DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant's election with traverse of Group I in the reply filed on January 6, 2026 is acknowledged. The traversal is on the ground(s) that the prior art cited in the Restriction mailed on November 6, 2025. This is not found persuasive because Applicants have: 1) amended the claims to obviate the cited prior art; and 2) the amended claim nevertheless is rejected over prior art as discussed below, thereby lacking novelty and/or lacking inventive step.
The requirement is still deemed proper and is therefore made FINAL.
Claims 9 and 10 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected invention, there being no allowable generic or linking claim. Applicant timely traversed the restriction (election) requirement in the reply filed on January 6, 2026.
Priority
Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55.
Information Disclosure Statement
The IDS received on February 20, 2023 and May 22, 2023 are proper and are being considered by the Examiner.
Drawings
The drawings received on February 20, 2023 are acceptable.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1-8 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 1 recites the phrase, “2 guide ssDNA are adjacent to each other and there is no space sequence between them”. It is unclear whether there is no space between the two ssDNAs based on their complementary to each other or whether the regions they anneal on a target strand is immediately adjacent to each other, thus no gap exists between them on the target strand. The latter interpretation is assumed.
Applicants are advised to clearly recite how the two guide ssDNAs anneal to the same strand of the target nucleic acid.
Claim 1 is also indefinite for reciting the limitation, “a gene editing enzyme (Ago)” because the parenthetical term, “Ago” is ambiguous as to whether this is what the gene editing enzyme is limited to or an optional limitation. For the purpose of prosecution, the term has been construed to be an optional limitation.
As well, claim 1 recites the term, “Ago”, which should first be fully spelled out.
Claim 2 is indefinite for reciting the phrase, “the sample to be tested comprises an unamplified sample as well as an amplified (or nucleic acid amplified) sample”. It is unclear how the sample can be both an unamplified and (i.e., “as well as”) an amplified sample.
Claims 4 and 7 recites the word, “preferably” and the phrase, “more preferably”. Any limitations that follow such word (or phrase) is indefinite because it is unclear whether the limitation is actively required and under what parameters (or conditions) the limitation is “preferred”.
Claim 5 recites the phrase, “the guide ssDNA”. It is unclear which of the two guide ssDNAs, “the” guide ssDNA is referring to. For the purpose of prosecution, the phrase has been construed to refer to a guide ssDNA.
Claims 2-8 are indefinite by way of their dependency on claim 1.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1, 2, 4, 5, 7, and 8 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Todd et al. (WO 2008/040095 A1, published April 2008).
The present rejection is based on the claim interpretation of the parenthetical limitation, “Ago” being an optional limitation.
With regard to claim 1, Todd et al. teach a construct which is reproduced below (Fig. 1):
PNG
media_image1.png
459
642
media_image1.png
Greyscale
As seen, Todd et al. teach a method for detecting a target nucleic acid molecule (“invention … a method for the detection of an assembly facilitator”, section [0062], also “the assembly facilitator may be a target … nucleic acid selected from the group … DNA, methylated DNA … amplicons …”, section [0067]), comprising the steps of:
providing a sample to be tested comprising a target nucleic acid molecule, the target nucleic acid molecule comprises a single stranded DNA (“the assembly facilitator may be, for example, a target nucleic acid sequence present in a test sample”, section [0171], also above single stranded assembly facilitator annealing to portions (i) and (i) of the partzyme A and B);
mixing the sample to be tested with a cleavage reagent thereby forming a detection system, wherein the cleavage reagent comprises 2 guide ssDNA, a gene editing enzyme, and a first reporter nucleic acid molecule, the first reporter nucleic acid molecule bearing a fluorescent group and a quencher, wherein the 2 guide ssDNA are adjacent to each other and there is no space sequence between them (see above, the mixture of the assembly facilitator, the partzyme A and B (or a gene editing enzyme), and the substrate (or a first reporter) comprising a fluorescent group and a quencher, two ssDNA that are adjacent to each other with no apparent space sequence between them (see two regions (ii) which are single stranded and are adjacent to each other); and
performing a fluorescent detection on the detection system, thereby obtaining a fluorescence signal value, wherein the detection of a fluorescence signal value in the detection system indicates the presence of a target nucleic acid molecule in the sample, and the absence of a fluorescence signal value in the detection system indicates the absence of a target nucleic acid molecule in the sample (see F-Q substrate is cleaved in the presence of the target nucleic acid molecule (i.e., assembly facilitator).
With regard to claim 2, the sample to be tested comprises amplicons (“the nucleic acid may be selected from … amplicons”, section [0053]).
With regard to claim 4, the lengths of the guide ssDNA are each independently 10-60 nt (see section [0278], underlined sequences of SEQ ID NO: 1 and 3 for Partzymes A and B, 10 bases, respectively).
With regard to claim 5, the ssDNA is phosphorylated (see “P” at the end of SEQ ID NO: 1, section [0278]).
With regard to claim 7, the first reporter nucleic acid molecule has a length of 9-100 nt (see section [0279], wherein SubBi-2FB is the reporter molecule and has 22 nucleotides).
With regard to claim 8, the target nucleic acid molecule is a “specific” target nucleic acid molecule (“MNA complexes specific for each of a plurality of assembly facilitators”, section [0230]).
