Prosecution Insights
Last updated: October 04, 2026
Application No. 18/039,813

RNA-TARGETING COMPOSITIONS AND METHODS FOR TREATING CAG REPEAT DISEASES

Non-Final OA §103§112§DP
Filed
Jun 01, 2023
Priority
Dec 01, 2020 — provisional 63/119,977 +2 more
Examiner
VIJAYARAGHAVAN, JAGAMYA NMN
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Astellas Gene Therapies, Inc.
OA Round
1 (Non-Final)
62%
Grant Probability
Moderate
1-2
OA Rounds
4m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 62% of resolved cases
62%
Career Allowance Rate
25 granted / 40 resolved
+2.5% vs TC avg
Strong +49% interview lift
Without
With
+49.3%
Interview Lift
resolved cases with interview
Typical timeline
3y 8m
Avg Prosecution
45 currently pending
Career history
85
Total Applications
across all art units

Statute-Specific Performance

§101
5.0%
-35.0% vs TC avg
§103
31.6%
-8.4% vs TC avg
§102
13.2%
-26.8% vs TC avg
§112
33.6%
-6.4% vs TC avg
Black line = Tech Center average estimate • Based on career data from 40 resolved cases

Office Action

§103 §112 §DP
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Priority Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Information Disclosure Statement The information disclosure statements (IDS) submitted on 04/24/2025 and 04/25/2024 are in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statements are being considered by the examiner. Election/Restrictions Applicant’s election without traverse of Group 1 drawn to nucleic acid compositions and host cells in the reply filed on 05/06/2026 is acknowledged. Claims 46-47 and 49 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected species, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 05/06/2026. Status of claims Claims 1, 9-13, 15-18, 20-26, 31-33, 37, 41-43, 45-47, 49 are pending. Claims 46-47 and 49 are withdrawn. Claims 1, 9-13, 15-18, 20-26, 31-33, 37, 41-43, 45 are pending and under exam. Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claim 1 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. The claim broadly recites a nucleic acid encoding any PUF domain which are known in the art to be extremely variable for any given sequence (such as the claimed CUG). However, the specification does not reasonably convey to a person of ordinary skill in the art that the inventors were in possession of the full scope of PUF or PUMBY polypeptides encompassed by the claim. It is generally known in the art that PUF domains are extremely diverse and modular class of RNA-binding proteins. For example, Abil et al (J. Bio Eng, 2014; See IDS of 04/24/2025) developed a repeat module library that is potentially capable of generating a PUF domain with any desired specificity. (See Abil Abstract). As such Abil taught that PUF domains can be assembled in a modular fashion from interchangeable repeat units and that numerous distinct PUF variants can be generated to recognize a given RNA sequence by altering amino acid residues at key RNA-contacting positions. In view of this known diversity the specification’s disclosure of only limited PUF embodiments is insufficient to demonstrate possession of entire genus of “PUF or PUMBY polypeptides capable of binding toxic CAG repeat RNA sequence.” The specification does not describe representative species spanning the full scope of the claimed genus, nor does it identify common structural features that would allow a person of ordinary skill in the art to recognize which PUF or PUMBY variants fall within the claim. