Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Priority
Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged.
Information Disclosure Statement
The information disclosure statements (IDS) submitted on 01/02/2026 and 04/24/2025 are in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statements are being considered by the examiner.
Election/Restrictions
Applicant’s election without traverse of Group II drawn to method of treating myotonic dystrophy comprising administering a composition comprising a nucleic acid encoding a PUF or PUMBY polypeptide capable of binding without cleaving a toxic target CUG repeat RNA sequence in the reply filed on 01/02/2026 is acknowledged.
Status of claims
Claims 1, 9-11, 16-26, 31-33, 37, 40-43 and 45 are pending and under exam. Claims 46-47, 52-54 are withdrawn.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claim 1 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement.
The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
The claim broadly recites a nucleic acid encoding any PUF domain which are known in the art to be extremely variable for any given sequence (such as the claimed CUG). However, the specification does not reasonably convey to a person of ordinary skill in the art that the inventors were in possession of the full scope of PUF or PUMBY polypeptides encompassed by the claim.
It is generally known in the art that PUF domains are extremely diverse and modular class of RNA-binding proteins. For example, Abil et al (J. Bio Eng, 2014; See IDS of 04/24/2025) developed a repeat module library that is potentially capable of generating a PUF domain with any desired specificity. (See Abil Abstract). As such Abil taught that PUF domains can be assembled in a modular fashion from interchangeable repeat units and that numerous distinct PUF variants can be generated to recognize a given RNA sequence by altering amino acid residues at key RNA-contacting positions.
In view of this known diversity the specification’s disclosure of only limited PUF embodiments is insufficient to demonstrate possession of entire genus of “PUF or PUMBY polypeptides capable of binding toxic CUG repeat RNA sequence.” The specification does not describe representative species spanning the full scope of the claimed genus, nor does it identify common structural features that would allow a person of ordinary skill in the art to recognize which PUF or PUMBY variants fall within the claim.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1, 11 and 20 are rejected under 35 U.S.C. 103 as being unpatentable over Zhang et al (Mol Ther. 2014 Feb; hereinafter "Zhang;" See IDS filed 04/24/2025) in view of Zhao et al (Nucleic Acids Res. 2018 May 18; hereinafter "Zhao;" See IDS filed 04/24/2025) and Zacksenhaus (Mol Cell Biol. 1993 Aug; hereinafter "Zacksenhaus;" See PTO-892).
Regarding claim 1: Zhang “developed artificial site-specific RNA endonucleases (ASREs) that specifically bind and cleave (CUG)n repeats RNA.” (See Zhang Abstract). Zhang “generated one ASRE that can target the expanded RNA repeats in DM1 patient cells and specifically degrade the pathogenic DMPK messenger RNAs with minimal effect on wild-type alleles. Such ASRE treatment significantly decreased the number of nuclear foci in DM1 patient cells and can reverse the missplicing of many genes affected in DM1 patients.” (See Zhang Abstract). It is also noted that Zhang used a “FLAG epitope tag for protein detection and a nuclear localization sequence (PKKKRKV) to facilitate the import of ARSEs into the nucleus where the (CUG)n repeats accumulate.“ (See Zhang p. 313, col. 2, para 3). It is noted that Zhang did not teach or suggest use of a PUF domain that binds RNA without cleavage as required by the claim.
Zhao “created ESFs (engineered splicing factors) targeting RNAs of different length by fusing these engineered PUF domains with the arginine/serine-rich (RS) domain of SRSF7 splicing factor that promotes exon inclusion.” (See Zhao p. 4775-4776, col. 1, first para). Zhao included a nuclear localization sequence to direct the ESFs to the nucleus and a Flag tag to facilitate the detection of the ESFs. By co-transfecting HEK-293T cells with plasmids expressing the ESFs and a splicing reporter containing the cognate RNA sequences in an alternatively spliced cassette exon, Zhao tested the activities of the new ESFs. Alternative splicing levels measured by RT-PCR using the total RNAs purified from the transfected cells as templates and primer pairs targeting the GFP exons of the reporter showed obviously enhanced inclusion of the cassette exon compared to those with the corresponding PUF domain alone, indicating our engineered PUF domains could be utilized to construct artificial factors that efficiently manipulate splicing. Zhao noted that the ESF containing PUF-9R affected splicing more efficiently than that with the native PUF-8R, while increasing PUF repeat numbers beyond nine did not always enhance the splicing. Furthermore, the efficiency of the engineered ESFs to some noncognate RNA targets was also consistent with their binding affinities (Figures 1F and 2C), indicating that the length of RNA targets may affect the splicing efficiency as well.” (See Zhao p. 4775-4776, col. 1, first para; Figures 1 and 2).
