DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
This action is written in response to applicant’s correspondence received on 1/31/2024. Claims 44-57 and 86-89 are pending. Claim 44 has been amended. Claims 1-43 and 58-85 have been previously cancelled. All pending claims are currently under examination.
Drawings
The drawings are objected to because the figures are not properly labeled.
37 CFR 1.84 (u)(1) states “The different views must be numbered in consecutive Arabic numerals, starting with 1, independent of the numbering of the sheets and, if possible, in the order in which they appear on the drawing sheet(s). Partial views intended to form one complete view, on one or several sheets, must be identified by the same number followed by a capital letter. View numbers must be preceded by the abbreviation "FIG." Where only a single view is used in an application to illustrate the claimed invention, it must not be numbered and the abbreviation "FIG." must not appear.”
The drawings are objected to because Figures 3, 4, 7, 10, 11, and 12, are improperly labeled. These figures contain partial views on separate sheets. For example, Figure 3 spans two separate sheets and is labeled “Fig. 3” and “Fig. 3 (cont)” but should be labeled “Fig. 3A” and “Fig. 3B,” etc. The same is true for figures 4, 7, 10 , 11, and 12.
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Nucleotide and/or Amino Acid Sequence Disclosures
REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
the name of the ASCII text file;
the date of creation; and
the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or
In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
Specific deficiencies and the required response to this Office Action are as follows:
Specific deficiency - The Incorporation by Reference paragraph required by 37 CFR 1.821(c)(1) is missing or incomplete. See item 1) a) or 1) b) above.
Required response – Applicant must provide:
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required incorporation-by-reference paragraph, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter.
Claim Interpretation
As an initial matter, the following interpretation of the claims is given. Claim 44 appears to be broadly drawn to a method of providing a plurality of nucleic acids, exposing the nucleic acids to an adaptor which is capable of being ligated to a 3’ end of a strand of DSB, fragmenting the plurality of nucleic acids, and then exposing the nucleic acids to a second adaptor capable of being ligated to the 5’ end of a break induced by fragmentation, where the second adaptor does not bind to the primer immobilized on the substrate and is incapable of being ligated to the first adaptor. However, claim 44 does not recite that any ligation or binding to any primer in fact occurs; the nucleic acids are simply exposed to the two adaptors which can broadly be interpreted to simply be two different adaptors. For instance, conditions which are “conducive to ligation” can simply refer to a condition in which the components could be ligated, i.e., if the components are present in the same reaction, such conditions would be “conducive” to ligation in the sense that the condition would make possible a ligation of the components. Furthermore, claim 44 recites “a sequence that is capable of binding to a primer immobilised to the substrate by hybridization,” in claim 44, step b). Recitation of this phrase, and use of the phrase “capable” and/or “not capable” can be broadly interpreted to not supply structural limitations of the adaptors, as adaptors could be “capable” of binding to a primer in multiple ways through chemical modification, or similarly “not capable” of hybridizations simply by changing the reaction conditions.
Furthermore, while the specification highlights that the technical problem being solved by the present invention is that no PCR step is required during library preparation (e.g., page 3, first paragraph), the claims are open-ended (i.e., the methods recited “comprise” the recited steps), and therefore prior art methods which rely on PCR still read on the recited claims provided that the art teaches methods of DSB identification using fragmentation and the introduction of two adaptors as recited.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 44-57 and 86-89 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding claim 44, claim 44 recites “a method of sample preparation for identifying DNA double-strand breaks (DSBs) in a nucleic acid sample, wherein the preparation comprises modifying DSB-associated nucleic acids to be suitable for binding to a substrate comprising immobilised primers, the method comprising” and recites steps a-d. The claim is confusing because it is unclear if the phrase “wherein the preparation comprises modifying DSB-associated nucleic acids to be suitable for binding to a substrate comprising immobilised primers” is a part of the method steps or simply a part of the preamble, as steps a-d are the only active steps recited which are directed fragmentation and exposure to a adaptors to nucleic acids and not modifying DSB nucleic acids to be suitable for binding to a substrate.
Claims 45-57 and 86-89 depend from claim 44 and do not resolve this 112(b) issue and are therefore also rejected.
