DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Priority
The instant application is a 35 U.S.C. 371 national phase application and claims priority to International Application No. PCT/EP2021/072452 (filing date 08/12/2021), which claims the benefit of the prior-filed EP20190722.7 (filing date 08/12/2020).
Status of Application/Claims
The preliminary amendment, filed 02/10/2023, is acknowledged. Claims 3-6, 10, and 13 are amended. Claims 1-16 are currently pending.
Information Disclosure Statements
The information disclosure statements (IDSs) submitted on 10/04/2023, 11/14/2023, and 12/06/2023 are in compliance and have been considered by the examiner except where noted below:
With regard to pdf documents labeled C8 and C9 on the IDS submitted on 10/04/2023 and the pdf document labeled C28 on the IDS submitted on 11/14/2023, these documents are not legible due to poor resolution. These references were crossed out on the IDS and were not considered by the examiner.
Claim Interpretation
The following is a quotation of 35 U.S.C. 112(f):
(f) Element in Claim for a Combination. – An element in a claim for a combination may be expressed as a means or step for performing a specified function without the recital of structure, material, or acts in support thereof, and such claim shall be construed to cover the corresponding structure, material, or acts described in the specification and equivalents thereof.
The following is a quotation of pre-AIA 35 U.S.C. 112, sixth paragraph:
An element in a claim for a combination may be expressed as a means or step for performing a specified function without the recital of structure, material, or acts in support thereof, and such claim shall be construed to cover the corresponding structure, material, or acts described in the specification and equivalents thereof.
The claims in this application are given their broadest reasonable interpretation using the plain meaning of the claim language in light of the specification as it would be understood by one of ordinary skill in the art. The broadest reasonable interpretation of a claim element (also commonly referred to as a claim limitation) is limited by the description in the specification when 35 U.S.C. 112(f) or pre-AIA 35 U.S.C. 112, sixth paragraph, is invoked.
As explained in MPEP § 2181, subsection I, claim limitations that meet the following three-prong test will be interpreted under 35 U.S.C. 112(f) or pre-AIA 35 U.S.C. 112, sixth paragraph:
(A) the claim limitation uses the term “means” or “step” or a term used as a substitute for “means” that is a generic placeholder (also called a nonce term or a non-structural term having no specific structural meaning) for performing the claimed function;
(B) the term “means” or “step” or the generic placeholder is modified by functional language, typically, but not always linked by the transition word “for” (e.g., “means for”) or another linking word or phrase, such as “configured to” or “so that”; and
(C) the term “means” or “step” or the generic placeholder is not modified by sufficient structure, material, or acts for performing the claimed function.
Use of the word “means” (or “step”) in a claim with functional language creates a rebuttable presumption that the claim limitation is to be treated in accordance with 35 U.S.C. 112(f) or pre-AIA 35 U.S.C. 112, sixth paragraph. The presumption that the claim limitation is interpreted under 35 U.S.C. 112(f) or pre-AIA 35 U.S.C. 112, sixth paragraph, is rebutted when the claim limitation recites sufficient structure, material, or acts to entirely perform the recited function.
Absence of the word “means” (or “step”) in a claim creates a rebuttable presumption that the claim limitation is not to be treated in accordance with 35 U.S.C. 112(f) or pre-AIA 35 U.S.C. 112, sixth paragraph. The presumption that the claim limitation is not interpreted under 35 U.S.C. 112(f) or pre-AIA 35 U.S.C. 112, sixth paragraph, is rebutted when the claim limitation recites function without reciting sufficient structure, material or acts to entirely perform the recited function.
Claim limitations in this application that use the word “means” (or “step”) are being interpreted under 35 U.S.C. 112(f) or pre-AIA 35 U.S.C. 112, sixth paragraph, except as otherwise indicated in an Office action. Conversely, claim limitations in this application that do not use the word “means” (or “step”) are not being interpreted under 35 U.S.C. 112(f) or pre-AIA 35 U.S.C. 112, sixth paragraph, except as otherwise indicated in an Office action:
Claim 15 invokes 35 U.S.C. 112(f) or pre-AIA 35 U.S.C. 112, sixth paragraph, and the examiner’s analysis using the three-prong test is as follows:
the claim limitation “means” is used for performing a claimed function;
the term “means” is not modified by functional language, but is linked by the transition phrase “to determine” (i.e., “means to determine”); and
the term “means” has been determined to not be modified by sufficient structure, material, or acts for performing the claimed function. While claim 15 recites the structural element “primer,” applicant disclosure supports that a primer is use as a probe for detecting nucleic acid (p.20). While the instant specification also supports that the kit is comprised of additional structural components that aid in DNA extraction (i.e., lysis/binding buffer, digestion buffer, wash buffers, elution buffers, enzymes, and spin columns/collection tubes) there is no claimed structure for the “kit” that would aid in a “means to determine” the sequence detected by the primer probe.
Thus, it is the examiner’s interpretation that the kit is interpreted to not be modified by functional language, but instead by a mental process; and is not modified by sufficient structure, material, or acts for performing the claimed function.
Nucleotide and/or Amino Acid Sequence Disclosures
REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
SEQ ID NOs: 36 and 38 are nucleic acid sequences in the disclosure (p.31), but are amino acid sequences in the CRF sequence listing.
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
the name of the ASCII text file;
the date of creation; and
the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or
In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
Specific deficiencies and the required response to this Office Action are as follows:
Specific deficiency - This application fails to comply with the requirements of 37 CFR 1.821 - 1.825 because the "Sequence Listing" part of the disclosure submitted as a PDF file (37 CFR 1.821(c)(2)) or on physical sheets of paper (37 CFR 1.821(c)(3)) is not the same as the CRF of the "Sequence Listing" as required by 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii).
