Prosecution Insights
Last updated: April 19, 2026
Application No. 18/040,503

MODULATION OF SIGNAL TRANSDUCER AND ACTIVATOR OF TRANSCRIPTION 3 (STAT3) EXPRESSION

Non-Final OA §102§103§112
Filed
Feb 03, 2023
Examiner
DACE DENITO, ALEXANDRA GERALDINE
Art Unit
1636
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
National University Of Singapore
OA Round
1 (Non-Final)
54%
Grant Probability
Moderate
1-2
OA Rounds
3y 0m
To Grant
92%
With Interview

Examiner Intelligence

Grants 54% of resolved cases
54%
Career Allow Rate
23 granted / 43 resolved
-6.5% vs TC avg
Strong +38% interview lift
Without
With
+38.1%
Interview Lift
resolved cases with interview
Typical timeline
3y 0m
Avg Prosecution
50 currently pending
Career history
93
Total Applications
across all art units

Statute-Specific Performance

§101
5.9%
-34.1% vs TC avg
§103
34.1%
-5.9% vs TC avg
§102
17.3%
-22.7% vs TC avg
§112
30.1%
-9.9% vs TC avg
Black line = Tech Center average estimate • Based on career data from 43 resolved cases

Office Action

§102 §103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Priority Applicant’s claim to priority from Foreign Application SG10202007545P filed 08/06/2020 and from International Application PCT/SG2021/050462 filed 08/06/2021 is hereby acknowledged. Election/Restrictions Applicant’s election of Invention Group I and Species Group A in the reply filed on 01/19/2026 is acknowledged as follows: Invention Group I, claims 39-56, drawn to a nucleic acid comprising an oligonucleotide strand of 15-80 nucleotides in length, and/or the corresponding double stranded nucleic acid, and/or an agent for inhibiting expression of STAT3 comprising said double stranded nucleic acid, and/or a nanoparticle comprising the double strand nucleic acid. Species Group A, claims 41 and 42: a sense strand comprising at least 15 contiguous nucleotides, Comprising a sequence at least 80% complementary to a nucleotide sequence of SEQ ID NO: 8. And that are differing by no more than 3 nucleotides from a nucleotide sequence of SEQ ID NO: 13. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)). Claims 57 and 58 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse, in the reply filed on 01/19/2026 (MPEP § 818.01(a)). Applicant is reminded that upon the cancelation of claims to a non-elected invention, the inventorship must be corrected in compliance with 37 CFR 1.48(a) if one or more of the currently named inventors is no longer an inventor of at least one claim remaining in the application. A request to correct inventorship under 37 CFR 1.48(a) must be accompanied by an application data sheet in accordance with 37 CFR 1.76 that identifies each inventor by his or her legal name and by the processing fee required under 37 CFR 1.17(i). Application Status This Application is a National Stage Entry under 35 U.S.C. §371 of PCT/SG2021/050462 filed 08/06/2021. Amendments to claims filed 01/19/2026 are hereby acknowledged. Claims 1-38 are cancelled. Claims 46 and 54 are currently amended. Therefore, claims 39-58 are currently pending. Claims 57 and 58 are withdrawn, therefore claims 39-56 are under consideration in this office action. Information Disclosure Statement The information disclosure statement (IDS) submitted on 02/03/2023 is hereby acknowledged. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner. Drawings The drawings are objected to for the following reasons: 37 CFR 1.84 (u)(1) states “View numbers must be preceded by the abbreviation "FIG."” In the current case, the view numbers for Figures 1-15 are preceded by the word "Figure" instead of the abbreviation "FIG.". 37 C.F.R. 1.84 states “Character of lines, numbers, and letters. All drawings must be made by a process which will give them satisfactory reproduction characteristics. Every line, number, and letter must be durable, clean, black (except for color drawings), sufficiently dense and dark, and uniformly thick and well-defined.” In the current case, the words in Figure 10 is illegible. 37 CFR 1.84 (u)(1) states “Partial views intended to form one complete view, on one or several sheets, must be identified by the same number followed by a capital letter.” In the current case, the view numbers for the partial views for Figures 2, 6, 12, 14 and 15, that appear on several sheets are followed by "Continued." instead of a capital letter such as FIG. 1A, FIG. 1B, etc. Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance. Nucleotide and/or Amino Acid Sequence Disclosures REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES Items 1) and 2) provide general guidance related to requirements for sequence disclosures. 37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted: In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying: the name of the ASCII text file; ii) the date of creation; and iii) the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying: the name of the ASCII text file; the date of creation; and the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended). When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical. Specific deficiencies and the required response to this Office Action are as follows: Specific deficiency – Nucleotide and/or amino acid sequences appearing in Table 1 (page 39-40; [00140]), in the specification are not identified by sequence identifiers in accordance with 37 CFR 1.821(d). Required response – Applicant must provide: A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers, consisting of: A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version); A copy of the amended specification without markings (clean version); and A statement that the substitute specification contains no new matter. Specification The disclosure is objected to because of the following informalities: In Table 1, the term “Reserve” should be “Reverse” (see pages 39-40). Appropriate correction is required. The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code ([00151], [00156]). Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01. The use of the term “JetPrime” ([0014], [0016], [0021], [0023], [0024], [00158]), “Seahorse XF Cell Mito Stress test” ([0025]), “Alimta” ([00118])which are trade names or marks used in commerce, has been noted in this application. The terms should be accompanied by the generic terminology; furthermore the terms should be capitalized wherever they appear or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term. Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks. Claim Objections Claim 52 is objected to because of the following informalities: the term “sense” is missing between the term “oligonucleotide” and “strand” in line 2. Appropriate correction is required. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 45, 46, 48, 50, 52 and 53 are rejected under 35 U.S.C. § 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Regarding claim 45, it recites “The dsNA of claim 40, wherein the Antisense strand comprises 1-5 single-stranded nucleotides at its 3' terminus, optionally 1-3 nucleotides in length, and optionally 2 nucleotides in length”. A broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). In the present instance, claim 45 recites the broad recitation “1-5 single-stranded nucleotides at its 3’ terminus”, and the claim also recites “optionally 2 nucleotides in length” which is the narrower statement of the range/limitation. The claim is considered indefinite because there is a question or doubt as to whether the feature introduced by such narrower language is (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claims. Regarding claims 46, 48, 50, 52 and 53, as for claim 45, the claims recite broader range followed by a narrow range or limitation. A broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). In each instance above, the claims recite a broad range of limitations followed by a narrow range of the limitations. The claims are considered indefinite because there is a question or doubt as to whether the feature introduced by such narrower language is (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claims. Claims 45, 46, 48, 50, 52 and 53 are indefinite and are therefore rejected. Claim Interpretation Claims 45, 46, 48, 50, 52 and 53 recite the term “optionally”. For the purpose of examination and applying prior art, Examiner interprets the term as meaning that the limitations recited following the term are not required by the claim. Examiner interprets the term as introducing a possible alternative, not an absolute requirement. See MPEP 2173.05(h) “Alternative Limitations”. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claims 39-49, 52 and 55-56 are rejected under 35 U.S.C. §102(a)(1) as being anticipated by Robin (Robin, H. et al. US 2005/0196781 A1, published September 8, 2005; cited on IDS filed 02/03/2023). Regarding claim 39, Robin teaches RNA interference mediated inhibition of STAT3 gene expression using short interfering nucleic acid (see title and abstract). Robin teaches double stranded nucleic acid capable of modulating STAT3 expression (see abstract, and page 232, claim 1). Robin also teaches sense and antisense strands for each double strand nucleic acid having at least 15 nucleotides in length wherein the target STAT3 mRNA sequence has a sequence of SEQ ID NO: 1 (see § [0019]-[0029] and page 76, Table II, SEQ ID NOs: 197-201). PNG media_image1.png 127 562 media_image1.png Greyscale Regarding claim 40, Robin teaches double stranded nucleic acid for inhibiting STAT3 expression, comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand is 100% complementary to a target STAT3 mRNA along at least 15 nucleotides, wherein the target mRNA has a sequence of SEQ ID NO: 1 and the sense strand has a sequence of SEQ ID NO: 2 along at least 15 nucleotides (see page 76, Table II, SEQ ID NOs: 197-201 and corresponding SEQ ID NOs: 474-478). Regarding claim 41, Robin also teaches a nucleotide sense strand 100% complementary to SEQ ID NO: 8 (, i.e. SEQ ID NO: 474 of Robin (see page 76, Table II, SEQ ID NO: 474). Query Match 66.7%; Score 18; DB 1; Length 19; Best Local Similarity 100.0%; Matches 18; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 10 UCUUAAGGGUUUGACCUG 27 |||||||||||||||||| Db 1 UCUUAAGGGUUUGACCUG 18 Regarding claim 42, Robin teaches a sense strand comprising 15 contiguous nucleotides of SEQ ID NO: 13 (Qy), i.e. SEQ ID NO: 197 of Robin (Db). See alignment below: Query Match 64.0%; Score 16; DB 1; Length 19; Best Local Similarity 100.0%; Matches 16; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GGUCAAACCCUUAAGA 16 |||||||||||||||| Db 4 GGUCAAACCCUUAAGA 19 Regarding claims 43 and 44, Robin teaches a double stranded nucleic acid wherein the sense strand is 19 nucleotides in length and the antisense is 19 nucleotides in length , i.e. SEQ ID NOs: 197-201 and SEQ ID NOs: 474-478, with a duplex region that is 19 base pairs in length (see page 76, Table II). Regarding claim 45, Robin teaches that the 3’-ends of the “upper sequence” and the “Lower sequence”, i.e., sense and antisense strands, of the siNA construct can include an overhang sequence about 1, 2, 3, or 4 nucleotides in length, preferably 2 nucleotides in length (see Table II, page 79, [0539]). Regarding claims 46 and 47, Robin teaches that the siNA can comprise a modified nucleotide at a 2’ position, which can be a 2’-O-methyl or 2’-deoxy-2’fluoro modification. Robin also teaches phosphorothioate internucleotide linkage and other types of stabilizing modifications (see Table IV, [0541]; see Table III, pages 79-83, [0540]). Regarding claim 48, Robin teaches that the modifications increase stability (see Table IV; [0035]). Robin further teaches that the characteristics of the modified nucleotides can be improved in vitro or in vivo such as stability, activity, toxicity, immune response, and/or bioavailability (see [0036]). Robin teaches that the siNA can be conjugated/attached to at least one moiety that is polyethylene glycol, cholesterol, steroids, polyamines or other types of polymers, vitamins, antibodies, aptamers and other cofactors (see column 12, [0076], [0079], [0099], [0101]). Regarding claim 49, Robin teaches that the siNA can be conjugated to a molecule of PEG of a molecular weight up to 50,000 Daltons, therefore, the molecular mass of the formulated nucleic acid molecule conjugated with PEG can be more than 50 KDa (see [0227]). Regarding claim 52, Robin teaches that the conjugated moiety can be attached via a polynucleotide or a non-nucleotide linker to the sense or antisense strand (see Figures 22, 23 and 24; see [0044], [0048], [0063], [0079]). Regarding claims 55 and 56, Robin teaches that the dsNA, or siNA, can be delivered within a nanoparticle formulation, which can be made of biodegradable polymers such as poly (DL-lactide-coglycolide) or polybutylcyanoacrylate (see [0225], [0440]). Robin also teaches liposomes containing PEG lipids (see [0441]). Robin also teaches nanocapsules made of proteinaceous vectors, or microspheres formulated with polyethyleneimine or derivatives thereof ( e.g., PEI-PEG-GAL) (see [0427]). Robin teaches each and every limitation of claims 39-49, 52 and 55-56, and therefore, Robin anticipates claims 39-49, 52 and 55-56. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or non-obviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 50, 51, 53 and 54 are rejected under 35 U.S.C. §103 as being unpatentable over Robin (Robin, H. et al. US 2005/0196781 A1, published September 8, 2005; cited on IDS filed 02/03/2023), as applied to claims 40, 48 and 52 above, and in further view of Rossi (Rossi, J.J. et al. US 2017/0226515 A1, published August 10, 2017). It is noted that claims 40, 48 and 52 are anticipated by Robin, as described above. Regarding claims 50 and 51, Robin teaches double stranded nucleic acid for inhibiting STAT3 expression, comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand is 100% complementary to a target STAT3 mRNA along at least 15 nucleotides, wherein the target mRNA has a sequence of SEQ ID NO: 1 and the sense strand has a sequence of SEQ ID NO: 2 along at least 15 nucleotides (see page 76, Table II, SEQ ID NOs: 197-201 and corresponding SEQ ID NOs: 474-478). Robin teaches that the modifications increase stability (see Table IV; [0035]). Robin further teaches that the characteristics of the modified nucleotides can be improved in vitro or in vivo such as stability, activity, toxicity, immune response, and/or bioavailability (see [0036]). Robin teaches that the siNA can be conjugated/attached to at least one moiety that is polyethylene glycol, cholesterol, steroids, polyamines or other types of polymers, vitamins, antibodies, aptamers and other cofactors (see column 12, [0076], [0079], [0099], [0101]). Robin also teaches that the conjugated moiety can be attached via a polynucleotide or a non-nucleotide linker to the sense or antisense strand. Robin teaches that the linker can be optionally decorated with conjugates polymers or aptamers (see Figures 22, 23 and 24; see [0044], [0048], [0063], [0079]). Regarding claim 54, Robin teaches a double stranded nucleic acid for inhibiting STAT3 expression, comprising a sense strand and an antisense strand forming a double stranded region, wherein the antisense strand is 100% complementary to a target STAT3 mRNA along at least 15 contiguous nucleotides (see page 76, Table II). PNG media_image1.png 127 562 media_image1.png Greyscale Robin teaches SEQ ID NO: 200 and SEQ ID NO: 477 as sense and antisense strand of a duplex RNA molecule for inhibiting STAT3 mRNA (see Table II, page 76). When performing alignment of SEQ ID NO: 477 of Robin (Db) with SEQ ID NO: 10 (Qy) of instant Application, there is a 100% identity over 16 contiguous nucleotides, as shown below: Query Match 63.0%; Score 17; DB 1; Length 19; Best Local Similarity 100.0%; Matches 17; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 11 UUCUCCUUAAACCUUCC 27 ||||||||||||||||| Db 1 UUCUCCUUAAACCUUCC 17 Robin does not teach an aptamer that is an anti-transferrin receptor aptamer. Robin does not teach an aptamer comprising a sequence which differs by no more than 3 nucleotides from SEQ ID NO: 15. However, Rossi teaches RNA aptamers against transferrin receptor (TFR) (see title and abstract). Rossi teaches that attaching this aptamer to a therapeutic agent, allow for internalization via the transferrin receptor into a target cell expressing the receptor (see [0004]-[0005]). Rossi teaches that the therapeutic agent can be a polynucleotide, including double stranded RNA and siRNA ([0028]). When performing a search for SEQ ID NO: 15 (Qy), Rossi’s SEQ ID NO: 1 (Db) presents with 100% identity over 40 nucleotides in length of SEQ ID NO: 15 of instant Application, as shown in the alignment below: RESULT 2 US-15-519-074-1 (NOTE: this sequence has 7 duplicates in the database searched. See complete list at the end of this report) Sequence 1, US/15519074 Publication No. US20170226515A1 GENERAL INFORMATION APPLICANT: City of Hope APPLICANT: Apterna Ltd APPLICANT: Rossi, John J. APPLICANT: Yoon, Sorah APPLICANT: Habib, Nagy TITLE OF INVENTION: RNA APTAMERS AGAINST TRANSFERRIN RECEPTOR (tfr) FILE REFERENCE: 48440-551001WO CURRENT APPLICATION NUMBER: US/15/519,074 CURRENT FILING DATE: 2017-04-13 PRIOR APPLICATION NUMBER: US 62/064,310 PRIOR FILING DATE: 2014-10-15 NUMBER OF SEQ ID NOS: 3 SEQ ID NO 1 LENGTH: 87 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic polynucleotide Query Match 100.0%; Score 40; Length 87; Best Local Similarity 100.0%; Matches 40; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 UGCGUUCACGUUUAUUCACAUUUUUGAAUUGAGCAUGAGC 40 |||||||||||||||||||||||||||||||||||||||| Db 