Furthermore, regarding claim 89, claim 89 recites “wherein said ligation in step b) occurs in situ or in vitro.” However, no actual ligation is recited in step b), where step b) simply recites that the nucleic acids are exposed to an adaptor in conditions that are “conducive to ligation.” Recitation of “said ligation” in claim 89 therefore lacks proper antecedent basis because a condition that is “conducive to ligation” is not the same as “ligation” itself.
Regarding claim 47, claim 47 recites that “step b) is” and “step d) is.” Claim 47 depends from claim 44, which recites different steps for steps b and d) relative to those claimed in claim 47. It is unclear if the additional b) and d) steps recited in claim 47 are meant to be in addition to the steps b) and d) already performed in independent claim 44. If is recommended that claim 47 be amended to recite language indicating that the steps comprise additional elements as opposed to the present language which appears to change and/or add steps to the method of claim 44. Presently the method of claim 47 is unclear, as it is unclear which steps b) and d) would need to be performed in order to carry out the recited method of claim 47.
Claims 48-49 depend from claim 47 and do not resolve this issue and are therefore also rejected.
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claims 47-49 are rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Regarding claim 47, claim 47 depends from claim 44, where claim 47 recites that:
“Step b) is: exposing the plurality of nucleic acids to a first adaptor pair under conditions conducive to ligation, wherein the first adaptor pair is capable of being ligated to at least a 3' terminus of a strand of a DSB, and wherein the first adaptor pair comprises a first and a second oligonucleotides that are at least partially complementary, wherein the first oligonucleotide of the first adaptor pair is ligatable to the 3' terminus and comprises a sequence that is capable of binding to a primer immobilised to the substrate by hybridisation; and wherein
step d) is: exposing the plurality of nucleic acids to a second adaptor pair under conditions conducive to ligation, wherein the second adaptor pair is capable of being ligated to at least a 5' terminus of a strand at a break induced by fragmentation but is not capable of being ligated to the first oligonucleotide of the first adaptor pair, wherein the second adaptor comprises a first and a second partially complementary oligonucleotides, wherein the first oligonucleotide of the second adaptor pair is ligatable to the 5' terminus and comprises a sequence identical to a region of a second primer, and the second oligonucleotide of the second adaptor pair does not comprise a sequence that is complementary to said sequence identical to the region of the second primer.
Thus, claim 47 recites new steps b) and d) compared with claim 44 because steps b) and d) are changed in claim 47, where the plurality of nucleic acids is recited to be exposed to first and second adaptor “pairs.” Thus, claim 47 does not limit the claim from which it depends (claim 44) because it expands the adaptor molecules recited. Furthermore, as steps b and d are recited with new limitations, the previous steps of b and d recited in claim 44 are longer part of the claim. Claim 47 therefore does not include the limitations of the claim from which it depends (claim 44). Claims 48-49 depend from claim 47 and suffer similar 112(d) issues.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 44-47, 49-57 and 86-89 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Zhang (WO 2017/218979 A1).
Regarding these claims, Zhang is a patent document which teaches labelling and detecting double-strand breaks (DSBs) in nucleic acids (Title, Abstract, and see document).
Regarding claim 44, Zhang teaches a method of sample preparation for identifying DNA double-strand breaks (DSB) in a nucleic acid sample, where the preparation comprises modifying DSB-associated nucleic acids to be suitable for binding to a substrate comprising immobilized primers (e.g., paragraphs 121 and 128, Figure 3). Zhang teaches providing a plurality of nucleic acids (paragraph 121, step 1, paragraph 188, step 1). Zhang teaches exposing the plurality of nucleic acids to a first adaptor under conditions conducive to ligation, where the first adaptor is capable of being ligated to at least a 3’ terminus of a strand of a DSB, and the first oligonucleotide is ligatable to a 3’ terminus and comprises a sequence that is capable of binding to a primer immobilized to the substrate by hybridization since such an adaptor could reasonably be ligated to “a 3’ terminus” and also bind a primer (paragraphs 121 and 188). Zhang teaches that ligation adapters are attached to the ends of gDNA (i.e., nucleic acid fragments). Furthermore, Zhang teaches that the adapters comprise Illumina RA3 sequences and are therefore “complementary” to primer sequences (see Figure 3, paragraphs 121 and 188). Zhang further teaches fragmenting the nucleic acids by teaching that the adapter-ligated nucleic acids are cut by Cas9 enzymes (step 4, paragraphs 121 and 188). Zhang teaches exposing the nucleic acids to a second adapter (step 6 of paragraph 121, and further the “third adapter” which can be ligated paragraphs 120 and 123). Furthermore, Zhang teaches that the second adapter is not ligatable to the first adaptor because the first adaptor is ”blocked” (e.g., step 2 of paragraph 121 and 188). Zhang teaches using different adaptors (e.g., RA3 and RA5, paragraph 121); thus, Zhang teaches a second adaptor that does not bind to the first primer immobilized on the substrate. Furthermore, Figure 3 of Zhang teaches the ligation of blocked adaptors, which prevent further ligation (i.e., where the second adaptor is not capable of being ligated to the first adaptor).