Required response - Applicant must provide:
A replacement "Sequence Listing" as described above in items 1) c) or d) in accordance with 37 CFR 1.825(b)(1)(ii) or (iii); as well as
An amendment specifically directing its entry into the application as required by 37 CFR 1.825(b)(2)(ii);
A statement that identified the locations of any deletions, replacements or additions to the “Sequence Listing” as required by 37 CFR 1.825(b)(3);
A statement that the "Sequence Listing" added by amendment includes no new matter as required by 37 CFR 1.825(b)(5);
A statement that indicates support for the amendment in the application, as filed, as required by 37 CFR 1.825(b)(4); and
A statement that the content of the previously-filed CRF is identical to the "Sequence Listing" part of the disclosure added by amendment as required by 37 CFR 1.825(b)(7), where provided under item 1) c) or d) (note that where a "Sequence Listing" part of the disclosure is provided under item 1) a) or b), the text file will also serve as the CRF, and the statement of identity is not required);
OR
A CRF as required by 37 CFR 1.821(e)(1) or 1.821(e)(2); and
A statement that the content of the CRF is identical to the "Sequence Listing" part of the disclosure previously submitted as a PDF file (37 CFR 1.821(c)(2)) or on physical sheets of paper (37 CFR 1.821(c)(3)), as required by 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii).
Specification
The use of the terms Prism, GraphPad, Proteros, Biotrend, Lieca, Sigma, and VisiView, which are trade names or marks used in commerce, have been noted in this application. The terms should be in all caps wherever they appear or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the terms.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code. Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01.
Hyperlinks located on p.29 contain prefixes (underlined) and are not limited to the top-level domains (see bold).
“https://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?showRare=on&chooseRs=coding&go=Go&locusid=2903” and
“https://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?showRare=on&chooseRs=coding&go=Go&locusid=2904”
Claim Objections
Claim 4 is objected to because of the following informalities: The term “a polypeptide” in line 1 should be corrected to “the polypeptide” to clearly indicate reference to the polypeptide of claim 1
Claim 5 is objected to because of the following informalities: The term “a polypeptide” in lines 3-4 should be corrected to “the polypeptide” to clearly indicate reference to the polypeptide of claim 1.
Claim 6 is objected to because of the following informalities: The term “a polypeptide” in line 2 should be corrected to “the polypeptide” to clearly indicate reference to the polypeptide of claim 1.
Claim 8 is objected to because of the following informalities: Claim 8 recites “…the region corresponding to amino SEQ ID NO: 1…” in line 3 which should be corrected to “…the region corresponding to amino acid SEQ ID NO: 1…”.
Claim 14 is objected to because of the following informalities: The terms “see also” in lines 5-7 (5 instances) should be removed to indicate that the recited SEQ ID NOs are in fact definitions for the recited associated GluN2A and GluN2B mutants.
Appropriate correction is required.
Claim Rejections - 35 USC § 101
Claims 1-7, 10, 12-15 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a natural phenomenon judicial exception without significantly more. The claims are drawn to naturally occurring peptides. The judicial exception is not integrated into practical application because the claims read on natural phenomena. The claims do not include additional elements that are sufficient to amount to significantly more than the judicial exception.
The claims are evaluated using the “Subject Matter Eligibility Test for Products and Processes” flow chart as shown in MPEP § 2106.III.
Step 1: Is the claim drawn to a process, machine, manufacture or composition of matter?
Yes.
Claims 1 is drawn to a composition of matter (a polypeptide) which is one of the four statutory categories. Claims 2-7, 10, and 13 are dependent on claim 1 and do not overcome the issue.
Claim 2 is drawn to a composition of matter (a polypeptide) which is one of the four statutory categories.
Claim 4 is drawn to a composition of matter (a nucleic acid) which is one of the four statutory categories.
Claim 12 is drawn to a process (a method for assessing susceptibility of a subject to toxicity) which is one of the four statutory categories.
Claims 14 is drawn to a process (a method for identifying a compound potentially interacting with GluN2A or GluN2B protein) which is one of the four statutory categories.
Claim 15 is drawn to a composition of matter (a kit) which is one of the four statutory categories.
Step 2A, Prong One: Does the claim recite an abstract idea, law of nature, or natural phenomenon?
Yes.
With respect to claims 1-7, 10, and 13, SEQ ID NOs: 1 and 9 represent amino acid fragments from the sequence of the full-length human GluN2A protein (see
Uniprot.org, Q12879, NMDE1_Human, residues 861-878, 1996) and SEQ ID NOs: 7 and 15 represent amino acid fragments from the sequence of the full-length human GluN2B protein (see Uniprot.org, Q13224, NMDE2_Human, residues 862-879, 2001). Therefore, the claims recite naturally occurring phenomena.
With respect to claim 4, the claim recites a nucleic acid encoding the polypeptides recited in claim 1 described above. Thus, claim 4 also recites naturally occurring phenomena.
With respect to claim 12, the claim indicates that it is drawn to a method for assessing susceptibility of a patient, and in subparts a)-f) of the claim it identifies what sequences correspond to various susceptibility levels. This indicates that the claim is drawn to a mental analysis of and conclusion being drawn from the results of data gathering steps. Such mental activity represents an abstract idea according to MPEP 2106.04(a)(2) III. In addition, as indicated above, the claim sets forth what sequence mutations correlate with various susceptibility levels. These represent laws of nature/natural phenomena. See e.g., MPEP 2106.04(b).
With respect to claim 14, the claim is indicated to be a process for identifying a compound potentially interacting with a domain of a GluN2A or GluN2B protein, comprising the steps of performing a virtual docking of a candidate compound to the GluN2 polypeptide or variant, and determining a docking score or internal strain for the docking. The claim language is thereby describing a relationship between the docking score of a candidate compound and its ability to interact with the target polypeptide. This correlation is a natural phenomenon, and the corresponding identification of a compound as interacting with the target polypeptide based on the docking score falls within the abstract idea category of mental steps.