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim 1 is rejected under 35 U.S.C. 103 as being unpatentable over Wang et al (FEBS J. 2013 Aug; hereinafter "Wang;" See PTO-892). Regarding claim 1: Wang taught a PUF-based RNA detection system in which PUF RNA-binding domains are fused to split fluorescent protein fragments to enable visualization of RNA molecules in living cells. Wang further taught that PUF-domains can be used to detect endogenous RNA targets and that the system reduces background noise by assembling fluorescent protein at the RNA site. Wang taught that “[s]everal trinucleotide expansions have been found to cause neurodegenerative diseases (such as CAG repeats in Huntington disease and CUG repeats in myotonic dystrophy.” (See Wang; p.5; 3rd para). Wang pointed out that “These pathogenic RNA repeats usually contain hundreds of copies of the trinucleotide, thus a GFP-PUF recognizing these repeated sequences may provide a new way to visualize the RNA and study the dynamics of such pathogenic RNA in live cells.” (See Wang; p.5; 3rd para). Wang further taught that “[w]ith the natural modularity and recognition code of human Pumilio 1, its PUF domain can be engineered to target an eight-nucleotide RNA sequence containing adenine, uracil and guanine. By fusing the PUF domain with a functional domain, these ‘designer’ PUFs have been applied to track RNA localization in cells, regulate alternative splicing, and modulate translational regulation” (See Wang; p.4 para 2). Wang also indicated that “Combination of PUF domain with a non-specific RNA endonuclease (PIN domain) can produce a new class of enzymes that specifically recognize and cleave RNA.” As such it is recognized that a PUF domain alone does not cleave an RNA. It would have been obvious for a person of ordinary skill in the art to arrive at or modify or employ a PUF RNA-binding domain to bind toxic CAG repeat without cleavage, as recited in in the claim, because the reference explicitly identified CAG repeat RNA as a disease associated endogenous target and taught that PUF domains could be engineered or selected to bind CAG repeat RNA sequences for detection or targeting purposes. Claims 9-13, 15, 23-25 and 45 are rejected under 35 U.S.C. 103 as being unpatentable over Wang et al (FEBS J. 2013 Aug; hereinafter "Wang;" See PTO-892) in view of Okayama (WO2017104796A1; Published Jun 22, 2017; hereinafter "Okayama;" See PTO-892) and Abil et al (J Biol Eng. 2014 Mar 1; hereinafter "Abil" See PTO-892). Regarding claim 9-10, 13: It is noted that Wang taught that PUF domains possess a fully determined modular RNA recognition code that permits rational redesign of RNA-binding specificity by modifying the RNA-recognition residues within individual PUF repeats. Wang further taught the motivation to target CAG repeats in RNA. Okayama taught the sequences of PUF repeat domains comprising defined repeat sequences (R1-R8) that confer sequence specific RNA recognition of PUF domain. In particular Okayama disclosed engineered repeat modules that recognize pre-determined RNA target sequences through programmable RNA binding, thereby providing sequence specific RNA binding. In addition to the teachings of Wang and Okayama, Abil taught that Pumillo homology domain consists of 8 tandem repeats where each repeat contributes to recognition of a single RNA molecule. This modular architecture allows predictable reprogramming of RNA-binding specificity by systematically substituting each amino acid within each repeat. Specifically, Abil explained that residues at positions 12 and 16 of each repeat from the primary base recognition interface, and that altering these residues according to a defined “PUF-code” (E.g. S12/E16, N12/Q16, C12/Q16 variants) enables predictable binding to desired RNA bases. Abil also taught that residue 13 is involved in a stacking interaction between two adjacent bases. (See Abil, p. 2, col. 1-2). By selecting and combining modified repeats, the PUF scaffold can be engineered to recognize any desired 8-nt RNA sequence. Further Abil taught “PUF domain for the sequence-specific RBP engineering, a rapid cloning approach is desirable that would allow efficient introduction of multiple key amino acid mutations in the protein.” (See Abil Abstract). Abit taught a “GG cloning method, which