Thus, the teachings of Zhang appear to read on the instant claims in light of the claim interpretation provided above because Zhang teaches providing a plurality of nucleic acids and exposing them to first and second adaptors and fragmenting the nucleic acids. See claim interpretation, where claim 44 does not require specifically ligating any nucleic acids and only requires that adaptors which are potentially capable of binding and/or not binding to primers and/or ligating to each other are present at some point in the method.
Regarding claim 45, claim 45 merely recites that the second adaptor comprises a sequence identical to “a region of a second primer,” where the second primer is not required for the method. Thus, the “second primer” can be any sequence, as the second primer is not limited in the claim. Thus, the sequence of the adaptors taught by Zhang inherently comprise a region identical to a second primer, as such a sequence can be any sequence. Furthermore, a “region” is not specifically defined in the specification, and could be as short as a few nucleotides.
Regarding claim 46, Zhang teaches that during bridge amplification, first and second primers are immobilized, the sequences attached to libraries prepared in their methods bind to the immobilized primers (paragraph 231). Furthermore, regarding the limitation that the second adaptor comprises a sequence identical to a region of the second immobilized primer, a “region” is not specifically defined in the specification, and could be as short as a few nucleotides. The adaptors taught by Zhang therefore read on the claim.
Regarding claim 47, as discussed above in the rejection of claim 44, Zhang teaches such adaptor/adaptor pair elements. Furthermore, with regards to the claim limitation that the second adapter pair can not be ligated to the first pair, Zhang teaches that the first pair can be blocked (e.g, Figure 3). Furthermore, with regards to the claim limitation that the second pair comprises partially complementary oligos, where the second oligo does not comprise a sequence complementary to the sequence identical to the region of the second primer, Zhang also teaches that the adaptors can be A-tailed or have UMIs attached to them (e.g., Figure 3); such A-tailing would render partially complementary sequences, where furthermore UMIs can be considered to be non-complementary to second primers used for sequencing.
Regarding claim 49, Zhang teaches that the ends of the adaptors can be blocked (i.e., the 5’ or 3’ end comprise a protective feature, for instance Figure 3 or paragraph 121, step 2).
Regarding claim 50, Zhang teaches that the blocked protective feature prevents other nucleic acids from ligating to the first adapter (paragraph 121, step 2).
Regarding claim 51, Zhang teaches that the second adapter comprises a region identical to a second primer (T7, step 6, paragraph 121).
Regarding claim 52, Zhang teaches denaturing nucleic acids to generate single-stranded DNA as a step in sequencing (e.g., paragraph 16).
Regarding claim 53, Zhang teaches contacting the nucleic acids with a substrate comprising immobilized primers under conditions suitable for hybridization of the immobilized primers to complementary nucleic acids (e.g., paragraph 16).
Regarding claim 54, Zhang teaches sequencing nucleic acid molecules to obtain sequence information (e.g., paragraph 32).
Regarding claim 55, Zhang teaches that the plurality of nucleic acids is gDNA (e.g., paragraph 33, final sentence).
Regarding claim 56, Zhang teaches the order to perform the method in the steps a), b), c), and d) (e.g., the methods taught in paragraphs 121 and 188). Note that although the methods taught by Zhang in paragraphs 121 and 188 begin with fragmentation, they also include an additional fragmentation step where the nucleic acids are cut by Cas9 (step 6, paragraphs 121 and 188). The instant method is recited to “comprise” the steps, and therefore allow for additional steps and reagents, such as those taught by Zhang in paragraphs 121 and 188.
