCATTGCCTT 730 Qy 520 CTCTTCCAGGACATACTGCTGAGGATGTCAAAAATGCAGTTGGAGTCCTCATCGGGGGAC 579 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 731 CTCTTCCAGGACATACTGCTGAGGATGTCAAAAATGCAGTTGGAGTCCTCATCGGGGGAC 790 Qy 580 TTGAATGGAATGATAACACAGTTCGAGTCTCTGAAACTCTACAGAGATTCGCTTGGAGAA 639 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 791 TTGAATGGAATGATAACACAGTTCGAGTCTCTGAAACTCTACAGAGATTCGCTTGGAGAA 850 Qy 640 GCAGTAATGAGAATGGGAGACCTCCACTCACTCCAAAACAGAAACGAGAAATGGCGGGAA 699 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 851 GCAGTAATGAGAATGGGAGACCTCCACTCACTCCAAAACAGAAACGAGAAATGGCGGGAA 910 Qy 700 CAATTAGGTCAGAAGTTTGAAGAAATAAGATGGTTGATTGAAGAAGTGAGACACAAACTG 759 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 911 CAATTAGGTCAGAAGTTTGAAGAAATAAGATGGTTGATTGAAGAAGTGAGACACAAACTG 970 Qy 760 AAGATAACAGAGAATAGTTTTGAGCAAATAACATTTATGCAAGCCTTACATCTATTGCTT 819 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 971 AAGATAACAGAGAATAGTTTTGAGCAAATAACATTTATGCAAGCCTTACATCTATTGCTT 1030 Qy 820 GAAGTGGAGCAAGAGATAAGAACTTTCTCGTTTCAGCTTATTTAATAATAAAAAACACCC 879 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1031 GAAGTGGAGCAAGAGATAAGAACTTTCTCGTTTCAGCTTATTTAATAATAAAAAACACCC 1090 Qy 880 TTGTTTCTACT 890 ||||||||||| Regarding claim 4, Wolschek teaches PA, PB1, PB2, HA, NA, M and NP segments derived from Vero-cell adapted influenza A H1N1 virus strain (GHB01) that are cloned into the truncated NS1 IAV (Page 31, Col 1, Para 131). Regarding claim 5, Wolschek teaches a pharmaceutically acceptable carrier that can be used in a preparation (Page 30, Col 1, Para 111). Regarding claims 12 and 13 Wolschek teaches using an inhaler to deliver the truncated NS1 influenza A virus with an aerosolizing agent (Page 30, Col 1, Para 109). Regarding claims 20, 21, and 22 Wolschek teaches systemic administration of the truncated NS1 influenza A virus using an inhaler or nebulizer (Page 30, Col 1, Para 109). In view of the foregoing, all the claimed limitations are found in one reference and are taught to be optional variations to a ‘base’ method they exemplify. As such, the claimed invention is within the scope of Wolschek, and thus Wolschek renders the invention prima facie obvious. The rationale to support this conclusion of obviousness is that Wolschek provides a teaching, suggestion, and motivation to substitute different variables disclosed within the reference. Furthermore, there is no evidence on the record that indicates that the claimed supplement exhibits any unexpected results compared to the prior art. Accordingly, the claimed invention was prima facie obvious to one of ordinary skill in the art at the time of filing especially in the absence of evidence to the contrary. Claims 7, 14, 15, and 19 are rejected under 35 U.S.C. 103 as being unpatentable over Wolschek as applied to claim 1 - 5, 12, 13, 17, 18, 20, 21 and 22 above, and further in view of Martinez-Sobrido et al. (US20200206341A1, hereinafter, "Martinez-Sobrido"). As discussed above, claims 1 - 5, 12, 13, 17, 18, 20, 21 and 22 were rendered prima facie obvious by the teachings of Wolschek. The reference fails to teach a prophylactic or therapeutic treatment of an infection caused by IFN-sensitive viruses by a truncated NS1 IAV combined with an active substance, or to a subject, which can be a human, dog, cat, horse, camelid, cow or pig, who is at risk of infection from an IFN-sensitive virus. However, regarding claims 7 and 19, Martinez-Sobrido teaches the use of a canine influenza virus (CIV), a member of the influenza A virus family, comprising a truncated NS1 region as a treatment and preventive measure against the IFN-sensitive CIV in dogs (Page 8, Fig 7). Regarding claims 14 and 15, Martinez-Sobrido teaches the administration of truncated NS1 IAV and a biologically active agent delivered nasally (Page 25, Col 1, Para 0126) to dogs (Page 24, Col 1, Para 119). Wolschek and Martinez-Sobrido are considered to be analogous to the claim invention because they are in the same field of using modified IAVs with truncated NS1 regions to therapeutically or prophylactically treat conditions caused by IFN-sensitive virus. Therefore, it would have been prima facie obvious before the effective filing date of the claimed invention to utilize the product taught by Wolschek in the method taught by Martinez-Sobrido because doing so would advantageously permit prophylactic and therapeutic treatment for infections caused by IFN-sensitive viruses. One of ordinary skill in the art would have had a reasonable expectation of success of using a truncated NS1 