As well, Todd et al. graphically depict that the two single-stranded DNAs (i.e., two guide ssDNA) that anneal to the assembly facilitator molecule has no gap between them when annealed with an actual sequence shown in the specification (see below from section [0279] and [0280]):
Assembly Facilitator (SEQ ID NO: 5)
TTCCAAAGGAGAGCAACAGTCTGTCTACCTGTAGGTCA
TGCCCCCTCACCCTCACGAAGGTATA/CAGACAGATGGACATCCAGTTGGTGA (SEQ ID NO: 5)
CATATTCGATCGGAGGGACCCGT
Note that the assembly facilitator is the target nucleic acid and the bolded sequence separated by a slash is the two region that are not separated by any gap, each of which is complementary to the partA and parB of DNAzyme ssDNAs that anneal thereto (respectively).1
DNAzyme of Todd et al. is properly considered a “gene editing enzyme,” because the DNAzyme disclosed by Todd et al. is capable of cleaving any sequence to which is it bound, including but not limited to target DNA as well as gene sequence in a sample.
Therefore, the invention as claimed is anticipated by Todd et al.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 3 is rejected under 35 U.S.C. 103 as being unpatentable over Todd et al. (WO 2008/040095 A1, published April 2008).
The teachings of Todd et al. have already been discussed above.
Todd et al. do not explicitly teach that the 5’ end of the respective guide ssDNA is T (claim 3).
However, it would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to take the teachings of Todd et al. and the general knowledge available to the artisan, to arrive at the invention as claimed for the following reasons.
While Todd et al. do not explicitly teach the sequence of the 5’ end of the ssDNA being a T, because the sequence of DNAzyme is engineered to align to any desired target nucleic acid sequence, one of ordinary skill in the art would have resulted in engineering the 5’ ends of the ssDNA of the DNAzyme sequence to have thymine residues at their ends based on what the sequence of the target nucleic acid is being detected.
While the Office recognizes that this motivation may differ from that of Applicants’ rationale for doing so, because the teachings relied upon by Todd et al. is based on a different technology, a different motivation to arrive at a claimed invention is nevertheless recognized by the courts.
That is, whether Applicant has recognized another advantage which would flow naturally from following the suggestion of the prior art cannot be the basis for patentability when the differences would otherwise be obvious. See Ex parte Obiaya, 227 USPQ 58, 60 (Bd. Pat. App. & Inter. 1985).
In KSR International Co. v. Teleflex Inc. (citation omitted), the Supreme Court stated that, “[i]n determining whether the subject matter of a patent claim is obvious, neither the particular motivation nor the avowed purpose of the patentee controls” but rather, “the objective reach of the claim” and that “[i]f the claim extends to what is obvious, it is invalid under § 103.” (page 16, Opinion)
Expounding, the Supreme Court stated that, “[t]he first error of the Court of Appeals in this case was to foreclose this reasoning by holding courts and patent examiners should look only to the problem the patentee was trying to solve” and that the Court of Appeals, “failed to recognize that the problem motivating the patentee may be only one of many addressed by the patent’s subject matter.”
Therefore, for the above reasons, the invention as claimed is deemed prima facie obvious over the cited references.
Conclusion
No claims are allowed.
Claim 6 is free of prior art. There is no motivation to utilize Ago gene editing enzyme which are recited in the Markush group. The enzyme of Todd et al. (of record), is not an Ago enzyme and does not comprise the same or analogous structure. As well, the mechanism by which Ago enzymes of claim 6 operates with 2 guide ssDNA DNA is entirely different (see Fig. 2 or 3).
Applicants are requested to amend the claims to clearly recite that the two guide ssDNAs anneal to the same strand of the single-stranded target nucleic acid, as well as the necessary step of structures involved in the secondary cleavage that effects in the cleavage of the reporter nucleic acid (which is absent in the present claims).
CN 10876036 (made of record in the Restriction) is the closest prior art with regard to the embodiment depicted in claim 6. However, the two guide ssDNAs of CN10876036 anneal to two different strands of a target nucleic acid, and comprises a space sequence between them, with no motivation nor reasons to arrive at the claimed configuration.
Inquiries
Any inquiry concerning this communication or earlier communications from the Examiner should be directed to Young J. Kim whose telephone number is (571) 272-0785. The Examiner can best be reached from 7:30 a.m. to 4:00 p.m (M-F). The Examiner can also be reached via e-mail to Young.Kim@uspto.gov. However, the office cannot guarantee security through the e-mail system nor should official papers be transmitted through this route.
If attempts to reach the Examiner by telephone are unsuccessful, the Examiner's supervisor, Gary Benzion, can be reached at (571) 272-0782.
Papers related to this application may be submitted to Art Unit 1681 by facsimile transmission. The faxing of such papers must conform with the notice published in the Official Gazette, 1156 OG 61 (November 16, 1993) and 1157 OG 94 (December 28, 1993) (see 37 CFR 1.6(d)). NOTE: If applicant does submit a paper by FAX, the original copy should be retained by applicant or applicant’s representative. NO DUPLICATE COPIES SHOULD BE SUBMITTED, so as to avoid the processing of duplicate papers in the Office. All official documents must be sent to the Official Tech Center Fax number: (571) 273-8300. Any inquiry of a general nature or relating to the status of this application should be directed to the Group receptionist whose telephone number is (571) 272-1600.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/YOUNG J KIM/Primary Examiner
Art Unit 1637 January 23, 2026
/YJK/
1 It should be noted that partA and partB of DNAzyme are shown as top and bottom alignment (bolded and underlined), but when formed together, the remaining regions (non-bolded and underlined) form a construct shown in Figure 1 shown above where the two (i) regions anneal adjacent to each other without any gap therebetween.