Regarding claim 57, Zhang teaches that the nucleic acids are exposed to Cas9, which can cause DSBs in a nucleic acid sample (step 4, paragraph 121).
Regarding claims 86-88, Zhang teaches preparing samples for amplification using immobilized primers and the second primer (e.g., Zhang teaches Illumina sequencing and bridge amplification, paragraph 231). Zhang teaches bridge amplification (paragraph 231).
Regarding claim 89, Zhang teaches that the method is carried out in vitro (e.g., step 8 of paragraph 188).
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 48 is rejected under 35 U.S.C. 103 as being unpatentable over Zhang (WO 2017/218979 A1) as applied to claims 44-47, 49-57, and 86-89, above, and further evidenced by Faham (WO2010053587 A2).
Regarding claim 48, the teachings of Zhang are discussed above. Zhang further teaches that their methods are amendable to sequencing using Illumina sequencing platforms (e.g., page 18, first two lines, paragraph 87, final three lines). Furthermore, Zhang teaches the use of P5 and P7 adapters which can be used with their methods (e.g., paragraph 106).
As evidenced by Faham, the sequences taught in instant 48 (SEQ ID NOs 32 and 34) are simply the P7 and P5 adapters Illumina adapter/primer sequences, respectively (see below):
CAAGCAGAAGACGGCATACGAGAT – P7 adapter taught by Faham (paragraph 231)
CAAGCAGAAGACGGCATACGAGAT – SEQ ID NO 32, claim 48
AATGATACGGCGACCACCGAG – P5 Adapter, taught by Faham (paragraph 231)
AATGATACGGCGACCACCGA – SEQ ID NO 34, claim 48
Note that SEQ ID NO 34 is missing the “G” nucleotide compared with the P5 adapter. This is viewed as an insignificant modification, as such a molecule would still function as an adapter molecule. Thus, as evidenced by Faham, SEQ ID NOs 32 and 34 are simple the P7 and P5 adapters known to be used with Illumina sequencing technologies (paragraph 231, Faham).
Zhang does not explicitly teach that the method taught in paragraphs 121 and 188 use P5 and P7 adapters.
It would have been obvious to a person of ordinary skill in the art before the time of the effective filing date of the claimed invention to use the P5/P7 adapters taught by Zhang in one portion of their disclosure with the methods recited in paragraphs 121 and 188 of the same disclosure because such a modification is the simple substitution of one known prior art element for another with a predictable outcome of success. In the present case, Zhang has taught the specific P5 and P7 adapters to be compatible with their methods using Illumina sequencing, and the substitution of one adapter for another would therefore result in predictable Illumina sequencing success (Zhang, paragraph 106, page 18, first two lines, paragraph 87, final three lines).
Double Patenting
A rejection based on double patenting of the “same invention” type finds its support in the language of 35 U.S.C. 101 which states that “whoever invents or discovers any new and useful process... may obtain a patent therefor...” (Emphasis added). Thus, the term “same invention,” in this context, means an invention drawn to identical subject matter. See Miller v. Eagle Mfg. Co., 151 U.S. 186 (1894); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Ockert, 245 F.2d 467, 114 USPQ 330 (CCPA 1957).
A statutory type (35 U.S.C. 101) double patenting rejection can be overcome by canceling or amending the claims that are directed to the same invention so they are no longer coextensive in scope. The filing of a terminal disclaimer cannot overcome a double patenting rejection based upon 35 U.S.C. 101.
Claims 44-57 and 86-89 are rejected under 35 U.S.C. 101 as claiming the same invention as that of claims 1-20 of prior U.S. Patent No. 12,421,544. This is a statutory double patenting rejection.
