Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 04/28/2026 has been entered.
Claim Status
Claims 30-33, 35-38, 40-41, and 43-44 are pending and being examined.
All previous objections and rejections not set forth below have been withdrawn in view of applicant’s amendments to the claims.
Claim Rejections - 35 USC § 102(a)(1)
Claims 30, 32, 35, 37, and 43-44 remain rejected under 35 U.S.C. 102(a)(1) as being anticipated by Gao et al. (WO 2018/071362 A1).
Amended claim 30, adding a new issue which was not present before, recites, “…wherein the one or more modified target sites are not transgenic and comprise only native corn plant polynucleotide sequence”.
Gao et al. teaches a corn plant comprising modified genomic loci (page 2, line 17-24; page 4, line 5-8) by moving or translocating disease resistant alleles including Ht1 and NLB18 to another site in the genome of the same plant (p. 2, line 20-24), thus target site(s) are not transgenic. The loci (reads on to “target site”) comprise(s) one or more modified target site(s) within the genome of the same plant (thus, does not qualify as transgenic and comprise only native corn polypeptide) comprise an endogenous polynucleotide sequence encoding Ht1 (page 2, line 28-29) and another endogenous polynucleotide sequence encoding the NLB18 (page 4, line 5-8) polypeptides. One of the NLB18 polypeptides comprising SEQ ID NO: 64 (p. 4, line 27-34) is having 100% identity to the full-length sequence of the instant SEQ ID NO: 3 (data not shown), as recited in claim 32.
The endogenous or native polynucleotide sequence encoding the Ht1 polypeptide would read on to the “first native polypeptide” while the other endogenous or native polynucleotide sequence encoding the NLB18 polypeptide would read on to the “second native polypeptide”. Both are endogenous corn polynucleotide sequences, thus non-transgenic, while encoding the native Ht1 and NBL18 polypeptides are merely translocated to a different locus in the same corn genome. Both sequences confer enhanced disease resistance against the fungal pathogen causing northern leaf blight disease (page 1, abstract; page 2, line 3-6; page 4, line 20-24).
Gao et al. also teaches methods to introduce resistant alleles of Ht1 and NLB18 to another distal site, Complex Trait Locus (CTL) 1, (Example 4, page 59, last 4 lines; page 60, line 1-6) in the same corn genome (page 1, abstract, line 4-6; page 2, line 20-22), wherein the two polynucleotide sequences encoding Ht1 and NLB18 alleles would be heterologous to the modified genomic locus, which is also non-transgenic.
Regarding claim 35, Gao et al. describes relocating disease resistant genes (NLB18-PH26N, Ht-PH4GP, and NLB18-PH26N) to a distal and modified site in chromosome 1 (page 60, line 3-6) in a corn plant, where the polynucleotide sequences would be heterologous to the corresponding genomic locus (but not heterologous to the corn plant/genome itself).
Regarding claims 37, Gao et al. teaches a method breeding northern leaf blight resistance maize lines (Summary at page 2, line 16-24) by introducing resistant genes conferring disease resistant traits at a single locus (example 4 at page 59-63) through homologous recombination (page 62, line 8-11) via traditional breeding. Gao et al. teaches introgressing a single genomic locus comprising multiple resistance genes/loci into elite maize lines (page 2, line 9-10 and line 17-24) through backcrossing (page 46, line 6-11).
Regarding claims 43-44, Gao et al. teaches introgressing a single genomic locus comprising multiple resistance genes/loci into the genetic background of elite maize lines (page 2, line 9-10 and line 17-24) through backcrossing (page 46, line 6-11) and minimizing linkage drag from non-elite resistant donor lines (page 46, line 6-11).
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claim 31 is rejected under 35 U.S.C. 103 as being unpatentable over Gao et al.
as applied to claim 30 above, and further in view of Hu et al. (Evolved Cas9 variants with broad PAM compatibility and high DNA specificity, 2018, Nature, 556: 57–63) and GenBank Accession No. AC217378 (published in 2014).