With respect to claim 15, the kit is limited to structural features that are primers including SEQ ID NO: 29-40 that represent fragments of the human genome corresponding to Grin2A and Grin2B. Therefore, the claims recite naturally occurring phenomena. Genomic locations for SEQ ID NOs: 29-40 are on positive and negative strands of human chromosome 16 and are taught by NCBI. Homo sapiens genome assembly GRCh38.p13 – “Grin2A” and “Grin2B”. NLM (2019), herein referred to as NCBI (see genomic locations listed below):
SEQ ID NO/Gene
Start Location
End Location
Positive/Negative Strand
Grin2a
SEQ ID NO: 29
9802549
9802568
Negative
SEQ ID NO: 30
9802164
9802183
Positive
SEQ ID NO: 31
9798625
9798647
Negative
SEQ ID NO: 32
9798280
9798301
Positive
SEQ ID NO: 33
9802487
9802504
Negative
SEQ ID NO: 34
9798558
9798575
Negative
Grin2b
SEQ ID NO: 35
13441689
13441708
Negative
SEQ ID NO: 36
13441254
13441273
Positive
SEQ ID NO: 37
13439286
13439305
Negative
SEQ ID NO: 38
13438911
13438930
Positive
SEQ ID NO: 39
13441663
13441681
Negative
SEQ ID NO: 40
13439251
13439269
Negative
Step 2A, Prong Two: Does the claim recite additional elements that integrate the judicial exception (JE) into an application?
No.
Claim 1 recites SEQ ID NOs: 1 and 7 which encode for short peptide fragment of the natural peptide sequence for the natural protein listed above and does not integrate the judicial exception into a practical application. See MPEP 2106. Claims 2-7, 10, and 13 are dependent on claim 1 and do not overcome the issue.
Claim 2 recites the additional limitations SEQ ID NO: 9 and 15 which comprise SEQ ID NOs: 1 and 7, respectively, with additional flanking amino acid residues which are also part of the naturally occurring GluN2A and GluN2B proteins listed above. These limitations do not integrate the judicial exception into a practical application.
Claim 4 recites a nucleic acid that encodes the polypeptide of claim 1 which does not integrate the judicial exception into a practical application.
Claim 12, in addition to the JE, recites the step of sequencing genomic nucleic acids. However, these steps are merely gathering data necessary to apply the JE. Such steps are considered to be insignificant extra-solution activity that fails to integrate the JEs into a practical application. See, MPEP 2106.05(g) (3).
Claim 14, in addition to the JE, claim 14 also identifies a step for the virtual docking of the candidate compound to the target polypeptide and determining the docking score or internal strain of the docking. This is mere data gathering required in order to apply the JE. As such, this is considered to be insignificant extra-solution activity that fails to integrate the JE into a practical application. It is noted that the claim also recites an additional step of contacting the compound to the target polypeptide in vitro or in vivo. However, this step is indicated to be optional, and is therefore also insufficient to integrate the JE into a practical application.
Claim 15 recites a kit wherein the only claimed structural component of the kit is a primer of a naturally occurring human sequence. While claim does recite that the primers are being used as means for determining the sequence partial sequences for the GRIN2A and GRIN2B genes, the kit is drawn to the structural products recited in the claim (i.e., primer SEQ ID NOs) and; therefore, the kit itself does not integrate the JE into a practical application.
Step 2B: Does the claim recite additional elements that amount to significantly more than the judicial exception?
There are no additional recited elements in claims 1 and 2 that amount to significantly more than what is found in the naturally occurring protein. Claims 2-7, 10, and 13 are dependent on claim 1 and do not overcome the issue.
The limitations of claim 4 do not amount to significantly more because a nucleic acid encoding the naturally occurring polypeptide also is found in nature.
The data gathering steps limitations of claim 12 fail to add significantly more to the claim. They recite the step of sequencing genomic nucleic acids, but do so at a high level of generality. This indicates that the process is relying on well-understood, routine, and conventional methods for performing the sequencing.
The limitations in claim 14 recite the virtual docking of the candidate with the target polypeptides and determine the relevant docking score. However, the steps are recited at a high level of generality. This indicates that the process is relying on well-understood, routine, and conventional methods for performing the sequencing.
The kit recited in claim 15 does not amount to significantly more than the primer which is what is found in the naturally occurring human genome sequence.
Therefore, claims 1-7, 10, 12-15 encompass naturally occurring phenomena that are not markedly different in structure from naturally occurring products; and, claim 12 additionally recites a mental process/abstract idea.
Without any evidence to the contrary, the polypeptide functionality and structure
would not be markedly different from that of the naturally occurring GluN2A and GluN2B. Because there is no difference in the characteristics (structural, functional, or otherwise) between the claimed and naturally occurring proteins, the claimed invention does not have markedly different characteristics from what exists in nature. See, e.g., MPEP 2106).
Accordingly, the claims are directed to judicial exceptions. Because the claims
do not include any additional features that integrate it into a practical application or that could add significantly more to the exceptions, the claims do not qualify as eligible subject matter under 35 U.S.C §101.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 3, 5-6, 8-9, 11-12, and 15 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 3 recites the limitation "the heterologous polypeptide sequence" in line 3. There is insufficient antecedent basis for this limitation in the claim. Line 2 refers to an “amino acid sequence heterologous…”. The claim recites a heterologous amino acid sequence but an amino acid sequence is not necessarily a polypeptide. Additionally, claim 3 recites the limitation "…in particular wherein the heterologous polypeptide sequence is selected from one or more of… a membrane anchoring polypeptide, a sequence of a protein transduction domain and a sequence of a tag" in line 3. It is unclear whether the limitations following the term “in particular” are required limitations of the claim or if they are merely examples. Thus, the claim is rendered indefinite. For further examination, the limitations following the term “in particular” are considered to not be required limitations for the claim.
Claim 5 recites the limitation "…in particular for treating neuroblastoma…" in line 3. It is unclear whether the term “neuroblastoma” is a required limitation of the claim or if it is merely an example. Thus, the claim is rendered indefinite. For further examination, the limitations following the term “in particular” are considered to not be required limitations for the claim.