As such one of ordinary skill in the art would have been motivated to use the PUF domain alone without cleavage activity, comprising specificity to CUG repeats to reverse alternative splicing defects such as those observed in myotonic dystrophy. It is however noted that the combination of Zhang and Zhao did not teach or suggest use of Rb NLS for directing the PUF domain to nucleus. However, Zacksenhaus discovered a peptide at the C-terminal of retinoblastoma gene product which had a sequence similarity to known bipartite nuclear localization signals (NLSs), abrogation of which lead to protein being restricted to cytoplasm. (See Zacksenhaus Abstract). It is also noted that Zacksenhaus used the NLS to demonstrate nuclear localization of non-retinoblastoma gene products (Such as beta-galactosidase-C-terminally tagged with NLS, Fig. 4). As such one of ordinary skill would have been motivated to use the NLS identified by Zacksenhaus to direct a protein of interest to the nucleus.
It is submitted that a person of ordinary skill in the art would have been motivated to modify the PUF-based construct of Zhang by omitting the nuclease domain and relying on RNA binding without cleavage in view of teachings of Zhao that non-cleaving PUF constructs can efficiently manipulate alternative splicing. The motivation is reinforced by known therapeutic objective in myotonic dystrophy of correcting splicing defects caused by CUG repeat RNA, which Zhao showed can be achieved by binding and transport to nucleus rather than by degradation of RNA. Additionally the person would have been motivated to use a known effective NLS such as Rb-NLS taught by Zacksenhaus to ensure nuclear delivery of the modified PUF construct as the nuclear localization is required for interaction with the CUG repeat RNA. The person would have reasonable expectation of success in making these modifications as Zhang established that PUF domains can be engineered to bind CUG repeat RNA in the nucleus and Zhao demonstrated that the binding only PUF constructs localized to the nucleus modulate splicing without RNA cleavage. Additionally Zacksenhaus demonstrated that Rb NLS reliably transports proteins to the nucleus. The combination involves substitution of known elements and does not require undue experimentation or unpredictable results.
It is submitted that the claimed invention would have been obvious to a person of ordinary skill in the art in view of the cited references.
Regarding claim 11: Zhang disclosed a CUG repeat comprising UGCUGCUG which is 100% identical to SEQ ID NO: 453. (See Zhang p. 313 col. 1, para 2).
Regarding claim 20: Zacksenhaus C-terminally tagged beta galactosidase with Rb NLS, indicating that the signal peptide should be positioned at the C-terminus of the gene of interest. As such one of ordinary skill in the art would have found it obvious to tag Rb NLS at the C-terminus in view of the teachings of Zacksenhaus.
Claims 16 and 18-19 are rejected under 35 U.S.C. 103 as being unpatentable over Zhang et al (Mol Ther. 2014 Feb; hereinafter "Zhang;" See IDS filed 04/24/2025) in view of Zhao et al (Nucleic Acids Res. 2018 May 18; hereinafter "Zhao;" See IDS filed 04/24/2025) and Zacksenhaus (Mol Cell Biol. 1993 Aug; hereinafter "Zacksenhaus;" See PTO-892); further in view of Chen et al (Adv Drug Deliv Rev. 2013 Oct; hereinafter "Chen;" See PTO-892).
Regarding claim 16: Further Chen taught that “Flexible linkers (GGGGS)n with different copy numbers (n =1, 2, or 4) were inserted to test the optimal distance” It is noted that SEQ ID NO: 414 is a GGGGS with n = 2. A person of ordinary skill in the art would have been motivated to add use the claimed well known linkers in view of the teachings of Chen to provide optimal spatial separation of various domains.
Regarding claims 18 and 19: The teachings of Zhang in view of Zhao and Zacksenhaus are set forth above. It is noted that Zacksenhaus taught that the NLS of Rb comprises KRSAEGGNPPKPLKKLR. It is noted however, the SEQ ID NO: 543 required 4 more amino acids at the N-terminus of the NLS sequence taught by Zacksenhaus. Chen taught that “[t]he length of the linkers can be easily adjusted by changing the copy number to achieve an optimal distance between domains. As a result, rigid linkers are chosen when the spatial separation of the domains is critical to preserve the stability or bioactivity of the fusion proteins.” The specification fails to provide any unexpected benefit realized from addition of the amino acids to the linker sequence. It is submitted that addition of the amino acids to the C-term of retinoblastoma gene product immediately preceding the NLS is routine in view of Chen. A person of ordinary skill in the art would have been motivated to add the residues in view of the teachings of Chen that linkers provide spatial separation of domains and may be critical to the stability of the domains (in this case NLS).