is implemented [here] for the assembly of custom PUF domains, [is] based on the ability of Type IIS restriction enzymes to cleave outside of their non-palindromic recognition sequence, thus creating overhangs unrelated to the recognition sequence. This polarity and flexibility in the overhang sequence allows for a seamless removal of the original restriction site as well as a ligation of multiple fragments in one step.” (See Abil p.3, col.1, 3rd para). In view of these teachings, it would have been obvious for a person of ordinary skill in the art to engineer a PUF domain taught by Okayama by selecting amino acid substitutions at positions 12, 13 and 16 according to the RNA sequence of the desired target in accordance with the principles taught by Abil and obtain a PUF domain having the desired RNA-binding specificity for the target RNA taught by Wang. The motivation for doing so arises from the teachings of Abil that these residues constitute recognized engineering positions governing RNA sequence specificity and that modification of these positions provides a predictable means of altering target recognition. Such modification would have represented nothing more than routine application of the established PUF recognition code to achieve desired RNA-binding specificity and would have been expected to succeed as the prior art taught that altering the identified amino acid positions to alter nucleotide recognition. having the amino acid sequence necessary to bind the desired CAG repeat RNA target. Accordingly, the claimed PUF sequence represents no more than the predictable selection and substitution of known amino acid residues at the established RNA-recognition positions within the PUF repeat modules using the routine engineering principles taught by the prior art, and therefore would have been obvious to a person of ordinary skill in the art. Regarding claim 11-12: Wang taught toxic CAG repeat RNA associated with Huntington’s disease using sequence specific RNA-binding protein. Wang recognized that expanded that expanded CAG repeat is a desirable therapeutic target. Abil taught that PUF domain is a modular RNA-binding scaffold in which each of the eight repeats recognizes one nucleotide of an nucleotide of an 8 nucleotide long RNA-target, with nucleotide specificity governed primarily by key amino acid residues within each repeat according to a defined code. Accordingly, the target code designated as SEQ ID NO: 453 (CAGCAGCA) constitutes an obvious selection of an eight-nucleotide sequence from the known pathogenic CAG repeat RNA disclosed by Wang using the routine and predictable PUF engineering methodology taught by Abil. Regarding claim 15: Wang taught that “a PUF domain fused with a nuclear localization sequence (NLS) may be created to block nuclear-to-cytoplasmic RNA transport.” (See Wang p.8, para 2). Regarding claim 23-25, and 45: Wang taught that “[f]or application in cultured cells or animal models, the lentiviral system is a good choice for ease of use and robust expression in most cell types. For therapeutic applications in humans, adeno-associated virus (AAV) is a favorable choice in gene therapy, because it lacks known pathogenicity, can infect non-dividing cells, and has many serotypes that allow specific gene delivery into different tissues.” Wang also indicated that PUF domains are small enough to be packaged by AAV. As such, it is submitted that before the filing date of the instant application that delivery of PUF domains by AAV was routine. The teachings of the prior art indicate that the use of vectors such as AAV would have constituted routine optimization involving predictable use of known gene delivery techniques rather than the exercise of inventive skill. Claim 16 is rejected under 35 U.S.C. 103 as being unpatentable over Wang et al (FEBS J. 2013 Aug; hereinafter "Wang;" See PTO-892) in view of Okayama (WO2017104796A1; Published Jun 22, 2017; hereinafter "Okayama;" See PTO-892) and Abil et al (J Biol Eng. 2014 Mar 1; hereinafter "Abil" See PTO-892) and further in view of Chen et al (Adv Drug Deliv Rev. 2013 Oct; hereinafter "Chen;" See PTO-892). Regarding claim 16: The teachings of Wang in view of Okayama and Abil are set forth above. It is noted that Wang, Okayama and Abil do not teach linker. Chen taught that “Flexible linkers (GGGGS)n with different copy numbers (n =1, 2, or 4) were inserted to test the optimal distance” It is noted that SEQ ID NO: 414 is a GGGGS with n = 2. A person of ordinary skill in the art would have been motivated to add use the claimed well known linkers in view of the teachings of Chen to provide optimal spatial separation of various domains. Claim 17 is rejected under 35 U.S.C. 103 as being unpatentable over Wang et al (FEBS J. 2013 Aug; hereinafter"Wang;" See PTO-892) in view of Okayama (WO2017104796A1; Published Jun 22, 2017; hereinafter "Okayama;" See PTO-892) and Abil et al (J Biol Eng. 2014 Mar 1; hereinafter "Abil" See PTO-892) and Chen et al (Adv Drug Deliv Rev. 2013 Oct; hereinafter "Chen;" See PTO-892), and further in view of Tsukada et al (PLoS One. 2020 Sep 24; hereinafter "Tsukada;" See PTO-892). Regarding claim 17: The teachings of Wang in view of Okayama and Abil further in view of Chen are set forth above. It is noted that the cited references did not teach or suggest placement of linkers between a transgene and NLS sequence as required by claim 17. It is noted that Tsukada taught that linkers are important for the optimal function of NLS sequences. For example, Tsukada taught that “we identified a functional putative nuclear localization signal (NLS) of PNKP located in the linker region, and showed that lysine 138 (K138), arginine 139 (R139) and arginine 141 (R141) residues therein are critically important for nuclear localization.” (See Tsukada Abstract). It would have been obvious for a person of ordinary skill in the art to provide a linker between the PUF and NLS of the claimed composition. The teachings of the prior art indicate that the placement of linkers are routine in the art and the placement of these elements would have constituted routine optimization involving predictable use of known protein engineering principles rather than the exercise of inventive skill. Claims 18 and 20 are rejected under 35 U.S.C. 103 as being unpatentable over Wang et al (FEBS J. 2013 Aug; hereinafter "Wang;" See PTO-892) in view of Okayama (WO2017104796A1; Published Jun 22, 2017; hereinafter "Okayama;" See PTO-892) and Abil et al (J Biol Eng. 2014 Mar 1; hereinafter "Abil" See PTO-892) and further in view of Chen et al (Adv Drug Deliv Rev. 2013 Oct; hereinafter "Chen;" See PTO-892), Tsukada et al (PLoS One. 2020 Sep 24; hereinafter "Tsukada;" See PTO-892) and Zacksenhaus (Mol Cell Biol. 1993 Aug; hereinafter "Zacksenhaus;" See PTO-892). Regarding claim 18 and 20: The teachings of Wang in view of Okayama and Abil further in view of Chen are set forth above. It is noted that the cited references did not teach or suggest placement of linkers between a transgene and NLS sequence as required by claim 17. It is noted that Tsukada taught that linkers are important for the optimal function of NLS sequences. For example, Tsukada taught that “we identified a functional putative nuclear localization signal (NLS) of PNKP located in the linker region, and showed that lysine 138 (K138), arginine 139 (R139) and arginine 141 (R141) residues therein are critically important for nuclear localization.” (See Tsukada Abstract). It is noted that Tsukada did not teach the sequence of any of the claimed SEQ ID NOs as linker sequences. It is pointed out that Zacksenhaus taught that the NLS of Rb comprises KRSAEGGNPPKPLKKLR (SEQ ID NO: 442) at the C terminus of a transgene. (See Zacksenhaus Abstract). The teachings of the prior art indicate