Claim 31 depends on claim 30 and is drawn to the one or more modified target sites comprising at least one of SEQ ID NOs: 12-21. The Applicant describes, a ““genomic region” (also referred to as “genomic locus”) refers to a segment of a chromosome in the genome of a cell. In one embodiment, a genomic region includes a segment of a chromosome in the genome of a cell that is present on either side of the target site or, alternatively, also comprises a portion of the target site” (p. 20, line 11-14). The Applicant defines the term “target site” to “refer to a polynucleotide sequence including, but not limited to, a nucleotide sequence within a chromosome, an episome, or any other DNA molecule in the genome (including chromosomal, choloroplastic, mitochondrial DNA, plasmid DNA) of a cell, at which a guide polynucleotide/Cas endonuclease complex can recognize, bind to, and optionally nick or cleave” (p. 30, line 6-12). Any specific genomic locus including the DSL1 region needs to be identified by scanning potential target sites using a bioinformatics tool searching for protospacer adjacent motifs (PAM) and retrieving the upstream 20-base sequences (p. 46, line 27-28). The Applicant describes that the “target sites were deemed unsuitable if less than 2.5 kb away from any native gene annotation (p. 46, line 31-32).
Gao et al. describes a method to overcome the limitations of conventional breeding for introgressing northern leaf blight resistance into maize lines by editing to move/relocate (within the same genome but to a different locus) the genes that confer enhanced resistance to northern leaf blight to another site in the genome such that enhanced resistance to northern leaf blight can be obtained by introgressing a single genomic locus comprising multiple nucleotide sequences, each conferring enhanced resistance to northern leaf blight, into maize plants (p.2, line 17-24). Genome editing to introduce a specific polynucleotide sequence at a specific target sequence using CRISPR-Cas technique is known in the art.
An ordinarily skilled artisan would have scanned (using publicly available sequence analysis software) any of the published corn genomic sequences (available for several corn cultivars including B73) to identify potential target sites with suitable PAM site(s) for a known Cas endonuclease (e.g., Cas9 which typically recognizes NGG PAM site (Hu et al.; abstract, line 3; p.2 para 1, line 9-1) but also known to recognize other PAM sites like NNG, GAA, GAT, CAA (Hu et al.; p.4, para 2, line 7-11).
One such target sites in chromosome 1 in corn cultivar B73 (GenBank Accession No. AC217378, published in 2014) is having 100% sequence identity to instant SEQ ID NO: 20, as described below.
RESULT 1
LOCUS AC217378 171085 bp DNA linear HTG 13-SEP-2014
DEFINITION Zea mays cultivar B73 chromosome 1 clone ZMMBBb-290A24,
SEQUENCING IN PROGRESS ***, 9 unordered pieces.
ACCESSION AC217378
VERSION AC217378.4
KEYWORDS HTG; HTGS_PHASE1; HTGS_IMPROVED; HTGS_LIMITED_ORDER.
SOURCE Zea mays
ORGANISM Zea mays
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; PACMAD
clade; Panicoideae; Andropogonodae; Andropogoneae; Tripsacinae;
Zea.
REFERENCE 1 (bases 1 to 171085)
CONSRTM Maize Genome Consortium
TITLE Maize genome
JOURNAL Unpublished
REFERENCE 2 (bases 1 to 171085)
AUTHORS Wilson,R.K.
TITLE Direct Submission
JOURNAL Submitted (08-FEB-2008) Genome Sequencing Center, Washington
University School of Medicine, 4444 Forest Park Parkway, St. Louis,
MO 63108, USA
REFERENCE 3 (bases 1 to 171085)
CONSRTM Maize Genome Consortium
TITLE Direct Submission
JOURNAL Submitted (13-SEP-2014) NCBI, NIH, Center Drive, Bethesda, MD
20857, USA
FEATURES Location/Qualifiers
source 1..171085
/organism="Zea mays"
/mol_type="genomic DNA"
/cultivar="B73"
/db_xref="taxon:4577"
/chromosome="1"
/clone="ZMMBBb-290A24"
Query Match 100.0%; Score 23; Length 171085; Best Local Similarity 100.0%;
Matches 23; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GACGGGGACTTAATTATGCGTGG 23
|||||||||||||||||||||||
Db 108197 GACGGGGACTTAATTATGCGTGG 108175
The genomic sequence of GenBank Accession No. AC217378 does not comprise any polynucleotide encoding any known or currently annotated gene within 2.5 kb (data not shown), absent evidence to the contrary. Criticality, if any, of any of the specific target sequences (SEQ ID NOs: 12-21) recited in claim 31 has not been articulated by the Applicant (See MPEP ¶ 2144).