Similar rejection applies to SEQ ID NO: 604 (claim 19) as the claimed sequence is 100% identical to the C-terminus of retinoblastoma gene product (See alignment below), which encodes the known NLS.
Query 1 GACCGTGTGCTCAAAAGAAGTGCTGAAGGAAGCAACCCTCCTAAACCACTGAAAAAACTA 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 174858 GACCGTGTGCTCAAAAGAAGTGCTGAAGGAAGCAACCCTCCTAAACCACTGAAAAAACTA 174917
Query 61 CGC 63
|||
Sbjct 174918 CGC 174920
Claims 21-25 are rejected under 35 U.S.C. 103 as being unpatentable over Zhang et al (Mol Ther. 2014 Feb; hereinafter "Zhang;" See IDS filed 04/24/2025) in view of Zhao et al (Nucleic Acids Res. 2018 May 18; hereinafter "Zhao;" See IDS filed 04/24/2025) and Zacksenhaus (Mol Cell Biol. 1993 Aug; hereinafter "Zacksenhaus;" See PTO-892); further in view of US20200123574A1 (Published 04/23/2020; See PTO-892).
Regarding claims 21-25: The teachings of Zhang in view of Zhao and Zacksenhaus are set forth above. Zhang taught that their study paves the way for the future test of in vivo efficacy of ASREs in DM1 animals, which can be carried out with standard gene delivery vectors for muscle and heart (e.g., AAV) (as required by claims 23-25).” (See Zhang p. 317, col. 2, last para). Zhang indicated that because the applications of AAV vectors have been extensively tested for muscular dystrophy and neurodegenerative diseases, their approach can benefit from these studies in the next stage of therapy development. (See Zhang p. 317, col. 2, last para). It is noted that the cited references did not teach or suggest the claimed promoters in claim 22.
US20200123574A1 taught nucleic acid constructs comprising promoters operably linked to coding sequences for expression in muscle tissues to drive expression of proteins of interest in muscle cells. (See US20200123574A1 [0170]). A person of ordinary skill in the art would have been motivated to include a promoter, and specifically a muscle specific promoter in the nucleic construct of Zhang in order to enable muscle specific expression. It is submitted that as exemplified by US20200123574A1, the claimed promoters have been extensively used for expression of proteins in muscles.
Claims 17, 26, 41-43 and 45 are rejected under 35 U.S.C. 103 as being unpatentable over Zhang et al (Mol Ther. 2014 Feb; hereinafter "Zhang;" See IDS filed 04/24/2025) in view of Zhao et al (Nucleic Acids Res. 2018 May 18; hereinafter "Zhao;" See IDS filed 04/24/2025) and Zacksenhaus (Mol Cell Biol. 1993 Aug; hereinafter "Zacksenhaus;" See PTO-892); further in view of US20200123574A1 (Published 04/23/2020; See PTO-892) and Tsukada et al (PLoS One. 2020 Sep 24; hereinafter "Tsukada;" See PTO-892).
Regarding claim 17 and 26: The teachings of Zhang in view of Zhao and Zacksenhaus are set forth above. It is noted that the cited references did not teach or suggest placement of linkers between a transgene and NLS sequence as required by claim 17. It is noted that Tsukada taught that linkers are important for the optimal function of NLS sequences. For example Tsukada taught that “we identified a functional putative nuclear localization signal (NLS) of PNKP located in the linker region, and showed that lysine 138 (K138), arginine 139 (R139) and arginine 141 (R141) residues therein are critically important for nuclear localization.” (See Tsukada Abstract).
Further, the AAV construct as claimed in claim 26 are routinely used in molecular biology. For example, US20200123574A1 taught an AAV vector comprising a 5’ ITR, promoter, a payload sequence and the 3’ intron. (See US20200123574A1 at [0120]-[0121]). It is submitted that PUF domain liked by a linker to NLS are considered to read on the payload as described by US20200123574A1.
Regarding claim 41-43: US20200123574A1 taught pharmaceutical compositions of AAV and a buffer. (See US20200123574A1 claim 31, [0715]). Further, US20200123574A1 taught a AAV vector genome carrying AAVrh10 capsid. (See US20200123574A1 claim 43).
Regarding claim 45: US20200123574A1 taught that AAV particles are produced in mammalian-cells. (See US20200123574A1 [0595]).