IAV to treat IFN- sensitive viruses and related physiological symptoms and conditions associated with infection via intranasal delivery with other biologically active agents given that this method was well known, has been successfully demonstrated, and commonly used as evidence by the prior art. Accordingly, the claimed invention was prima facie obvious to one of ordinary skill in the art at the time of filing especially in the absence of evidence to the contrary. Claims 8-9 are rejected under 35 U.S.C. 103 as being unpatentable over Wolschek and Martinez-Sobrido, as applied to claims 7, 14, 15, and 19 above, and further in view of Chen et al. (US20190125858A1, hereinafter, “Chen”). As discussed above, claims 7, 14, 15, and 19 were rendered prima facie obvious by the teachings of Wolschek and Martinez-Sobrido. The references fail to teach the IFN-sensitive virus of interest can be a coronavirus, including MERS-CoV. However, regarding claims 8 and 9, Chen teaches the use of truncated NS1 IAV as a prophylactic or therapeutic treatment, for the treatment of MERS-CoV, a coronavirus (Page 13, Fig 12; Page 16, Col 1, Para 0025). Wolschek, Martinez-Sobrido, and Chen are considered to be analogous to the claim invention because they are in the same field of using modified IAV with truncated NS1 regions to therapeutically or prophylactically treat conditions caused by IFN-sensitive virus. Therefore, it would have been prima facie obvious before the effective filing date of the claimed invention to modify Wolschek and Martinez-Sobrido according to Chen in order to advantageously increase the therapeutic utility of Wolschek and Martinez-Sobrido with a reasonable expectation of success since Chen teaches that the use of truncated NS1 IAV as a prophylactic and therapeutic treatment was well known in the field for MERS-CoV and other SARS viruses. Accordingly, the claimed invention was prima facie obvious to one of ordinary skill in the art at the time of filing especially in the absence of evidence to the contrary. Claims 10-11 are rejected under 35 U.S.C. 103 as being unpatentable over Wolschek, Martinez-Sobrido, and Chen as applied to claims 8-9 above, and further in view of Wu et al. (Nature, 2020, hereinafter “Wu”). As discussed above, claims 8-9 were rendered prima facie obvious by the teachings of Wolschek, Martinez-Sobrido, and Chen. As further discussed above, Chen teaches the use of truncated NS1 IAV as a prophylactic or therapeutic treatment for the treatment of MERS-CoV, a coronavirus. Chen also teaches the use of truncated NS1 IAV to treat pneumonia caused or associated with MERS-CoV (Page 13, Fig 12). The references do not teach treatment of a condition caused by SARS-Cov-2. However, Wu teaches that SARS-CoV-2 is a SARS virus that shares many similarities with other virulent coronaviridae. It would have been prima facie obvious before the effective filing date of the claimed invention to modify Wolschek, Martinez-Sobrido, and Chen because doing so would advantageously permit prophylactic and therapeutic treatment for infections SARS-CoV2. It would have been obvious for one of ordinary skill in the art to apply truncated NS1 IAV treatment to SARS-CoV-2, an IFN- sensitive virus closely related to MERS-CoV and other SARS virus, and related physiological symptoms and conditions associated with infection given that this method is well known, has been successfully demonstrated, and commonly used in the prior art for SARS viruses. Accordingly, the claimed invention was prima facie obvious to one of ordinary skill in the art at the time of filing especially in the absence of evidence to the contrary. Conclusion NO CLAIMS ARE ALLOWED Any inquiry concerning this communication or earlier communications from the examiner should be directed to DANYAL H ALAM whose telephone number is (571)272-1102. The examiner can normally be reached M - F 9am - 5pm. Examiner interviews are available via telephone and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Thomas J Visone can be reached at 571-270-0684. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /DANYAL HASSAN ALAM/Examiner, Art Unit 1672 /THOMAS J. VISONE/Supervisory Patent Examiner, Art Unit 1672
Read full office action

Prosecution Timeline

May 31, 2023
Application Filed
Dec 11, 2025
Non-Final Rejection — §103 (current)

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
100%
Grant Probability
0%
With Interview (-100.0%)
3y 2m
Median Time to Grant
Low
PTA Risk
Based on 1 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month