It would have been an experimental design choice of an ordinarily skilled artisan to use any specific target site including the one described above that satisfy the criteria for target site selection, as discussed above.
Claim 33 is rejected under 35 U.S.C. 103 as being unpatentable over Gao et al. in view of Hu et al. and GenBank Accession No. AC217378 as applied to claim 31 above, and further in view of Jaqueth et al. (WO 2019/182884 A1).
Claim 33 depends from claim 31 which, in turn, depends from claim 30. Claim 33 recites a polypeptide comprising a sequence selected from the group consisting of PRR03 (SEQ ID NO: 36), PRRO1 (SEQ ID NO: 38), NLRO1 (SEQ ID NO: 41), and NLR04 (SEQ ID NO: 44).
Gao et al. describes a corn plant comprising a modified genomic locus, the locus comprising one or more modified target sites, wherein the one or more modified target sites comprise two polynucleotide sequences conferring enhanced disease resistance to northern leaf blight in corn, wherein the polynucleotide sequences are heterologous to the modified genomic locus, as described above.
However, Gao et al. does not describe PRR03 (SEQ ID No: 36), PRRO1 (SEQ ID No: 38), NLRO1 (SEQ ID No: 41), and NLR04 (SEQ ID No: 44).
Jaqueth et al. describes a corn disease (southern corn rust) resistance gene NLR01 comprising 100% sequence identity to instant SEQ ID NO: 41 (data not shown).
Before the effective filing date, it would have been obvious to an ordinarily skilled artisan to introduce (via traditional breeding or introgression) the nucleotide sequence encoding the native (corn) NLR01 disease resistance polypeptide, as described by Jaqueth et al., into a modified genomic locus (Complex Trait Locus, CTL) comprising multiple resistance genes/loci, as described by Gao et al., with a realistic goal to broaden disease resistance spectrum of the corn plant. A different target site, as described by Gao et al. (page 60, line 1-6), to introduce the nucleotide sequence encoding the native (corn) NLR01 disease resistance polypeptide (SEQ ID NO: 41), would be a functional equivalent of the target sites listed in claim 33, and would not realistically change the outcome of the disease resistance trait of the NLR01 (SEQ ID NO: 41) polypeptide.
Before the effective filing date of the invention, an ordinarily skilled artisan would have been motivated to introduce the nucleotide sequence encoding the native (corn) NLR01 (SEQ ID NO: 41) disease resistance polypeptide into the modified genomic locus comprising multiple disease resistance genes to broaden the disease resistance spectrum of the corn plant.
Claims 38 and 40 remain rejected under 35 U.S.C. 103 as being unpatentable over Gao et al. as applied to claims 30, 32, 35, 37, 43-44 under 35 U.S.C. 102(a)(1) above, and further in view of Agapito-Tenfen et al. (Effect of stacking insecticidal cry and herbicide tolerance epsps transgenes on transgenic maize proteome, 2014, BMC Plant Biol., 14:346).
Claim 38 indirectly depends from claim 30, and is drawn to a method of breeding plants comprising a locus comprising at least one heterologous polynucleotide sequence encoding an insecticidal or herbicide resistance polypeptide.
Gao et al. describes a corn plant comprising a modified genomic locus, the locus comprising one or more modified target sites, wherein the one or more modified target sites comprise two polynucleotide sequences conferring enhanced disease resistance to northern leaf blight in corn, wherein the polynucleotide sequences are heterologous to the modified genomic locus, as discussed above.
However, Gao et al. does not describe to any plant comprising a locus containing at least one heterologous polynucleotide sequence encoding an insecticidal or a herbicide resistance polypeptide.
Agapito-Tenfen et al. describes corn plants containing nucleotide sequences encoding insecticidal and herbicide tolerance (or resistance) polypeptides clustered together (page 1, abstract). The Applicant describes the terms "tolerance" and "resistance" to be used interchangeably (Spec, page 18, line 18-19).
Before the effective filing date, it would have been obvious to an ordinarily skilled artisan to introduce the nucleotide sequences encoding insecticidal and herbicide tolerance/resistance polypeptides, as described by Agapito-Tenfen et al., into the same plant already containing multiple disease resistance genes, as described by Gao et al., with the realistic goal to incorporate more agronomically beneficial traits in the same corn plant, which is a commercially important crop.