Regarding claim 44, claim 1 of ‘544 recites:
“A method of sample preparation for identifying DNA double-strand breaks (DSBs) in a nucleic acid sample, wherein the preparation comprises modifying DSB-associated nucleic acids to be capable of binding to a substrate comprising at least a first immobilised primer, the method comprising:
providing a sample comprising a plurality of nucleic acids;
exposing the plurality of nucleic acids to a first adaptor pair under conditions conducive to ligation, wherein the first adaptor pair comprises first and second oligonucleotides that are at least partially complementary to each other, and the first oligonucleotide is ligatable to a 3′ terminus of a strand of a DSB and comprises a sequence that is capable of binding to the first immobilised primer by hybridisation;
fragmenting the plurality of nucleic acids; and
d) exposing the plurality of nucleic acids to a second adaptor pair under conditions conducive to ligation, wherein the second adaptor pair is capable of being ligated to at least a 5′ terminus of a strand at a break induced by fragmentation but is not capable of being ligated to the first oligonucleotide of the first adaptor pair, wherein the second adaptor pair comprises first and second oligonucleotides that are partially complementary to each other, and the first oligonucleotide is ligatable to a 5′ terminus and comprises a sequence identical to a region of a second primer, and the second oligonucleotide does not comprise a sequence that is complementary to said sequence identical to a region of the second primer.”
Note that, regarding step (b), ‘544 recites “a first adaptor pair” which reasonably includes “a first adaptor” as recited in instant claim 1 step (d). This minor difference in wording of step (b) between ‘544 and step (b) of the instant application is insignificant, as both claims are drawn to the same subject matter comprising a first adaptor..
Similarly, step (d) of ‘544 recites “a second adaptor pair” which reasonably includes a “second adaptor” as recited in instant claim 1 step (d). This minor difference in wording of step (d) between ‘544 and step (d) of the instant application is insignificant, as both are drawn to the same subject matter comprising a second adaptor.
Thus, claim instant claim 44 is drawn to the same subject matter as claim 1 of the ‘544 patent.
Regarding claim 45, claim 1 of ‘544 recites: “the first oligonucleotide is ligatable to a 5′ terminus and comprises a sequence identical to a region of a second primer” in step (d), which relates to the “second adaptor.”
Regarding claim 46, claims 3-4 of ‘544 recite:
“3. The method of claim 1, wherein the second primer is a second immobilised primer comprised by the substrate.
4. The method of claim 3, wherein the method comprises modification of the DSB-associated nucleic acids to be capable of amplification, wherein the amplification comprises the use of the first immobilised primer and the second immobilised primer.”
Claims 3-4 of ‘544 therefore recite that the substrate comprises first and second immobilized primers. Furthermore, claim 1 of ‘544 recites that the first adaptor is capable of hybridizing to the immobilized primer (step (b) of claim 1 of ‘544). Furthermore, step (d) of claim 1 of ‘544 recites: “the first oligonucleotide is ligatable to a 5′ terminus and comprises a sequence identical to a region of a second primer.”
Regarding claim 47, steps (b) of claim 1 of ‘544 recites:
“b) exposing the plurality of nucleic acids to a first adaptor pair under conditions conducive to ligation, wherein the first adaptor pair comprises first and second oligonucleotides that are at least partially complementary to each other, and the first oligonucleotide is ligatable to a 3′ terminus of a strand of a DSB and comprises a sequence that is capable of binding to the first immobilised primer by hybridisation;”
Step (b) of claim 1 of ‘544 therefore recites identical subject matter as the recited step (b) of instant claim 47.
Furthermore, step (d) of ‘544 recites:
“exposing the plurality of nucleic acids to a second adaptor pair under conditions conducive to ligation, wherein the second adaptor pair is capable of being ligated to at least a 5′ terminus of a strand at a break induced by fragmentation but is not capable of being ligated to the first oligonucleotide of the first adaptor pair, wherein the second adaptor pair comprises first and second oligonucleotides that are partially complementary to each other, and the first oligonucleotide is ligatable to a 5′ terminus and comprises a sequence identical to a region of a second primer, and the second oligonucleotide does not comprise a sequence that is complementary to said sequence identical to a region of the second primer.”
Thus, step (d) of claim 1 of ‘544 recites identical subject matter compared with step (d) as recited in instant claim 47.
Regarding claim 48, claims 6-7 of ‘544 recite:
“6. The method of claim 1, wherein the second adaptor pair comprises the first oligonucleotide comprising a sequence according to CAAGCAGAAGACGGCATACGAGAT (SEQ ID NO: 32), and the second oligonucleotide comprising a sequence that does not comprise a sequence of more than 5, 10, 15, or 20 bases, or does not comprise all 24 bases, of the sequence ATCTCGTATGCCGTCTTCTGCTTG (SEQ ID NO: 30).