Claim 6 recites the limitations “the canonical sequence motif,” “a variant sequence” and “said aforementioned sequence motif” in lines 6-7 and in lines 12-13. It is unclear whether “said aforementioned sequence motif” refers to “the canonical sequence motif” or “a variant sequence” in each case as it pertains to GluN2A and GluN2B. Thus, the claim is rendered indefinite. For further examination, the term “said aforementioned sequence motif” is interpreted as referencing “the canonical sequence motif.” Further, there is insufficient antecedent basis for the limitation “the canonical sequence motif” in the claim.
Additionally, claim 6 recites a list comprising a, b, c but is missing a conjunction between b and c, such as “and” or “or”. Thus, it is unclear if all three of a, b, and c are required or if only one of a, b, or c is required.
Claim 8 recites the limitation "…in particular wherein the antibody, nanobody or anticalin binds to….SEQ ID NO: 1…SEQ ID NO: 27" in lines 3-8. Due to the use of the term “in particular,” it is unclear whether the claim requires that the antibody, nanobody or anticalin bind one of the SEQ ID NOs in the recited list or if the SEQ ID NOs are merely examples. Thus, the claim is rendered indefinite.
Further, claim 8 contains the trademark/trade name “nanobody.” Where a trademark or trade name is used in a claim as a limitation to identify or describe a particular material or product, the claim does not comply with the requirements of 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph. See Ex parte Simpson, 218 USPQ 1020 (Bd. App. 1982). The claim scope is uncertain since the trademark or trade name cannot be used properly to identify any particular material or product. A trademark or trade name is used to identify a source of goods, and not the goods themselves. Thus, a trademark or trade name does not identify or describe the goods associated with the trademark or trade name. In the present case, the trademark/trade name is used to identify/describe a molecule binding to the C-terminal cytoplasmic domain of a GluN2A or GluN2B protein, and, accordingly, the identification/description is indefinite. For further examination, the claim is interpreted to mean that the antibody, nanobody, or anticalin can bind any GluN2A or GluN2B antibody that contains the amino acid region of SEQ ID NOs: 1 and 7.
Claim 9 recites “…wherein the antibody, nanobody or anticalin protects against, induces or ameliorates NMDA receptor mediated toxicity.” It is unclear how a single antibody, nanobody, or anticalin could induce NMDA mediated toxicity and also protect against and ameliorate NMDA mediated toxicity at the same time. Thus, the claim is rendered indefinite. For further examination, the claim is interpreted to mean that the antibody, nanobody, or anticalin protects against or ameliorates NMDA receptor toxicity.
Claim 11 recites the phrases “…wherein the partial sequence of GRIN2A gene comprises at least the gene region usually encoding the canonical sequence…” and “…wherein the partial sequence of GRIN2B gene comprises at least the gene region usually encoding the canonical sequence…”. The use of the term “usually” in both cases renders the claim indefinite because metes and bounds of the claim are unclear.
Claim 12 recites, “…wherein a subject with: a)…b)…c)…d)…e)…and f)…” regarding the subject having a canonical GluN2A and/or GluN2B but also having GluN2A and GluN2B mutations. It is unclear how a single subject could harbor both a canonical sequence as well as all recited mutant sequences for GluN2A and/or GluN2B; and, therefore, simultaneously exhibit regular, increased, and decreased susceptibility to NMDA receptor toxicity at the same time. Thus, the claim is rendered indefinite. For further examination, the claim is interpreted to mean, ““…wherein a subject with: a)…; and/or b)…; and/or c)…; and/or d)…; and/or e)…; and/or f)…”
Claim 15 recites, “A kit comprising means to determine…the sequence…”. As stated in the 112f analysis above, the only claimed structural element is a primer and the claim is determined not to invoke 112f because “means” is not considered to be modified by functional language, but instead, by the phrase “to determine” which is a mental process. Thus, it is unclear how a kit/primer would determine the sequence in a sample and the claim is rendered indefinite. For further examination, claim 15 is interpreted as “A kit comprising means to detect…the sequence.”
Further, claim 15 recites the limitation "…in particular wherein the kit comprises a primer selected from…SEQ ID NO: 29….SEQ ID NO: 40" in lines 6-10. The use of the phrase “in particular” renders the claim unclear because it is not clear whether the claim requires a primer selected from a SEQ ID NO in the list or if the SEQ ID NOs are merely examples. Thus, the claim is rendered indefinite. For further examination, a primer selected from the recited SEQ ID NOs is considered to be required.
Additionally, as indicated above, primers defined by SEQ ID NOs: 36 and 38 are designated as nucleotide sequences in the disclosure (p.31) but are designated as amino acid sequences in the CFR listing; thus, rendering the claim indefinite. For further examination, SEQ ID NOs: 36 and 38 are interpreted to be nucleotide sequences AACTGCCCAAATCCCACACA and AACTGCCCAAATCCCACACA, respectively, according to the disclosure.
Claim Rejections - 35 USC § 112(a)
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 8-9 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. THIS IS A WRITTEN DESCRIPTION REJECTION.
Claim 8 is drawn to an antibody, nanobody, or anticalin that binds the C-terminal cytoplasmic domain of a GluN2A or GluN2B protein, but not to a GluN2A or GluN2B deletion mutant lacking the region corresponding to amino (acid) SEQ ID NO: 1 and SEQ ID NO: 7 but binding to any of the peptides of SEQ ID NOs: 1-16, 21-22, 24, and 26-27. Claim 9 further limits claim 8 and recites an additional function for the antigen binding molecule wherein the antibody, nanobody, or anticalin “protects against, induces or ameliorates NMDA receptor mediated toxicity."
The claims are drawn to an antibody, nanobody, or anticalin that is limited only by the recited functional limitations. As the claims are drawn to functional limitations without additional structural limitations, the claims are drawn to what the molecule does (function) rather than by what the molecule is (structure). See MPEP 2173.05(g).
The instant specification discloses a description for an antibody, nanobody, or anticalin based on its function but does not provide sufficient structural information to allow one of ordinary skill in the art to identify or produce a molecule that would perform the claimed function.