24 UGCGUUCACGUUUAUUCACAUUUUUGAAUUGAGCAUGAGC 63 Therefore, it would have been obvious to one of ordinary skills in the art, before the effective filing date of the claimed invention, to have substituted the aptamer taught by Robin, linked to the double stranded RNA antisense molecule targeting STAT3 mRNA, with an anti-transferrin receptor aptamer as taught by Rossi. One with ordinary skills in the art, motivated in efficiently delivering the double stranded RNA antisense molecule using the natural transferrin receptor-mediated internalization pathway in a cell that expresses the transferrin receptor, could have performed this modification with a reasonable expectation of success and arrived at the claimed invention. Regarding claim 53, The obviousness of the combination of references Robin and Rossi is described above for the rejections of claims 48 and 52. The combination of Robin and Rossi does not teach specifically “a molecule comprising the structure of: [moiety]-[hydrocarbon linker]-[polynucleotide linker][oligonucleotide strand/antisense strand of the nucleic acid/dsNA], wherein each"]-[" represents a covalent bond; optionally wherein the molecule comprises the structure of: [ Aptamer ]-[hydrocarbon linker ]-[polynucleotide linker]-[ oligonucleotide strand/antisense strand of the nucleic acid/dsNA].”. However, Robin teaches the use of linkers (see Figures 22 and 23), which can be a nucleotide or a non-nucleotide molecules ( see [0376]-[0383], [0404]), a synthetic linker such as hexaethyleneglyol (see [0528]), or a mixed nucleotide and non-nucleotide to attach a conjugate moiety to the siNA, wherein the nucleic acid linker can be an aptamer (see [0122]). Robin also teaches different formulas for modifications of antisense nucleic acid molecules, including formula VII (see [0102]-[0103]). Robin teaches that R1 and/or R3 in the formula VII can comprise a conjugating moiety and a linker attached to the nucleic acid molecule; see below: PNG media_image2.png 504 329 media_image2.png Greyscale Therefore, it would have been obvious to one of ordinary skills in the art, before the effective filing date, to have substituted the linker taught by Robin in Figure 23, i.e., a linker covalently attached to the double stranded RNA antisense molecule targeting STAT3 mRNA, with a mixed linker comprising an anti-transferrin receptor aptamer (nucleic acid aptamer) as taught by Rossi, followed by a non-nucleotide linker attached with a conjugating moiety as taught by Robin in [0122], and corresponding to the general formula VII wherein R1 is the mixed linker, R2 is a polyalkyl group and R3 is the double strand antisense oligonucleotide targeting STAT3 mRNA. One with ordinary skills in the art, motivated in efficiently delivering the double stranded RNA antisense molecule using a construct comprising a mixed linker allowing the use of the natural transferrin receptor-mediated internalization pathway in a cell that expresses the transferrin receptor, could have performed this modification with a reasonable expectation of success and arrived at the claimed invention. Therefore, the combination of references further renders the elements of claim 53 obvious. Conclusion No claim is allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to ALEXANDRA G DACE DENITO whose telephone number is (703)756-4752. The examiner can normally be reached Monday-Friday, 8:30-5:00EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /A.D./Examiner, Art Unit 1636 /NANCY J LEITH/Primary Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Feb 03, 2023
Application Filed
Mar 19, 2026
Non-Final Rejection — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12570996
Circular RNA For Translation In Eukaryotic Cells
2y 5m to grant Granted Mar 10, 2026
Patent 12529048
DOUBLE KNOCK-OUT CHO CELL LINE METHOD OF ITS GENERATION AND PRODUCING THERAPEUTIC PROTEINS THEREFROM
2y 5m to grant Granted Jan 20, 2026
Patent 12516376
OPTIMIZING BAG3 GENE THERAPY
2y 5m to grant Granted Jan 06, 2026
Patent 12509701
Circular RNA For Translation In Eukaryotic Cells
2y 5m to grant Granted Dec 30, 2025
Patent 12509686
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Dec 30, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
54%
Grant Probability
92%
With Interview (+38.1%)
3y 0m
Median Time to Grant
Low
PTA Risk
Based on 43 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month