Before the effective filing date of the invention, an ordinarily skilled artisan would have been motivated to introduce the nucleotide sequences encoding insecticidal and herbicide tolerance/resistance polypeptides in the same plant with the realistic goal to incorporate more agronomically beneficial traits in the same corn plant which already contains more than one gene conferring resistance against a plant disease.
Regarding claim 40, Gao et al. describes a method to introduce resistant genes at a single locus (CTL1) through homologous recombination (page 60, line 1-6; page 62, line 8-11). The nucleotide sequences encoding insecticidal and herbicide tolerance/resistance polypeptides, as described by Agapito-Tenfen et al., would have been introgressed into the same single genomic locus (CTL1) already having multiple disease resistance genes in the corn plant, as described by Gao et al., to broaden the number agronomically beneficial traits located to a single locus in a chromosome. That would help breeding future corn varieties more efficiently and would reduce linkage drag associated with introgression, as described by Gao et al. (page 2, line 9-14). The nucleotide sequences encoding insecticidal and herbicide tolerance/resistance polypeptides would read on to “a third heterologous polynucleotide”.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 30-33, 35-38, 40-41 and 43-44 remain provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 9, 16, 30, 32-33, 35-38, 40-44 of copending Application No. US 17/404,109 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because claim limitations for instant claims 30-33, 35-38, 40-41, 43-44 would read on the claims 16, 30, 32-33, 35-38, 40-41 of the reference application, as described below.
Reference claim 9 recites a method of generating a disease super locus in an elite crop plant genome to increase trait introgression efficiency in the elite crop plant, the method comprising introducing a plurality of disease resistance traits at a predetermined genomic locus of the crop plant chromosome by engineering (a) insertion of two or more disease resistant genes, (b) genomic translocation of one or more disease resistant genes through targeted chromosomal engineering, (c) duplication of one or more disease resistant genes at the genomic locus by targeted genome modification, (d) modifying the genomic locus by introducing one or more insertions, (e) deletions or substitutions of nucleotides in the genome, or a combination of the foregoing.
The method of reference claim 9 inherently anticipates instant claim 30, as it produces the plant of instant claim 30. The two or more disease resistant genes recited in the reference claim 9 would include disease resistant genes from the same plant species and, thus, would satisfy all the claim limitations of instant claim 30. Reference claim 15 also would satisfy all the claim limitations of instant claim 30.
Reference claim 16 is dependent from reference claim 15, and is a drawn to introducing a site-specific modification at least one target site in a genomic locus in a plant cell; wherein the at least one target site comprises a target site selected from Table 2 comprising SEQ ID NO: 12, SEQ ID NO:13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, and SEQ ID NO: 21. Reference SEQ ID NO: 21 is 100% identical to instant SEQ ID NO: 21 of instant claim 31 (data not shown).
Reference claims 20 and 32 are drawn to polypeptide sequences having a sequence selected from the group consisting of SEQ ID NO: 11(RppK), SEQ ID NO: 8 (Ht1), (SEQ ID NOs: 3 or 5 (NLB18), SEQ ID No: 29 (NLR01), SEQ ID No: 26 (NLRO2), SEQ ID Nos: 31 (RCG1), and SEQ ID Nos: 33 (RCG1b). The SEQ ID NO: 3 in the reference claims 20 and 32 has 100% identity to SEQ ID NO: 3 in the instant claim 32 (data not shown).
Reference claims 21 and 33 are drawn to a polypeptide comprising a sequence selected from the group consisting of SEQ ID No: 36 (PRRO3), SEQ ID No: 38 (PRR01), SEQ ID No: 41 NLR01), or SEQ ID No: 44 (NLRO4). The SEQ ID NO: 38 in the reference claims 21 and 33 has 100% identity to SEQ ID NO: 38 in the instant claim 33 (data not shown).
Reference claim 35 is drawn to a method for obtaining a plant cell with an modified genomic locus comprising at least two polynucleotide sequences that confer enhanced disease resistance to at least one plant disease, or at least two traits resulting in resistance to at least one disease through two different modes of action, wherein said at least two polynucleotide sequences are heterologous to the corresponding genomic locus, wherein the genomic locus is located in the distal region of chromosome 1. The method of the reference claim 35 would produce a plant that would satisfy all the claim limitations of instant claim 35.