Regarding antigens that bind applicant antibody: The disclosure states that the antibody can bind the C-terminal cytoplasmic domain of a GluN2A or GluN2B protein, but not to a GluN2A or GluN2B deletion mutant that lacks amino acids 861-878 of GluN2A or amino acids 862-879 of GluN2B (p.11, para.4 – p.12, para.1). The disclosure further states that the antibody will be specific for the inventive region which was identified as the region relevant for induction of NMDA receptor mediated toxicity; and that the antibody may bind to a polypeptide sequence selected from any of SEQ ID NOs: 1-16, 21-22, 24, and 26-27 (p.12, para.1). These SEQ ID NOs are for polypeptides that have variations in their amino acid sequences. Thus, applicant suggests that the same antibody is able to bind multiple amino acid sequences of varied identity. The disclosure further provides that the antibody can bind these polypeptides in order to prevent interaction of the GluN2A or GluN2B region of interest with other proteins or interaction partners, in particular TRPM4 (p.12, para.1). The disclosure specifies that the antibody is a single-domain antibody (sdAb) but provides no further structural information for the antibody that is able to bind a single GluN2A or GluN2B C-terminal domain, let alone an antibody that can bind multiple polypeptides harboring amino acid variations defined by the SEQ ID NOs listed above. There are no further descriptions for the structure of an antibody in the disclosure and there are no drawings provided to support any specific antibody with defined structure that is able to bind the recited polypeptides in order to perform the claimed function.
The instant disclosure does not provide any examples of antibodies, nanobodies, or anticalins harboring a structure that has the claimed function. Thus, there is no clear description regarding the structure of a molecule to be considered that could bind any of the above listed polypeptides defined by the above listed SEQ ID NOs. The instant disclosure does not disclose a structure-function relationship which would allow an ordinarily skilled artisan to produce an antibody, nanobody, or anticalin that would have the claimed function. For example, the disclosure does not identify regions, domains, or sequences for the claimed molecule that would exhibit the structure-function relationship of the claimed antibody, nanobody, or anticalin.
F. Overall, the disclosure does not provide any example of an antibody, nanobody, or anticalin that can bind to the C-terminal cytoplasmic domain of a GluN2A or GluN2B protein, including mutant polypeptides with amino acid variations, but not to a deletion mutant. The specification does not identify how the function is performed or how the result is achieved. There is no evidence of an antibody, nanobody, or anticalin structure in the disclosure. See MPEP 2163.03 (V).
G. The state of the art around the time of the effective filing date of the claimed invention also does not disclose a structure-function relationship that would allow a person of ordinary skill to predicably determine the structure of an antibody, nanobody, or anticalin that would be able to perform the claimed functions.
Hummer, A.M., et al. Advances in computational structure-based antibody design Current Opinion in Structural Biology (2022), 74:102379, p.1-7, demonstrates ongoing unpredictability between antibody binding and epitopes. Specifically, Hummer teaches that traditional methods for antibody development, such as deriving antibodies from hybridomas of inoculated animals or from library assembly followed by display techniques are not only costly and time consuming but also are not necessarily able to produce antibodies that bind to the desired site (epitope) on an antigen. Hummer teaches that computational antibody design methods offer a way to overcome these limitations, but are held back by the lack of accurate antibody and antigen structures (p.1, col.2, para.2). Hummer provides a review on how advances in protein structure prediction and other areas are bringing us closer to being able to entirely computationally designed antibodies that bind strongly to a defined epitope (p.1, col.2, para.3) demonstrating that in 2022 predictable structure function relationships were still not known. Hummer acknowledges this in their discussion of future directions stating that “Several challenges still remain for true computational structure-based antibody design. While there has been great progress in protein structure prediction, current methods are not yet able to accurately predict the position of the side chain atoms or structural changes on binding. For antibodies, accurately modeling the CDR-H3 loop remains a major obstacle. Additionally, improvements in paratope and epitope prediction, both in terms of accuracy and specificity (predicting the types of binding interactions for residues), will be needed to help improve docking for high-throughput virtual screening.” (p.4, . col.2, para.3). Thus, Hummer teaches the difficulties in predicting the relationship between antibody structure and the epitopes to which they bind demonstrating a lack of predictability in the field between antibody structure and function.
Paul. Fundamental Immunology, 3rd Edition, 1993, pp. 292-295, herein referred to as Paul, teaches that the amino acid sequences and conformations of each of the heavy and light chain CDRs are critical in maintaining the antigen binding specificity and affinity, which is characteristic of the immunoglobulin. It is expected that all of the heavy and light chain CDRs in their proper order and in the context of framework sequences which maintain their required conformation, are required in order to produce a protein having antigen-binding function and that proper association of heavy and light chain variable regions is required in order to form functional antigen binding sites (p. 293).
In view of Amgen v. Sanofi, 872 F.3d 1367 (Fed. Cir. 2017) and the Office’s February 2018 memo clarifying written description guidance for claims drawn to antibodies, the 2008 Written Description Training Materials are outdated and should not be relied upon as reflecting the current state of law regarding 35 U.S.C. 112. Further, a “newly characterized antigen” test flouts basic legal principles of the written description requirement (Amgen v. Sanofi, 872 F.3d 1367 (Fed. Cir. 2017)). Adequate written description of a newly characterized antigen alone is not considered adequate written description of a claimed antibody to that newly characterized antigen. Where an antibody binds to an antigen tells one nothing about the structure of any other antibody. Also, see the Board’s decision in Appeal 2017-010877 (claims to “A monoclonal antibody that binds a conformational epitope formed by amino acids 42-66 of SEQ ID NO:1”).
The functional requirements of the claimed antibodies is the sort of wish list of properties which fails to satisfy the written description requirement because “antibodies with those properties have not been adequately described.” Centocor, 636 F.3d at 1352.
The “claims merely recite a description of the problem to be solved while claiming all solutions to it and . . . cover any compound later actually invented and determined to fall within the claim’s functional boundaries— leaving it to the pharmaceutical industry to complete an unfinished invention.” Ariad Pharmaceuticals, Inc. v. EliLilly and Co.,598 F.3d 1336, 1353 (Fed. Cir. 2010).
