Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Applicant's preliminary amendment filed on March 12, 2026 is acknowledged. Claims 1-86 have been canceled. Claims 87, 88, 90, and 97-106 were amended. Claims 87-106 are pending.
Election/Restrictions
Applicant’s election without traverse of Group I (claims 87-96, 105, and 106) and the following species
PNG
media_image1.png
58
582
media_image1.png
Greyscale
in the reply filed on March 12, 2026 is acknowledged.
The reply filed 3/12/2026 asserts that the amendments to the claims render all pending claims readable upon the elected group and species. While the preambles of claims 97-104 were amended, the claims are still drawn to the nonelected invention of Group II. The claims contain the active step of “administering the artificial expression construct in a sufficient dosage and for a sufficient time to a sample or subject comprising the striatal neurons thereby expressing the heterologous gene within the striatal neurons.”
Claims 97-104 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on March 12, 2026.
Claims 105 and 106 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected species, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on March 12, 2026.
Claims 87-96 are examined on the merits herein.
Priority
PNG
media_image2.png
44
460
media_image2.png
Greyscale
Information Disclosure Statement
The information disclosure statement (IDS) submitted on February 7, 2023, March 8, 2023, and April 15, 2025 is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statements are being considered by the examiner.
The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered.
Drawings
The drawings were received on February 7, 2023. These drawings are found acceptable by the examiner.
Claim Objections
Claims 88 and 94 are objected to because of the following informalities:
For consistency throughout the claim set, claim 87 should use a colon after “NOs” instead of a period.
Claim 88 is missing a colon after “NOs”.
Claim 94 appears to be missing the phrase “wherein the artificial expression construct is” before “within a vector”.
Appropriate correction is required.
Improper Markush Grouping
Claims 87-96 are rejected on the basis that it contains an improper Markush grouping of alternatives. See In re Harnisch, 631 F.2d 716, 721-22 (CCPA 1980) and Ex parte Hozumi, 3 USPQ2d 1059, 1060 (Bd. Pat. App. & Int. 1984). A Markush grouping is proper if the alternatives defined by the Markush group (i.e., alternatives from which a selection is to be made in the context of a combination or process, or alternative chemical compounds as a whole) share a “single structural similarity” and a common use. A Markush grouping meets these requirements in two situations. First, a Markush grouping is proper if the alternatives are all members of the same recognized physical or chemical class or the same art-recognized class, and are disclosed in the specification or known in the art to be functionally equivalent and have a common use. Second, where a Markush grouping describes alternative chemical compounds, whether by words or chemical formulas, and the alternatives do not belong to a recognized class as set forth above, the members of the Markush grouping may be considered to share a “single structural similarity” and common use where the alternatives share both a substantial structural feature and a common use that flows from the substantial structural feature. See MPEP § 2117.
The Markush grouping of enhancers (claims 87 and 88) and heterologous encoding sequences (claims 89 and 90) are improper because the alternatives defined by the Markush grouping do not share both a single structural similarity and a common use for the following reasons: the alternatives listed in the claims lack any common structure or obvious common function.
To overcome this rejection, Applicant may set forth each alternative (or grouping of patentably indistinct alternatives) within an improper Markush grouping in a series of independent or dependent claims and/or present convincing arguments that the group members recited in the alternative within a single claim in fact share a single structural similarity as well as a common use.
Claim Interpretation
Given the broadest reasonable interpretation, the Examiner is interpreting claim 87 as requiring only a sequence of SEQ ID NO: 207; therefore, a sequence of two nucleotides or more is sufficient to satisfy the limitation “a sequence of any one of SEQ ID NOS: 1-37, 39-61, or 202-227”.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 87, 89, and 91-96 are rejected under 35 U.S.C. 102(a)(2) as being anticipated by Ting et al. (WO 2020/076614; reference cited by Applicant).
Regarding claim 87, Ting et al. teaches that an artificial expression construct includes (i) an enhancer sequence that leads to selective expression of a coding sequence within a targeted central nervous system cell type, (ii) a coding sequence that is expressed, and (iii) a promoter [0042]. Ting et al. teaches that the enhancer sequence of the artificial expression construct is SEQ ID NO: 3 [0121]. Ting et al. SEQ ID NO: 3 (designated as Db) has a match to instant SEQ ID NO: 207 (designated as Qy) as shown in the alignment below.