7. The method of claim 1, wherein the second adaptor pair comprises the first oligonucleotide comprising a sequence according to AATGATACGGCGACCACCGA (SEQ ID NO: 34), and the second oligonucleotide comprising a sequence that does not comprise a sequence of more than 5, 10, or 15 bases, or does not comprise all 20 bases, of the sequence TCGGTGGTCGCCGTATCATT (SEQ ID NO: 31).”
Claims 6 and 7 of ‘544 therefore recite the same sequences and subject matter of instant claim 48.
Regarding claim 49, claim 8 of ‘544 recites: “. The method of claim 1, wherein the first oligonucleotide of the first adaptor pair comprises a 3′ protective feature; and/or wherein the second oligonucleotide of the second adaptor pair comprises a 3′ protective feature.”
Regarding claim 50, claim 9 of ‘544 recites: “The method of claim 1, wherein the second adaptor pair is not capable of being ligated to the first adaptor pair due to the presence of a 3′ modification of the first adaptor pair.”
Regarding claim 51, claim 10 of ‘544 recites: “The method of claim 1, wherein the oligonucleotide of the second adaptor pair that is ligatable to a 5′ terminus comprises a sequence identical to 5, 10, 15, 20, 21, 24, or more bases of the second primer.”
Regarding claim 52, claim 11 of ‘544 recites: “11. The method of claim 1, further comprising denaturing the plurality of nucleic acids to form a plurality of single-stranded nucleic acids.”
Regarding claim 53, claim 12 of ‘544 recites: “12. The method of claim 1, further comprising contacting the plurality of nucleic acids with the substrate comprising immobilised primers under conditions suitable for hybridisation of the immobilised primers to complementary nucleic acids.”
Regarding claim 54, claim 13 of ‘544 recites: “13. The method of claim 12, further comprising obtaining sequence information for any nucleic acids hybridised to the substrate.”
Regarding claim 55, claim 14 of ‘544 recites: “14. The method of claim 1, wherein said sample comprising a plurality of nucleic acids is genomic DNA (gDNA).”
Regarding claim 56, claims 15-17 of ‘544 recite:
15. The method of claim 1, wherein the steps are performed in the order a), b), c), and then d).
16. The method of claim 15, wherein the sample is exposed to conditions capable of causing a DSB at a feature in the nucleic acid sample prior to step b).
17. The method of claim 1, wherein the steps are performed in the order a), c), d), and then b), wherein the sample is exposed to conditions capable of causing or suspected of being capable of causing a DSB between steps d) and b).
Regarding claim 57, claim 18 of ‘544 recites: “18. The method of claim 17, wherein the sample is exposed to conditions capable of causing a DSB at a feature in the nucleic acid sample.”
Regarding claims 86-88, claims 2-5 of ‘544 recite:
2. The method of claim 1, wherein the method comprises modification of the DSB-associated nucleic acids to be capable of amplification, wherein the amplification comprises the use of the first immobilised primer and the second primer.
3. The method of claim 1, wherein the second primer is a second immobilised primer comprised by the substrate.
4. The method of claim 3, wherein the method comprises modification of the DSB-associated nucleic acids to be capable of amplification, wherein the amplification comprises the use of the first immobilised primer and the second immobilised primer.
5. The method of claim 4, wherein the amplification is bridge amplification.
Regarding claim 89, claim 19 of ‘544 recites: “19. The method of claim 1, wherein said ligation in step b) occurs in situ or in vitro using a cell or tissue sample.”
Thus, the claims of ‘544 recite identical subject matter to what is being claimed in the instant application.
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 44-47, 49-57, and 86-89 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-22 of U.S. Patent No. 12,428,683 (‘683). Although the claims at issue are not identical, they are not patentably distinct from each other.