Because the disclosure fails to describe the structure for antibodies that perform the claimed functions, and because antibody specificity is highly variant and antibody binding to antigen is dependent largely on antibody structure and the 6 CDRs forming the variable regions, the disclosure insufficient describes antibodies that will predictably bind to peptides of the recited SEQ ID NOs. Thus, one of skill in the art would reasonably conclude that the disclosure fails to provide support for structures of antibody species in claims 8 and 9 that would predictably and specifically bind the recited antigens.
Vas-Cath Inc. v. Mahurkar, 19USPQ2d 1111, clearly states “applicant must convey with reasonable clarity to those skilled in the art that, as of the filing date sought, he or she was in possession of the invention. The invention is, for purposes of the ‘written description’ inquiry, whatever is now claimed.” (See page 1117.) The specification does not “clearly allow persons of ordinary skill in the art to recognize that [he or she] invented what is claimed.” (See Vas-Cath at page 1116). As discussed above, even though Applicant may propose methods of screening for possible members of the genus, the skilled artisan cannot envision the detailed chemical structure of the encompassed antibodies that would predictably bind TNFR2, and therefore conception is not achieved until reduction to practice has occurred, regardless of the complexity or simplicity of the method of isolation. Adequate written description requires more than a mere statement that it is part of the invention and reference to a potential method of isolation. The compound itself is required. See Fiers v. Revel, 25 USPQ2d 1601 at 1606 (CAFC 1993) and Amgen Inc. v. Chugai Pharmaceutical Co. Ltd., 18 USPQ2d 1016. See Ariad, 94 USPQ2d at 1161; Centocor at 1876 (“The fact that a fully-human antibody could be made does not suffice to show that the inventors of the '775 patent possessed such an antibody.”)
One cannot describe what one has not conceived. See Fiddes v. Baird, 30 USPQ2d 1481 at 1483. In Fiddes, claims directed to mammalian FGF’s were found to be unpatentable due to lack of written description for that broad class. The specification provided only the bovine sequence. Applicant is reminded that Vas-Cath makes clear that the written description provision of 35 U.S.C. §112 is severable from its enablement provision (see page 1115).
H. Overall, it is not evident from the disclosure or the prior art that applicant was in possession of an antibody, nanobody, or anticalin that can bind the claimed epitopes. There is no support providing that applicant had possession nor did applicant provide a sufficient description for an antibody, nanobody, or anticalin. This subject matter was not described in the specification in such a way as to reasonably convey to one of ordinary skill in the art that applicant was in possession of the claimed invention at the time of filing and, therefore, the claims do not meet the written description requirement.
Claims 8 and 9 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention. THIS IS AN ENABLEMENT REJECTION.
Enablement is considered in view of the Wands factors (MPEP 2164.01(a)). The court in Wands states: “Enablement is not precluded by the necessity for some experimentation such as routine screening. However, experimentation needed to practice the invention must not be undue experimentation. The key word is ‘undue,’ not ‘experimentation.’” (Wands, 8 USPQ2d 1404). Clearly, enablement of a claimed invention cannot be predicated on the basis of quantity of experimentation required to make or use the invention. “Whether undue experimentation is needed is not a single, simple factual determination, but rather is a conclusion reached by weighing many factual considerations.” (Wands, 8 USPQ2d 1404). The factors to be considered in determining whether undue experimentation is required include: The nature of the invention; the breadth of the claims; the amount of direction provided by the inventor; the existence of working examples; the state of the prior art; the level of predictability in the art; the quantity of experimentation needed to make or use the invention based on the content of the disclosure; and, the level of one of ordinary skill. While all of these factors are considered, a sufficient amount for amount for a prima facie case are discussed below.
The breadth of the claims is found in claim 8 and is described in detail above.
The nature of the invention is a genus of antibodies, nanobodies, or anticalins that can bind the peptides of SEQ ID NOs listed in claim 8.
The level of skill of one skilled in this art is high.
The specification does not teach provide for any antibody, nanobody, or anticalin structures that can bind the recited antigens as described above.
The state of the prior art is such that it is well established in the art that the formation of an intact antigen-binding site of antibodies generally requires the association of the complete heavy and light chain variable regions of a given antibody, each of which consists of three CDRs or hypervariable regions, which provide the majority of the contact residues for the binding of the antibody to its target epitope (described by Paul above).
Thus, the state of the art recognized that it would be highly unpredictable that any antibody of any structure would have the specifically claimed antigen binding function. The minimal structure which the skilled artisan would consider predictive of the function of binding the antigen of an antibody includes six CDRs (three from the heavy chain variable region and three from the light chain variable region) in the context of framework sequences which maintain their correct spatial orientation and have the requisite binding function. One of skill in the art would neither expect nor predict the appropriate functioning of the antibodies produced according to the claimed methods as broadly as is claimed.
In view of the lack of the predictability of the art to which the invention pertains as evidenced by Paul, the lack of guidance and direction provided by applicant, and the absence of working examples, undue experimentation would be required to practice the method for producing functional antibodies comprising fewer than all six CDRs with a reasonable expectation of success, absent a specific and detailed description in applicant’s specification of how to effectively practice this and absent working examples providing evidence which is reasonably predictive that the claimed antibodies are functional, commensurate in scope with the claimed invention.
Moreover, claims not containing elements critical or essential to the practice of the invention, such as antibodies or antibody fragments not having all of the relevant functional complementarity determining regions (CDRs) in the proper site on an appropriate antibody heavy or light chain framework, are not enabled by the disclosure. See In re Mayhew, 527 F.2d 1229, 188 USPQ 356 (CCPA 1976).
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 11 and 15 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Wei, et al. Exome sequencing identifies GRIN2A as frequently mutated in melanoma. Nature Genetics (2011), 43:5, p.442-449 and Supplementary Material p.1-22, herein referred to as Wei.