Query Match 2.0%; Score 9.8; DB 1; Length 393;
Best Local Similarity 84.6%;
Matches 11; Conservative 0; Mismatches 2; Indels 0; Gaps 0;
Qy 11 AGGAAAATTCCAG 23
| ||||||| |||
Db 35 AAGAAAATTACAG 47
Regarding claim 89, Ting et al. teaches that a coding sequence is a heterologous coding sequence that encodes an effector element. Examples of effector elements include reporter genes/proteins [0052] such as an expressible fluorescent protein [0053]. Ting et al. also teaches that additional effector elements include iCre [0065].
Regarding claims 91 and 92, Ting et al. teaches vectors (e.g., AAV) modified to include capsids that cross the blood-brain barrier (BBB). Examples of AAV with viral capsids that cross the blood brain barrier include AAV9, AAVrh.10, AAV1 R6, AAV1 R7, rAAVrh.8, AAV-BR1, AAV-PHP.S, AAV-PHP.B, and AAV-PPS [0093].
Regarding claim 93, Ting et al. teaches that particular examples of promoters include minBglobin [0070].
Regarding claims 94 and 95, Ting et al. teaches that expression constructs are provided within vectors. Useful vectors include viral vectors [0071].
Regarding claim 96, Ting et al. teaches a vector comprising an artificial expression construct wherein the vector is a recombinant adeno-associated viral vector [claim 19].
The applied reference has a common applicant and joint inventor with the instant application. Based upon the earlier effectively filed date of the reference, it constitutes prior art under 35 U.S.C. 102(a)(2). This rejection under 35 U.S.C. 102(a)(2) might be overcome by: (1) a showing under 37 CFR 1.130(a) that the subject matter disclosed in the reference was obtained directly or indirectly from the inventor or a joint inventor of this application and is thus not prior art in accordance with 35 U.S.C. 102(b)(2)(A); (2) a showing under 37 CFR 1.130(b) of a prior public disclosure under 35 U.S.C. 102(b)(2)(B) if the same invention is not being claimed; or (3) a statement pursuant to 35 U.S.C. 102(b)(2)(C) establishing that, not later than the effective filing date of the claimed invention, the subject matter disclosed in the reference and the claimed invention were either owned by the same person or subject to an obligation of assignment to the same person or subject to a joint research agreement.
Claims 87, 94, and 95 are rejected under 35 U.S.C. 102(a)(1) and 35 U.S.C. 102(a)(2) as being anticipated by Tsunoda et al. (US 2008/0250514; reference previously cited by the Examiner).
Regarding claim 87, Tsunoda et al. teaches a DNA construct, wherein a mammalian β-actin promoter is operably linked to an enhancer wherein the enhancer is derived from Cytomegalovirus (CMV) and wherein the CMV enhancer comprises the nucleotide sequence shown in SEQ ID NO: 4 [0022], [0023], and [0026]. SEQ ID NO: 4 (designated as Db) has a match to instant SEQ ID NO: 207 (designated as Qy) as shown in the alignment below.
Query Match 2.4%; Score 11.4; DB 1; Length 366;
Best Local Similarity 62.1%;
Matches 18; Conservative 0; Mismatches 11; Indels 0; Gaps 0;
Qy 154 CCCACTGTCCAGCTTAAAGGAAAATTCCA 182
|||| || || | ||| | |||||
Db 143 CCCATAGTAACGCCAATAGGGACTTTCCA 171
Regarding claim 94, Tsunoda et al. teaches a vector comprising the DNA construct of any one of [1] to [6] [0028] wherein [1] is a DNA construct, wherein a mammalian .beta.-actin promoter is operably linked to an enhancer [0022].
Regarding claim 95, Tsunoda et al. teaches that there is no limitation on the type of methods for introducing genes. The introduction can be achieved using viral vectors such as retrovirus. Viruses used as viral vectors include adeno-associated virus [0097].
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim 90 is rejected under 35 U.S.C. 103 as being unpatentable over Ting et al. (WO 2020/076614; reference cited by Applicant) as applied to claims 87, 89, and 91-96 above, and further in view of Konstantinova et al. (US 10,174,321; reference cited by Applicant).
Regarding claim 90, the teachings of Ting et al. are discussed above.