Claim 31 is rejected under 35 U.S.C. 103 as being unpatentable over Zhang et al (Mol Ther. 2014 Feb; hereinafter "Zhang;" See IDS filed 04/24/2025) in view of Zhao et al (Nucleic Acids Res. 2018 May 18; hereinafter "Zhao;" See IDS filed 04/24/2025) and Zacksenhaus (Mol Cell Biol. 1993 Aug; hereinafter "Zacksenhaus;" See PTO-892); further in view of Frei et al (Nat Commun. 2020 Sep 15; hereinafter "Frei;" See PTO-892).
Regarding claim 31: The teachings of Zhang in view of Zhao and Zacksenhaus are set forth above. It is noted that the cited references did not teach or suggest a promoter comprising any one of SEQ ID NOs:568, 569, 608,609,or 634-637. However, many of the claimed sequences for example SEQ ID NO: 636 are well known promoter sequences. For example SEQ ID NO: 636 is a CMV enhancer sequence in routinely used plasmids. For instance Frei disclosed the use of CMV enhancer sequence of instant SEQ ID NO: 636 in their pBI-CMV-EGFP-mKate-3xmiR31ts5'UTR construct. It would have been obvious for a person of ordinary skill in the art to use promoters that are known to drive robust expression of protein.
Query 1 CGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATT 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1098 CGTTACATAACTTACGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATT 1157
Query 61 GACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCA 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1158 GACGTCAATAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCA 1217
Query 121 ATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCC 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1218 ATGGGTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCC 1277
Query 181 AAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTA 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1278 AAGTACGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTA 1337
Query 241 CATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTAC 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1338 CATGACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTAC 1397
Query 301 CATG 304
||||
Sbjct 1398 CATG 1401
Alignment between SEQ ID NO: 636 of instant application and promoter of Frei.
Claims 32-33 are rejected under 35 U.S.C. 103 as being unpatentable over Zhang et al (Mol Ther. 2014 Feb; hereinafter "Zhang;" See IDS filed 04/24/2025) in view of Zhao et al (Nucleic Acids Res. 2018 May 18; hereinafter "Zhao;" See IDS filed 04/24/2025) and Zacksenhaus (Mol Cell Biol. 1993 Aug; hereinafter "Zacksenhaus;" See PTO-892); further in view of Simons et al (WO2019126329A1; published Jun 27, 2029; hereinafter “Simons;” See PTO-892).
Regarding claims 32-33: The teachings of Zhang in view of Zhao and Zacksenhaus are set forth above. It is noted that the cited references did not teach or suggest a 1st or a 2nd ITR comprising SEQ ID NO: 599 or 600. However, these sequences are routinely used in AAV molecular biology. For example SEQ ID NO: 599 was identical to SEQ ID NO: 36 used as a 5’ (See Simons Figure 1B) and 3’ (See Simons Figure 1C) ITR by Simons.
It would have been obvious for a person of ordinary skill in the art to use known ITR sequences that are known to drive produce infectious AAV.
Claim 37 is rejected under 35 U.S.C. 103 as being unpatentable over Zhang et al (Mol Ther. 2014 Feb; hereinafter "Zhang;" See IDS filed 04/24/2025) in view of Zhao et al (Nucleic Acids Res. 2018 May 18; hereinafter "Zhao;" See IDS filed 04/24/2025) and Zacksenhaus (Mol Cell Biol. 1993 Aug; hereinafter "Zacksenhaus;" See PTO-892); further in view of Leppek et al (Nat Rev Mol Cell Biol. 2018 Mar; hereinafter "Leppek;" See PTO-892).
Regarding claim 37: The teachings of Zhang in view of Zhao and Zacksenhaus are set forth above. It is noted that the cited references did not teach or suggest use of Kozak sequence. However, it is submitted that the use of Kozak sequence was routine in molecular biology at the time of filing of instant application. For example, Leppek taught that “a strong Kozak sequence26 improves start codon recognition as a feature of highly translated mRNAs.” (See Leppek p. 2, last para). A person of ordinary skill in the art would have been motivated to use a kozak sequence in the AAV vector coding sequence to improve expression of the encoded protein with a reasonable expectation of success.
Claim Objections
Claim 9-10 and 40 appear free of art in view of the sequence search results and may be allowable if written in independent form.
Regarding claim 1: Full forms of the terms “PUF,” “PUMBY” or Rb are required at the first instance of their use.
Conclusion
No claim is allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JAGAMYA VIJAYARAGHAVAN whose telephone number is (703)756-5934. The examiner can normally be reached 9:00a-5:00p.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Christopher M. Babic can be reached at 571-272-8507. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JAGAMYA NMN VIJAYARAGHAVAN/ Examiner, Art Unit 1633
/EVELYN Y PYLA/ Primary Examiner, Art Unit 1633