Wei teaches a method of whole exome sequencing of the GRIN2A from DNA from human subjects (title; p.442, col.1, para.2; p.445, col.1, para.2; Figure 3), which necessarily includes the C-terminal region encoded by applicant’s recited SEQ ID NO: 1. Wei further teaches primer sequence probes that enable detection of genetic regions along the genome and teaches sequencing of the entire GRIN2A exome (Supplementary Table 8). As the kit of instant claim 15 comprises a means to determine in a genomic nucleic acid sample of a subject the sequence of the GRIN2A gene region of applicant’s recited SEQ ID NO: 1, Wei also teaches instant claim 15.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claim 12 is rejected under 35 U.S.C. 103 as being unpatentable over Martel, et al. The subtype of GluN2 C-terminal domain determines the response to excitotoxic insults. Neuron (2012), 74, p.543-556 (herein referred to as Martel); further in view of Strehlow, et al. GRIN2A-related disorders: genotype and functional consequence predict phenotype. Brain (2019), 142, p.80-92 (herein referred to as Strehlow); and in further view of Wei.
Martel teaches that elevated levels of glutamate results in excitotoxicity due to inappropriate activity of NMDAR (NMDA receptor)-mediated calcium influx (abstract; p543, col.1, para.1). Martel teaches that calcium influx is differentially controlled by the cytoplasmic C-terminal domains (CTDs) of GluN2B and GluN2A; and that GluN2B and GluN2A have large evolutionarily divergent cytoplasmic CTDs which have the potential to differentially associate with signaling molecules and differentially influence calcium-mediated toxicity (p.543, col.2, para.2). Martel also teaches that GluN2A and GluN2B have different spatiotemporal profiles where GluN2B is the predominant form in younger neurons (p.543, col.2, para.3); and, that GluN2B- and GluN2A-containing NMDARs are enriched at extrasynaptic and synaptic regions of neurons, respectively (p.545, col.1, para.1). Martel compared wild type animals to knock-in animals expressing chimeric GluN2A/2B subunits wherein the CTDs for GluN2A and GluN2B were exchanged to test the effects of the CTDs on neurotoxicity: GluN2B2A(CTR) = GluN2B, where the CTD is replaced with the CTD of GluN2A (CTD of GluN2A is amino acids 825-1463); and, GluN2A2B(CTR) = GluN2A, where the CTD is replaced with the CTD of GluN2B (CTD of GluN2B is amino acids 826-1482)(p.545, col.1, para.3). Martel additionally teaches transfection of neurons using Lipofectamine 2000 (p.554, col.1, para.4). Martel teaches that the GluN2B CTD determines excitotoxicity (see reference in entirety, but especially Figures 1-5). Instant SEQ ID NOs: 1 and 7 encode for amino acid positions 861-878 of GluN2A and amino acid positions 862-879 of GluN2B respectively, as evidenced by UP-NMDE1 (p.12) and UP-NMDE2 (p.13), respectively. Martel compares neurotoxicity of these variants with canonical wild type GluN2A/GluN2B genes and shows that species harboring the CTD of GluN2B exhibit increased toxicity compared to the canonical wild type that exhibits regular susceptibility to NMDA receptor mediated toxicity (p.545, col.2, para.3; Fig.1).
Martel does not explicitly teach using the primers to sequence the CTD region of GluN2A or GluN2B genes for the purpose of assessing susceptibility to NMDA receptor cytotoxicity as the genomic sequences of Martel are known; rather, the primer sequences were used to validate CTD exchange. Martel also does not explicitly identify which exons encode the Grin2A gene for the GluN2A protein.
Strehlow teaches geneotype differences and functional consequences of genetic variants encoding NMDAR subunits that result in neurological disease (title; p.81, col.2, para.2). Strehlow also teaches that exons 13 and 14 encode the CTD domain of Grin2A gene/GluN2A protein (p.84, Fig.1).
As described above for claims 11 and 15, Wei whole genome sequencing of the entire GRIN2A exome (Supplementary Table 8); thus, Wei necessarily teaches sequencing methods that capture exons 13 and 14 of the Grin2A CTD domain.
It would have been prima facie obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Martel with the teachings of Wei and Strehlow by using exome sequencing methods (taught by Wei) to sequence exons 13 and 14 of the Grin2A gene/GluN2A protein (taught by Strehlow) in order to determine the identity of NMDA receptors comprising a canonical GluN2A CTD sequence (i.e., a sequence that comprises the gene region encoded by canonical wild type sequence of instant SEQ ID NO: 1). One would be motivated to do so because Martel teaches that the GluN2B CTD imparts higher susceptibility to NMDA mediated neurotoxicity than the GlunN2A CTD that exhibits “regular” toxicity. One of ordinary skill would have a reasonable expectation of success because Strehlow teaches that exons 13 and 14 encode the CTD.
Claim 14 is rejected under 35 U.S.C. 103 as being unpatentable over Siebenmorgen and Zacharias. Computational prediction of protein-protein binding affinities. WIREs Computational Molecular Science (2019), 10:3, p.1-18 (herein referred to as Siebenmorgen); further in view of Hardingham. NMDA recteptor C-terminal signaling in development, plasticity, and disease. F1000Research (2019), p:1547, p.1-10 (herein referred to as Hardingham); and further in view of Martel.
Siebenmorgen teaches computational prediction of protein-protein binding affinities (title); and that it is possible to generate structural models of many putative protein-protein complexes or to design new protein-protein interactions using docking approaches or template-based methods (abstract). Siebenmorgen teaches that the structure of a growing number of protein-protein complexes has been solved recently (abstract); and that several computational tools are available to predict relative and absolute binding affinities of complexes (abstract). Siebenmorgen further teaches that the associated binding free energy of protein-protein interactions determines the stability of association and the conditions for complex formation (p.1, para.1). Additionally, Siebenmorgen teaches computational prediction of protein-protein binding affinity requires a 3D structure of the protein-protein complex which can be generated using computational methods (p.3, para.4). Siebenmorgen teaches computational protein-protein docking for proteins and “scoring” for identifying likely geometries and for estimating relative binding affinities (p.3, Fig.2). Siebenmorgen further teaches docking programs including HADDOCK, ATTRACT, and RosettaDock approaches for docking as well as refinement and re-scoring as part of the process (p.4, para.4).