Reference claims 16 and 36 would anticipate instant claim 36. Reference claim 16 are drawn to the at least one target site comprises a target site selected from any one of SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, or SEQ ID NO: 21. Reference claim 36 depends from reference claim 35, and recites, “… wherein the genomic locus is located in the telomeric region.” Instant SEQ ID NO: 21 is one of the target sites in the genomic locus (CTL1), as described above, and it is in the telomeric region. The product (a plant) produced using the method of reference claim 36 would satisfy all the claim limitations of instant claim 36.
Reference claim 37 is drawn to a method of breeding transgenic and native disease traits at a single locus in a plant comprising: a. inserting at a single locus in a plant a first heterologous polynucleotide sequence that confers enhanced disease resistance to a first plant disease, and second heterologous polynucleotide sequence that confers enhanced disease resistance to the first plant disease or to a second plant disease; b. inserting at least one heterologous polynucleotide sequence encoding an insecticidal polypeptide, agronomic trait polypeptide, or a herbicide resistance polypeptide at the single locus; c. crossing the plant with the single locus with a different plant; and d. obtaining a progeny plant comprising the single locus; and wherein the single locus allows for fewer backcrosses compared to a plant with traits at more than one locus. Reference claim 37 would satisfy all the claim limitations of instant claim 37.
Reference claim 38 depends from reference claim 37, and is drawn to a method wherein different plant comprising a second locus comprising at least one heterologous polynucleotide sequence encoding an insecticidal or herbicide resistance polypeptide. The reference claim 38 would anticipate instant claim 38.
Reference claim 40 is drawn to a modified plant comprising a first heterologous polynucleotide encoding a first polypeptide that confers enhanced disease resistance to a first plant disease, and a second heterologous polynucleotide encoding a second polypeptide that confers enhanced disease resistance to a second plant disease; and a third heterologous polynucleotide encoding an insecticidal polypeptide or a herbicide resistance polypeptide; wherein the first heterologous polynucleotide, second heterologous polynucleotide, and third heterologous polynucleotide are located at a single locus in a plant. The reference claim 40 would satisfy all the claim limitations of instant claim 40.
Reference claim 41 is drawn to a single locus comprising about 1cM, 5cM, or 10cM. The reference claim 41 would anticipate instant claim 41.
Reference claim 43 is drawn to a method of introgressing or forward breeding multiple disease resistance loci into an elite germplasm, wherein the timeframe for inserting two or more heterologous polynucleotides from different donor plants into the elite line and developing the homozygous resistant lines is shorter. Instant claim 43 would have been obvious to an ordinarily skilled artisan considering reference claim 43 because introgressing or forward breeding would produce progeny plants having the modified genomic locus in the genetic background of the elite line.
Reference claim 44 depends from reference claim 43, and is drawn to improving agronomic traits with multiple disease resistance with reduced yield drag from breeding. The reference claim 44 would make instant claim 44 obvious.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Claims 30, 40-41 and 43-44 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-2, 6-8 and 20-21 of copending Application No. US 18/840,335 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other.
Reference claim 1 is drawn to a method of generating a heterologous genomic locus in a transgenic plant or cell thereof, the method comprising, inter alia, introducing two or more intraspecies polynucleotide sequences to a predetermined locus thereby creating a heterologous genomic locus in the plant or cell thereof, wherein the introducing step does not result in integration of another transgene or a foreign polynucleotide that is not native to the plant or cell thereof and the intraspecies polynucleotides confer one or more agronomic characteristics to the plant or cell thereof. The plant in the reference claim 1 includes corn and, even tough the plant is a transgenic plant, the said method does not comprise introducing any transgene of a foreign polynucleotide that is not native to the plant. The “one or more agronomic characteristics” as recited in reference claim 1 would include disease resistance as well. Thus, the product of the said process as recited in reference claim 1 would anticipate the plant (the product of the process) of instant claim 30.