Regarding claim 44, claim 1 of ‘683 recites:
A method for identifying DNA double-strand breaks (DSBs) in a sample comprising a nucleic acid, comprising
exposing the sample of nucleic acid suspected of containing DSBs, under ligation conditions, to a first pair of oligonucleotides, wherein a first oligonucleotide of the first pair of oligonucleotides comprises a 5′ binding feature that enables ligation of said first oligonucleotide to a first strand of a DSB, a first hybridization site to which a first sequencing primer can bind, and a binding sequence for separating said DSB from a pool of DSBs; and a second oligonucleotide of the first pair of oligonucleotides that is complementary to said first oligonucleotide of the first pair and comprises a 3′ binding feature that enables ligation of said second oligonucleotide to a second strand of said DSB; wherein either or both of said oligonucleotides comprise, a 3′ and/or 5′ protective feature;
fragmenting the nucleic acid of said sample into fragments;
exposing said fragments, under ligation conditions, to a second pair of oligonucleotides, wherein a first oligonucleotide of the second pair of oligonucleotides comprises a 5′ binding feature, that enables ligation of said first oligonucleotide to a first strand of a fragmented nucleic acid and a second hybridization site to which a second sequencing primer can bind; and a second longer oligonucleotide of the second pair of oligonucleotides that is in part complementary to said first oligonucleotide of the second pair and comprises a 3′ binding feature for binding to a second strand of said fragmented nucleic acid, a sequence complimentary to said second hybridization site, and a further sequence; and wherein either or both of said oligonucleotides comprise a 3′ and/or 5′ protective feature;
denaturing the fragments to provide single strand nucleic acids;
v) separating the single strand nucleic acids of part iv) into two groups: group A strands that are associated with a DSB and have ligated at a first end the first hybridization site and the binding sequence provided by the first oligonucleotide of the first pair of oligonucleotides and at another end the second hybridization site and the further sequence provided by the second oligonucleotide of the second pair of oligonucleotides and group B strands that are not associated with a DSB and do not have ligated at a first end the hybridization site and the binding sequence provided by the first oligonucleotide of the first pair of oligonucleotides, wherein the separating comprises hybridizing the binding sequence provided by the first oligonucleotide of the first pair of oligonucleotides to a complementary binding strand anchored to a substrate in order to retain group A strands, and
removing group B strands from the substrate; and
vi) sequencing the strands of group A using at least the first sequencing primers where each sequence is equivalent to a DSB, wherein the number and nature of base pair deletions can be determined by comparing each sequence with a genome representative of a species from which the sample was taken.
Claim 1 of ‘683 therefore recites a method for identifying DSBs by providing a sample of plurality of nucleic acids, exposing the nucleic acids to a pair of oligonucleotides ligatable to the 3’ end which are complementary, fragmenting the nucleic acids, and exposing the nucleic acids to a second pair of nucleotides. Furthermore, claim 2 of ‘683 recites that the sequences comprise a sequence enabling bridge amplification, which implies that the sequences are to be sequenced on a substrate comprising immobilized primers. Claims 1 and 2 of ‘683 therefore anticipates the claim limitations recited in claim 44 of the present application.
Regarding claim 45, claim 45 merely recites that the second adaptor comprises a sequence identical to a region of a second primer, where no primer or sequence is recited. Claim 45 is therefore broadly drawn to any sequence of adaptor, where the adaptors of ‘683 read on such a limitation.
Regarding claim 46, claim 2 of ‘683 recites that the sequences comprise a sequence enabling bridge amplification, which implies that the sequences are to be suitable for amplification, where the nucleic acids are sequenced on a substrate comprising immobilized primers (i.e., sequencing on NGS sequencing platforms using bridge amplification). Bridge amplification depends on a substrate comprising immobilized first and second primers, where nucleic acids to be sequenced hybridize to the immobilized primers. Furthermore, recitation of “identical to a region” regarding the second primer can be as few as one or two nucleotides, where a second adaptor inherently reads on such a primer.
Regarding clam 47, these claim limitations appear in claim 1 of ‘683.
Regarding claim 49, claim 1 of ‘683 recites that the first and/or second adaptor pair comprise a 3’ or 5’ protective feature.
Regarding claim 50, claim 9 of ‘683 recites that the end-modifications resist ligation.
Regarding claim 51, claim 1 of ‘683 recites that the second sequencing primer binds to a hybridization region of the 5’ ligation region of the second pair of oligonucleotides.
Regarding claim 52, step iv) of claim 1 of ‘683 recites denaturing fragments to provide single-strand nucleic acids (step iv) of claim 1, ‘683).