Siebenmorgen does not teach identification of compounds specifically interacting with the CTD of GluN2A or GluN2B (i.e., the region comprising amino acid sequence according to SEQ ID NOs: 1 and 7).
Hardingham teaches the role of NMDA receptor (NMDAR) CTDs in neuronal synaptic plasticity and neurological disease; and, teaches that the NMDAR is not merely a conduit for ions to flow through but is linked to a large network of signaling and scaffolding proteins, primarily through the CTD of NMDAR GluN2 subunits that help to organize the signaling cascades downstream of NMDAR activation (abstract). Hardingham teaches GluN2A-D subtypes influence the biophysical properties of the channel, including agonist affinity, open probability, and deactivation kinetics that influence NMDAR-evoked currents and downstream signaling (abstract; p3, col1, para.1). Hardinham also teaches that a growing number of studies have illuminated the extent to which GluN2 CTD interactions vary according to GluN2 subtype and how this impacts NMDAR-mediated processes (abstract). Hardingham teaches that the CTDs of NMDAR subunits are linked to a signaling complex; and that the GluN2A and GluN2B CTDs are very large in vertebrate animals (p.3, col.1, para.2). Hardingham further teaches that CTD-associated proteins influence downstream NMDAR activation and differential association with different NMDAR subunits contributes to the functional diversity of NMDAR signaling; and that the overwhelming majority of studies are focused on protein interactions with the CTDs of GluN2A and GluN2B as compared to GluN2C and GluN2D (p.3, col.1, para.2).
Martel teaches that the GluN2A and GluN2B CTDs have differential effects of neuronal NMDAR-mediated toxicity as described in detail above for claim 12. Martel also teaches that the GluN2 CTD is the primary area of sequence divergence and is known to bind intracellular signaling/scaffolding proteins (p.545, col.1, para.2). Thus, Martel attributes the differences in neurotoxic effects to the CTD.
It would have been prima facie obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Siebenmorgen with the teachings of Hardingham and Martel by modifying the method of using computational virtual docking (taught by Siebenmorgen) to determine the docking score and to identify compounds that interact with a protein (also taught by Siebenmorgen), to determine compounds that interact with the CTD region (taught by Hardingham and Martel) of GluN2A or GluN2B protein (also taught by Hardingham and Martel). One would be motivated to do so because Hardingham teaches that NMDAR subunits are involved in synaptic plasticity and neurological disease and that GluN2A and GluN2B CTD protein interactions are a major area of interest. One of ordinary skill would have a reasonable expectation of success because Hardingham teaches GluN2 CTD interactions vary according to GluN2 subtype and Martel teaches that the CTD region of GluN2A vs GluN2B has differential effects on neurotoxicity.
Claim 16 is rejected under 35 U.S.C. 103 as being unpatentable over Rohn, et al. The potential of CRISPR/Cas9 gene editing as a treatment strategy for Alzheimer’s Disease. J. Alzheimers Dis. Parkinsonism (2018), 8:3, p.1-12 (herein referred to as Rohn); further in view of Hardingham; and further in view of Martel.
Rohn teaches the CRISPR/Cas9 method for gene replacement in Alzheimer’s Disease and Huntington Disease and suggests that this system of targeting, editing, modifying, and regulating genes could be used to treat other neurodegenerative disorders (title; abstract, p.3, paras.1-2). Rohn teaches the steps for CRISPR/Cas9 DNA replacement, including 1) creating guide RNA, 2) combining the guide RNA with the enzyme Cas9, and combining the guide RNA and Cas9 with the appropriate cell containing genomic DNA (i.e., providing the guide RNA and Cas9 to a cell for gene replacement; p.3, para.1; p.10, Fig.1). Rohn further suggests the use of viral vectors such as adeno-associated virus (AAV) for CRISPR/Cas9 in CNS cells (p.6, para.2).
Rohn does not specifically teach replacement of a GRIN2A or GRIN2B genomic sequence linked with higher NMDAR mediated toxicity with a GRIN2A and/or GRIN2B sequence linked with lower susceptibility toward NMDAR mediated toxicity to provide more resistance.
Hardingham teaches differential roles of GluN2 CTDs in synaptic plasticity, interactions with signaling/scaffolding proteins, and NMDAR neurotoxicity as described in detail above for claims 12 and 14.
Martel specifically teaches that GluN2A CTD is more resistant toward NMDAR toxicity than the GluN2B CTD, and that the GluN2A CTD can be used to replace the GluN2B CTD in order to provide for less toxicity in neurons, as described in detail above for claims 12 and 14.
It would have been prima facie obvious for one of ordinary skill in the art before the effective filing date of the claimed invention combine the teachings of Rohn with the teachings of Hardingham and Martel by using the CRISPR/Cas9 system (as taught by Rohn) for replacement of a GRIN2B (GluN2B) CTD that exhibits high neurotoxicity (as taught by Martel) for a GRIN2A (GluN2A) CTD that exhibits resistance toward NMDAR neurotoxicity (also taught by Martel). One would be motivated to do so because Hardingham and Martel teach that the CTD mediates NMDAR signaling and Martel teaches that GluN2A/GRIN2A CTD exhibits resistance toward toxicity compared to GluN2B/GRIN2B CTD. One of ordinary skill would have a reasonable expectation of success because Rohn teaches that CRISPR/Cas9 genes can be introduced to CNS cells using AAVs.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Jami M Gurley whose telephone number is (571)272-0117. The examiner can normally be reached Monday - Friday, 8am - 4pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Joanne Hama can be reached at 571-272-2911. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JAMI MICHELLE GURLEY/Examiner, Art Unit 1647
/JOANNE HAMA/Supervisory Patent Examiner, Art Unit 1647