However, Ting et al. does not teach that the heterologous encoding sequence encodes an RNA having a sequence of SEQ ID NO: 165.
Konstantinova et al. teaches a double stranded RNA comprising a first RNA sequence and a second RNA sequence for use in inducing RNAi against Huntingtin exon 1 sequences [abstract]. Konstantinova et al. teaches that SEQ ID NO: 5 is the first sequence targeting huntingtin (guide) [sequence listing]. SEQ ID NO: 5 (designated as Db) has a match to instant SEQ ID NO: 165 (designated as Qy) as shown in the alignment below.
Query Match 100.0%; Score 21; DB 1; Length 21;
Best Local Similarity 100.0%;
Matches 21; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 AAGGACUUGAGGGACUCGAAG 21
|||||||||||||||||||||
Db 1 AAGGACUUGAGGGACUCGAAG 21
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the artificial expression construct of Ting et al. with the heterologous encoding sequence of Konstantinova et al. because Ting et al. taught an artificial expression construct which includes (i) an enhancer sequence that leads to selective expression of a coding sequence within a targeted central nervous system cell type, (ii) a coding sequence that is expressed, and (iii) a promoter and Konstantinova et al. taught the first sequence targeting huntingtin gene. One of ordinary skill in the art would have made such a modification because it would have amounted to a simple substitution of one known element for another to obtain predictable results.
Claim 90 is rejected under 35 U.S.C. 103 as being unpatentable over Tsunoda et al. (US 2008/0250514; reference previously cited by the Examiner) as applied to claims 87, 94, and 95 above, and further in view of Konstantinova et al. (US 10,174,321; reference cited by Applicant).
Regarding claim 90, the teachings of Tsunoda et al. are discussed above.
However, Tsunoda et al. does not teach that the heterologous encoding sequence encodes an RNA having a sequence of SEQ ID NO: 165.
Konstantinova et al. teaches a double stranded RNA comprising a first RNA sequence and a second RNA sequence for use in inducing RNAi against Huntingtin exon 1 sequences [abstract]. Konstantinova et al. teaches that SEQ ID NO: 5 is the first sequence targeting huntingtin (guide) [sequence listing]. SEQ ID NO: 5 (designated as Db) has a match to instant SEQ ID NO: 165 (designated as Qy) as shown in the alignment below.
Query Match 100.0%; Score 21; DB 1; Length 21;
Best Local Similarity 100.0%;
Matches 21; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 AAGGACUUGAGGGACUCGAAG 21
|||||||||||||||||||||
Db 1 AAGGACUUGAGGGACUCGAAG 21
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the artificial expression construct of Tsunoda et al. with the heterologous encoding sequence of Konstantinova et al. because Tsunoda et al. taught a DNA construct, wherein a mammalian β-actin promoter is operably linked to an enhancer wherein the enhancer is derived from Cytomegalovirus (CMV) and Konstantinova et al. taught the first sequence targeting huntingtin gene. One of ordinary skill in the art would have made such a modification because it would have amounted to a simple substitution of one known element for another to obtain predictable results.
Claims 89, 91, and 92 are rejected under 35 U.S.C. 103 as being unpatentable over Tsunoda et al. (US 2008/0250514; reference previously cited by the Examiner) as applied to claims 87, 94, and 95 above, and further in view of Zhang et al. (US 2018/0155716).
Regarding claims 89, 91, and 92, the teachings of Tsunoda et al. are discussed above.
However, Tsunoda et al. does not teach that the heterologous encoding sequence encodes a fluorescent protein (claim 89). Tsunoda et al. also does not teach that the expression construct is encapsidated by a capsid that crosses a blood brain barrier (claim 91) wherein the capsid comprises AAV9 (claim 92).
Zhang et al. teaches that the nucleic acid-targeting effector protein is part of a fusion protein comprising one or more heterologous protein domains. Examples of protein domains that may be fused to a CRISPR enzyme include, without limitation, epitope tags, reporter gene sequences. Examples of reporter genes include green fluorescent protein (GFP) [0956]. Zhang et al. also teaches that although AAV-2-based vectors were originally proposed for CFTR delivery to CF airways, other serotypes such as AAV-9 exhibit improved gene transfer efficiency in a variety of models of the lung epithelium. The more recent isolate, AAV-9, was shown to display greater gene transfer efficiency [1493].