Regarding claim 53, claim 2 of ‘683 recite bridge amplification, which uses immobilized primers on a substrate in conditions suitable for hybridization of immobilized primers to complementary nucleic acids.
Regarding claim 54, step vi) of claim 1 of ‘683 recites obtaining sequence information.
Regarding claim 55, claim 5 of ‘683 recites that the nucleic acid sample is gDNA.
Regarding claim 56, the steps of claim 1 of ‘683 are recited in the same order as those recited in instant claim 1; a practitioner could therefore immediately envision that the steps are taken in the order recited.
Regarding claim 57, claim 1 of ‘683 recites that the method is intended for identifying DSBs, where the site of any DSB can reasonably be interpreted to be a “feature of interest” simply because such DSBs could be mapped using the method of claim 1 of ‘683, where any mapped DSB could be a “feature of interest.”
Regarding claims 86-88, claim 2 of ‘683 recites that the sequences comprise a sequence enabling bridge amplification, which implies that the sequences are to be suitable for amplification, where the nucleic acids are sequenced on a substrate comprising immobilized primers (i.e., sequencing on NGS sequencing platforms using bridge amplification). Bridge amplification depends on a substrate comprising immobilized first and second primers, where nucleic acids to be sequenced hybridize to the immobilized primers. Recitation of “bridge” amplification in claim 2 of ‘683 therefore anticipates the claim limitations of instant claims 86-88.
Regarding claim 89, claim 17 of ‘683 recites that ligation occurs in situ or in vitro using a cell or tissue sample.
Claim 48 is rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-20 of U.S. Patent No. 12,428,683 (‘683) in view of Zhang ((WO 2017/2189789 A1), as evidenced by Faham (WO2010053587 A2).
As discussed above, claims 1 and 2 of ‘683 anticipate instant claim 44, including recitation of second oligonucleotide pairs to be used in sequencing. ‘683 recites bridge amplification to be used for sequencing methods (claims 2 and step vi) of claim 1).
‘683 does not recite that the second adapter pair comprises SEQ ID NO 32, and that the second sequence specifically does not comprise SEQ ID NO 30.
Zhang teaches that their methods are amendable to sequencing using Illumina sequencing platforms (e.g., page 18, first two lines, paragraph 87, final three lines). Furthermore, Zhang teaches the use of P5 and P7 adapters which can be used with their methods (e.g., paragraph 106).
As evidenced by Faham, the sequences taught in instant claim 48 (SEQ ID NOs 32 and 34) are simply the P7 and P5 adapters Illumina adapter/primer sequences, respectively (see below):
CAAGCAGAAGACGGCATACGAGAT – P7 adapter taught by Faham (paragraph 231)
CAAGCAGAAGACGGCATACGAGAT – SEQ ID NO 32, claim 48
AATGATACGGCGACCACCGAG – P5 Adapter, taught by Faham (paragraph 231)
AATGATACGGCGACCACCGA – SEQ ID NO 34, claim 48
Note that SEQ ID NO 34 is missing the “G” nucleotide compared with the P5 adapter. This is viewed as an insignificant modification, as such a molecule would still function as an adapter molecule. Thus, as evidenced by Faham, SEQ ID NOs 32 and 34 are simply the P7 and P5 adapters known to be used with Illumina sequencing technologies (paragraph 231, Faham).
It would have been obvious to a person of ordinary skill in the art before the time of the effective filing date of the claimed invention to use the P5/P7 adapters taught by Zhang in combination with the recited method of ‘683 because such a modification is the simple substitution of one known prior art element for another with a predictable outcome of success. In the present case, Zhang has taught the specific P5 and P7 adapters to be compatible with their methods using Illumina sequencing, and the substitution of one adapter for another would therefore result in predictable Illumina sequencing success (Zhang, paragraph 106, page 18, first two lines, paragraph 87, final three lines).
This is a provisional nonstatutory double patenting rejection.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to DOUGLAS CHARLES RYAN whose telephone number is (571)272-8406. The examiner can normally be reached M-F 8AM - 5PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)-272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/D.C.R./Examiner, Art Unit 1635
/RAM R SHUKLA/Supervisory Patent Examiner, Art Unit 1635