that the placement of the specific linker is routine in the art and the placement of these elements would have constituted routine optimization involving predictable use of known protein engineering principles rather than the exercise of inventive skill. Claims 21-22, 26 and 41-43 are rejected under 35 U.S.C. 103 as being unpatentable over Wang et al (FEBS J. 2013 Aug; hereinafter "Wang;" See PTO-892) in view of Okayama (WO2017104796A1; Published Jun 22, 2017; hereinafter "Okayama;" See PTO-892) and Abil et al (J Biol Eng. 2014 Mar 1; hereinafter "Abil" See PTO-892) and further in view of Chen et al (Adv Drug Deliv Rev. 2013 Oct; hereinafter "Chen;" See PTO-892) and US20200123574A1 (Published 04/23/2020; See PTO-892). Regarding claims 21-22, 26 and 41-43: The teachings of Wang in view of Okayama and Abil further in view of Chen are set forth above. It is noted that the cited references did not teach or suggest the claimed promoters in claim 22. US20200123574A1 taught nucleic acid constructs comprising promoters such as synapsin promoter operably linked to coding sequences for expression in neurons to drive expression of proteins of interest in neuronal cells. (See US20200123574A1 [0149]). A person of ordinary skill in the art would have been motivated to include a promoter, and specifically a muscle specific promoter in the nucleic construct of Wang in view of Okayama and Abil in order to enable neuron specific expression. It is submitted that as exemplified by US20200123574A1, the claimed promoters have been extensively used for expression of proteins in neuron. Further, the AAV construct as claimed in claim 26 are routinely used in molecular biology. For example, US20200123574A1 taught an AAV vector comprising a 5’ ITR, promoter, a payload sequence and the 3’ intron. (See US20200123574A1 at [0120]-[0121]). It is submitted that PUF domain linked by a linker to NLS are considered to read on the payload as described by US20200123574A1. Claims 32-33 are rejected under 35 U.S.C. 103 as being unpatentable over Wang et al (FEBS J. 2013 Aug; hereinafter "Wang;" See PTO-892) in view of Okayama (WO2017104796A1; Published Jun 22, 2017; hereinafter "Okayama;" See PTO-892) and Abil et al (J Biol Eng. 2014 Mar 1; hereinafter "Abil" See PTO-892) and further in view of Chen et al (Adv Drug Deliv Rev. 2013 Oct; hereinafter "Chen;" See PTO-892); US20200123574A1 (Published 04/23/2020; See PTO-892) and Simons et al (WO2019126329A1; published Jun 27, 2029; hereinafter “Simons;” See PTO-892). Regarding claims 32-33: The teachings of Wang in view of Okayama, Abil, Chen and US20200123574A1 are set forth above. It is noted that the cited references did not teach or suggest a 1st or a 2nd ITR comprising SEQ ID NO: 599 or 600. However, these sequences are routinely used in AAV molecular biology. For example, SEQ ID NO: 599 was identical to SEQ ID NO: 36 used as a 5’ (See Simons Figure 1B) and 3’ (See Simons Figure 1C) ITR by Simons. It would have been obvious for a person of ordinary skill in the art to use known ITR sequences that are known to drive produce infectious AAV. Claim 37 is rejected under 35 U.S.C. 103 as being unpatentable over Wang et al (FEBS J. 2013 Aug; hereinafter "Wang;" See PTO-892) in view of Okayama (WO2017104796A1; Published Jun 22, 2017; hereinafter "Okayama;" See PTO-892) and Abil et al (J Biol Eng. 2014 Mar 1; hereinafter "Abil" See PTO-892) and further in view of Chen et al (Adv Drug Deliv Rev. 2013 Oct; hereinafter "Chen;" See PTO-892); US20200123574A1 (Published 04/23/2020; See PTO-892) and still further in view of Leppek et al (Nat Rev Mol Cell Biol. 2018 Mar; hereinafter "Leppek;" See PTO-892). Regarding claim 37: The teachings of Zhang in view of Zhao and Zacksenhaus are set forth above. It is noted that the cited references did not teach or suggest use of Kozak sequence. However, it is submitted that the use of Kozak sequence was