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the artificial expression construct of Tsunoda et al. wherein the heterologous encoding sequence encodes a fluorescent protein as taught by Zhang et al. because Tsunoda et al. taught a DNA construct, wherein a mammalian β-actin promoter is operably linked to an enhancer wherein the enhancer is derived from Cytomegalovirus (CMV) and Zhang et al. taught that a fusion protein comprises one or more heterologous protein domains which include green fluorescent protein. One of ordinary skill in the art would have made such a modification because it would have amounted to combining known prior art elements to yield predictable results.
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the artificial expression construct of Tsunoda et al. wherein the construct is encapsidated by AAV9 as taught by Zhang et al. because Tsunoda et al. taught a DNA construct, wherein a mammalian β-actin promoter is operably linked to an enhancer wherein the enhancer is derived from Cytomegalovirus (CMV) and Zhang et al. taught that AAV-9 displays greater gene transfer efficiency than other AAV serotype vectors. One of ordinary skill in the art would have made such a modification because it would have amounted to combining known prior art elements to yield predictable results.
Claim 93 is rejected under 35 U.S.C. 103 as being unpatentable over Tsunoda et al. (US 2008/0250514; reference previously cited by the Examiner) as applied to claims 87, 94, and 95 above, and further in view of Morgan et al. (Molecular Therapy: Methods & Clinical Development 2020).
Regarding claim 93, the teachings of Tsunoda et al. are discussed above.
However, Tsunoda et al. does not teach that the promoter comprises minBglobin.
Morgan et al. designed a reporter vector that contained only the minimal human β-globin promoter as the major cis-regulatory element driving expression of the bAS3-P2A-mCitrine (mCit) transgene. Then, a 103-bp sequence derived from the locus control region’s (LCR’s) HS2 core region was incorporated into the multiple cloning site of LV-reporter as HS2 has been shown to possess robust erythroid specific enhancer activity throughout all stages of human development. The 103-bp HS2 enhancer sequence provided increased expression of the reporter gene in human umbilical cord blood-derived erythroid progenitor clone 2 cells when compared to control. This finding suggests that approximately 100-bp regions of the locus control region (LCR) could enhance expression from the minimal human β-globin promoter [page 1001, left column, last paragraph bridging to right column].
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the artificial expression construct of Tsunoda et al. wherein the promoter comprises minBglobin because Tsunoda et al. taught a DNA construct, wherein a mammalian β-actin promoter is operably linked to an enhancer wherein the enhancer is derived from Cytomegalovirus (CMV) and Morgan et al. taught that approximately 100-bp regions of the LCR could enhance expression from the minimal human β-globin promoter. One of ordinary skill in the art would have made such a modification because it would have amounted to a simple substitution of one known element for another to obtain predictable results.
Claim 96 is rejected under 35 U.S.C. 103 as being unpatentable over Tsunoda et al. (US 2008/0250514; reference previously cited by the Examiner) as applied to claims 87, 94, and 95 above, and further in view of Aponte-Ubillus et al. (Applied Microbiology and Biotechnology 2018).
Regarding claim 96, the teachings of Tsunoda et al. are discussed above.
However, Tsunoda et al. does not teach that the viral vector comprises a recombinant adeno-associated viral vector.
Aponte-Ubillus et al. teaches that recombinant adeno-associated virus (rAAV) vectors are increasingly popular tools for gene therapy applications. Their non pathogenic status, low inflammatory potential, availability of viral serotypes with different tissue tropisms, and prospective long lasting gene expression are important attributes that make rAAVs safe and efficient therapeutic options [abstract].
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the artificial expression construct of Tsunoda et al. wherein the construct is within a recombinant AAV vector because Tsunoda et al. taught a DNA construct, wherein a mammalian β-actin promoter is operably linked to an enhancer wherein the enhancer is derived from Cytomegalovirus (CMV) and Aponte-Ubillus et al. taught that rAAV vectors have a non-pathogenic status, low inflammatory potential, and availability of viral serotypes with different tissue tropisms. One of ordinary skill in the art would have made such a modification because it would have amounted to combining known prior art elements to yield predictable results.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to CHRISTINA TRAN whose telephone number is (571)270-0550. The examiner can normally be reached M-F 7:30 - 5:00pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/C.T./
Examiner, Art Unit 1637
/Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637
Prosecution Insights