Reference claim 2 depends from reference claim 1. Claim 1 recites, “… the plant or cell thereof further comprises a first genomic locus which confers a transgenic trait, and the heterelogous genomic locus is on the same chromosome arm as the transgenic genomic locus” (last 3 lines). Reference claim 2 recites “…. the first transgenic locus comprises an insect control transgene, an herbicide tolerance transgene or transgenes conferring both insect control and herbicide tolerance traits”. The “first transgenic locus” has been present in the plant and not introduced by the method of reference claim 1, as discussed above. Thus, the product of the method of reference claim 2 would anticipate the product, a plant, which includes a corn plant, that would satisfy all the limitations of instant claim 40.
Reference claims 6, 7 and 8 recite “… the heterologous genomic locus is located within 10 cM, 5 cM and 1 cM (respectively) of the first genomic locus conferring the transgenic trait”. The product (a plant including a corn plant) produced by the methods of reference claims 6-8 would satisfy all the claim limitations of instant claim 41 and, thus, would anticipate instant claim 41.
Reference claims 20-21 would anticipate instant claims 43-44. The product (a plant including a corn plant) produced by the methods of reference claims 20-21 would satisfy all the claim limitations of instant claim 43-44.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Response to Applicants’ arguments
The argument set forth in the Applicant’s response on 04/28/2026 has been fully considered but is not found persuasive.
All the arguments against the anticipation, obviousness, and double patenting rejections boil down to, “… the target site(s) in Gao are transgenic and therefore contain polynucleotide sequences that are not native to corn” (response, page 6, para 1, line 5-7), specifically in reference to “the CTL1 site of Gao and Cigan (… WO2016040030)” (p.6, para 1, line 7-8). The Applicant continues to argue, “nowhere does Gao expressly or inherently disclose the limitation "wherein the one or more modified target sites are not transgenic and comprise only native corn plant polynucleotide sequence." (p. 6, para 3, line 1-3).
The Examiner respectfully disagrees. Gao et al. describes a corn plant comprising modified genomic loci (page 2, line 17-24; page 4, line 5-8) by moving or translocating disease resistant alleles including Ht1 and NLB18 to another genomic location in the genome of the same corn plant (p. 2, line 20-24). The target site(s) comprise(s) one or more modified site(s) within the genome of the same plant (thus, does not qualify as transgenic and comprise only native corn polypeptide) comprise an endogenous or native polynucleotide sequence encoding Ht1 (page 2, line 28-29) and another endogenous or native polynucleotide sequence encoding the NLB18 (page 4, line 5-8) polypeptides. Thus, neither the target site(s) nor the polynucleotide sequences encoding the disease resistance alleles are transgenic.
Gao et al. describes the target site in chromosome 1 as being identified and developed to become Complex Trait Locus (CTL) 1, citing the reference of Cigan et al., WO2016040030) (p.60, line 1-3). Cigan et al. describes, in Example 2, “the first maize genomic window that was identified for development of a Complex Trait Locus (CTL) spans from ZM01: 12987435 (flanked by public SNP marker SYN12545) to Zm01 :15512479 (flanked by public SNP marker SYN20196) on chromosome 1” (p.133, para 3, line 1-4) and precisely identified the ”Genomic Window comprising a Complex Trait Locus (CTL 1) on Chromosome 1 of maize” (p. 133, Table 1) in terms of the flanking SNP markers (which are native genomic sequences). There is no mention of any insertion of any transgene in the CTL1 locus. The Examiner interprets that the CTL1 locus described by Gao et al. refers to the CTL1 locus described by Cigan, as above. Example 14 of Cigan discusses introducing “multiple transgenic SSI sites into the each of said genomic windows” (i.e., CTLs including CTL1) (Example 14, p.176, para 6, line 1-2). However, Example 2 and Table 1 describes the CTL1 locus, which does not comprise the SSI sites.
Regarding Double Patenting Rejection based of the reference claims in US 17/404,109, the Applicant argues, “the claims are not obvious over the reference application for at least the reasons discussed herein” (response, p.7, last para, last 2 lines).
Applicant’s argument is not understood as the rejection does not include the references cited in the prior art rejections.
Conclusion
No claim is allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Communication
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JAY CHATTERJEE whose telephone number is (703)756-1329. The examiner can normally be reached (Mon - Fri) 8.30 am to 5.30 pm..
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at (571) 270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
Jay Chatterjee
Patent Examiner
Art Unit 1662
/Jay Chatterjee/Examiner, Art Unit 1662
/BRATISLAV STANKOVIC/Supervisory Patent Examiner, Art Units 1661 & 1662
Prosecution Insights