routine in molecular biology at the time of filing of instant application. For example, Leppek taught that “a strong Kozak sequence26 improves start codon recognition as a feature of highly translated mRNAs.” (See Leppek p. 2, last para). A person of ordinary skill in the art would have been motivated to use a kozak sequence in the AAV vector coding sequence to improve expression of the encoded protein with a reasonable expectation of success. Claim 31, 42-43 are rejected under 35 U.S.C. 103 as being unpatentable over Wang et al (FEBS J. 2013 Aug; hereinafter "Wang;" See PTO-892) in view of Okayama (WO2017104796A1; Published Jun 22, 2017; hereinafter "Okayama;" See PTO-892) and Abil et al (J Biol Eng. 2014 Mar 1; hereinafter "Abil" See PTO-892) and further in view of Chen et al (Adv Drug Deliv Rev. 2013 Oct; hereinafter "Chen;" See PTO-892) US20200123574A1 (Published 04/23/2020; See PTO-892) and Koch et al (The FEBS Journal; hereinafter “Koch;” See PTO-892). Regarding claim 31: The teachings of Wang, in view of Okayama and Abil, further in view of Chen and US20200123574A1 are stated above. It is submitted that the cited prior art did not teach a synapsin promoter comprising SEQ ID NO: 627. However, Koch taught a AAV 1/2 plasmid comprising a synapsin promoter that is 100% identical to instant SEQ ID NOI: 627. Query 1 AGTGCAAGTGGGTTTTAGGACCAGGATGAGGCGGGGTGGGGGTGCCTACCTGACGACCGA 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1555 AGTGCAAGTGGGTTTTAGGACCAGGATGAGGCGGGGTGGGGGTGCCTACCTGACGACCGA 1496 Query 61 CCCCGACCCACTGGACAAGCACCCAACCCCCATTCCCCAAATTGCGCATCCCCTATCAGA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1495 CCCCGACCCACTGGACAAGCACCCAACCCCCATTCCCCAAATTGCGCATCCCCTATCAGA 1436 Query 121 GAGGGGGAGGGGAAACAGGATGCGGCGAGGCGCGTGCGCACTGCCAGCTTCAGCACCGCG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1435 GAGGGGGAGGGGAAACAGGATGCGGCGAGGCGCGTGCGCACTGCCAGCTTCAGCACCGCG 1376 Query 181 GACAGTGCCTTCGCCCCCGCCTGGCGGCGCGCGCCACCGCCGCCTCAGCACTGAAGGCGC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1375 GACAGTGCCTTCGCCCCCGCCTGGCGGCGCGCGCCACCGCCGCCTCAGCACTGAAGGCGC 1316 Query 241 GCTGACGTCACTCGCCGGTCCCCCGCAAACTCCCCTTCCCGGCCACCTTGGTCGCGTCCG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1315 GCTGACGTCACTCGCCGGTCCCCCGCAAACTCCCCTTCCCGGCCACCTTGGTCGCGTCCG 1256 Query 301 CGCCGCCGCCGGCCCAGCCGGACCGCACCACGCGAGGCGCGAGATAGGGGGGCACGGGCG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1255 CGCCGCCGCCGGCCCAGCCGGACCGCACCACGCGAGGCGCGAGATAGGGGGGCACGGGCG 1196 Query 361 CGACCATCTGCGCTGCGGCGCCGGCGACTCAGCGCTGCCTCAGTCTGCGGTGGGCAGCGG 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1195 CGACCATCTGCGCTGCGGCGCCGGCGACTCAGCGCTGCCTCAGTCTGCGGTGGGCAGCGG 1136 Query 421 AGGAGTCGTGTCGTGCCTGAGAGCGCAG 448 |||||||||||||||||||||||||||| Sbjct 1135 AGGAGTCGTGTCGTGCCTGAGAGCGCAG 1108 Alignment between SEQ ID NO: 627 and synapsin promoter of Koch. Regarding claim 42-43: Koch taught a AAV 1/2 capsid. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1, 9-10-13, 15, 16, 17, 18, 20, 21-22, 23-26, 31-33, 37, 41-43 and 45 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 1, 10-11, 16-26, 31-33, 37,41-43 and 45 of copending Application No. 18/039,812 (reference application) in view of Wang et al (FEBS J. 2013 Aug; hereinafter "Wang;" See PTO-892), Okayama (WO2017104796A1; Published Jun 22, 2017; hereinafter "Okayama;" See PTO-892) and Abil et al (J Biol Eng. 2014 Mar 1; hereinafter "Abil" See PTO-892). Although the claims at issue are not identical, they are not patentably distinct from each other because of the reasons indicated below. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Regarding claim 1, 9-10-13, 15-18, 20, 21-22, 23-26, 31-33, 37, 41-43 and 45: The reference application taught sequence-specific PUF domains that bind CUG repeats. As indicated above, Wang taught a PUF-based RNA detection system in which PUF RNA-binding domains are fused to split fluorescent protein fragments to enable visualization of RNA molecules in living cells. Wang further taught that PUF-domains can be used to detect endogenous RNA targets and that the system reduces background noise by assembling fluorescent protein at the RNA site. Wang taught that “[s]everal trinucleotide expansions have been found to cause neurodegenerative diseases (such as CAG repeats in Huntington disease and CUG repeats in myotonic dystrophy.” (See Wang; p.5; 3rd para). Wang further taught that “[w]ith the natural modularity and recognition code of human Pumilio 1, its PUF domain can be engineered to target an eight-nucleotide RNA sequence containing adenine, uracil and guanine. By fusing the PUF domain with a functional domain, these ‘designer’ PUFs have been applied to track RNA localization in cells, regulate alternative splicing, and modulate translational regulation” (See Wang; p.4 para 2). Wang also indicated that “Combination of PUF domain with a non-specific RNA endonuclease (PIN domain) can produce a new class of enzymes that specifically recognize and cleave RNA.” As such it is recognized that a PUF domain alone does not cleave an RNA. Further, as indicated above, Abil and Okayama taught a method to arrive at the specific sequences that bind CAG repeats or CUG repeats using universal code for designing PUF domains. In view of these teachings, it would have been obvious for a person of ordinary skill in the art to engineer a PUF domain taught by Okayama by selecting amino acid substitutions at positions 12, 13 and 16 according to the RNA sequence of the desired target in accordance with the principles taught by Abil and obtain a PUF domain having the desired RNA-binding specificity for the target RNA taught by Wang. The motivation for doing so arises from the teachings of Abil that these residues constitute recognized engineering positions governing RNA sequence specificity and that modification of these positions provides a predictable means of altering target recognition. Such modification would have represented nothing more than routine application of the established PUF recognition code to achieve desired RNA-binding specificity and would have been expected to succeed as the prior art taught that altering the identified amino acid positions to alter nucleotide recognition. having the amino acid sequence necessary to bind the desired CAG repeat RNA target. Conclusion No claim is free of art, no claim is allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to JAGAMYA VIJAYARAGHAVAN whose telephone number is (703)756-5934. The examiner can normally be reached 9:00a-5:00p. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Christopher M. Babic can be reached at 571-272-8507. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /JAGAMYA NMN VIJAYARAGHAVAN/ Examiner, Art Unit 1633 /EVELYN Y PYLA/ Primary Examiner, Art Unit 1633
Read full office action

Prosecution Timeline

Jun 01, 2023
Application Filed
Jul 13, 2026
Non-Final Rejection mailed — §103, §112, §DP (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12709733
CELL CULTURE MEDIA
4y 3m to grant Granted Aug 18, 2026
Patent 12681006
METHODS OF GENERATING HUMAN ENDOMETRIAL STROMAL FIBROBLASTS AND THREE-DIMENSIONAL MULTI-LAYERED HUMAN ENDOMETRIAL TISSUE COMPOSITIONS
4y 2m to grant Granted Jul 14, 2026
Patent 12667621
RNA FORMULATIONS SUITABLE FOR THERAPY
4y 6m to grant Granted Jun 30, 2026
Patent 12637700
NOVEL METABOLIC PATHWAY FOR PRODUCING ITACONIC ACID AND METHOD FOR PRODUCING ITACONIC ACID USING SAME
2y 5m to grant Granted May 26, 2026
Patent 12618045
AUTOMATED METHOD FOR PREPARING RETINAL PIGMENT EPITHELIUM CELLS
4y 4m to grant Granted May 05, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
62%
Grant Probability
99%
With Interview (+49.3%)
3y 8m (~4m remaining)
Median Time to Grant
Low
PTA Risk
Based on 40 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month