Prosecution Insights
Last updated: April 19, 2026
Application No. 18/042,890

IMPROVED DEPENDOPARVOVIRUS PRODUCTION COMPOSITIONS AND METHODS

Non-Final OA §103§112
Filed
Feb 24, 2023
Examiner
PENNINGTON, KATIE LEIGH
Art Unit
1634
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Dyno Therapeutics Inc.
OA Round
1 (Non-Final)
26%
Grant Probability
At Risk
1-2
OA Rounds
3y 10m
To Grant
82%
With Interview

Examiner Intelligence

Grants only 26% of cases
26%
Career Allow Rate
13 granted / 51 resolved
-34.5% vs TC avg
Strong +57% interview lift
Without
With
+56.9%
Interview Lift
resolved cases with interview
Typical timeline
3y 10m
Avg Prosecution
67 currently pending
Career history
118
Total Applications
across all art units

Statute-Specific Performance

§101
4.8%
-35.2% vs TC avg
§103
34.3%
-5.7% vs TC avg
§102
14.9%
-25.1% vs TC avg
§112
31.5%
-8.5% vs TC avg
Black line = Tech Center average estimate • Based on career data from 51 resolved cases

Office Action

§103 §112
DETAILED ACTION The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Applicant’s Response to Election/Restriction Filed, Amendment, and Arguments/Remarks, filed 16 December 2025, have been entered. Claims 1-56 are pending in the application. Claims 1, 31, 33, 34, 35, 36, 40, 44, 45, 46, 47, 48, 53, 54, and 56 are independent claims. Applicant’s election of the invention of Group I, drawn to a first nucleic acid comprising a sequence encoding an ORF for a functional dependoparvovirus B MAAP polypeptide; a first dependoparvovirus B particle; a first vector; a cell, cell-free system, or other translation system; and a first dependoparvovirus B MAAP polypeptide, is acknowledged. Additionally, applicant’s election of the following species: Positions of change or mutation that creates an exogenous start codon: Position 74; Nucleic acid sequences encoding MAAP: SEQ ID NO: 4; MAAP polypeptide amino acid sequence: SEQ ID NO: 3; Nucleic acid sequences encoding VP1: SEQ ID NO: 2; VP1 polypeptide sequences: SEQ ID NO: 1; Rep polypeptide sequences: SEQ ID NO: 333; in a reply filed 16 December 2025 is acknowledged. While Applicant has not indicated whether these elections of Group I and species 1)-6) have been made with or without traverse, Applicant has not provided any arguments traversing the restriction nor the election of species requirement(s). Therefore, the election of Group I and species position 74 and SEQ ID NOs: 1-4 and 33 is considered to have been made without traverse. Applicant’s election of position 74 appears to conflict with the election of SEQ ID NOs: 2 and 4, which comprise a mutation at nucleotide position 75 relative to the VP1 start codon according to SEQ ID NO: 2, thereby introducing an exogenous ATG start codon for the MAAP reading frame. SEQ ID NOs: 2 and 4 do not comprise a mutation at VP1 position 74 relative to a wildtype AAV5 VP1-encoding sequence, as taught by NCBI NC_006152.1 [2018, Adeno-associated virus 5, complete genome, retrieved on 19 February 2026 from: <https://www.ncbi.nlm.nih.gov/nucleotide/NC_006152.1?report=genbank&log$=nuclalign&blast_rank=1&RID=TEJ71783014>, published 13 August 2018], see alignment below between NCBI NC_006152.1 and instant SEQ ID NO: 2, wherein the VP1 coding sequence is taught by NCBI to encompass nucleotides 2207-4381: PNG media_image1.png 581 707 media_image1.png Greyscale . In view of the conflicting elections of species, Examiner has modified the election of species requirement for 1) Positions of change or mutation that creates an exogenous start codon to be 1) Position of the first nucleotide of the exogenous start codon, such that Applicant’s election of Position 74 corresponds to the position of the A in the ATG exogenous start codon within the elected sequence of SEQ ID NO: 4. Claims 35 and 40-56 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Claim 26 is withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected species, there being no allowable generic or linking claim. Claims 1-34 and 36-39 are currently pending in the application and under examination to which the following grounds of rejection are applicable. An action on the merits follows. Priority The present application is a 35 U.S.C. 371 national stage filing of International Application No. PCT/US2021/047700, filed 26 August 2021, which claims priority to U.S. Provisional Application No. 63/070,763, filed 26 August 2020. Thus, the earliest possible priority for the instant application is 26 August 2020. Information Disclosure Statement The information disclosure statement filed 05 August 2025 has been considered by the Examiner. Examiner notes the filing of IDS Size Fee assertions for the IDS filed 05 August 2025, as required under 37 CFR 1.98, indicating that no IDS size fee is required under 37 CFR 1.17(v) at this time. Specification The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code on page 193 line 27 of the specification. Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01. Claim Objections Claims 1-4, 6-8, 10-16, 22-25, 27, 29-30, 36-37, and 39 are objected to because of the following informalities: Claims 1, 6, 11, 25 each recite the abbreviations “ORF” and “MAAP” without first writing out the terms for which they are abbreviated. Claims 7-8, 10, 12 recites the abbreviation “MAAP” without first writing out the term for which it is abbreviated. Appropriate correction is required. Claims 2, 29-30, and 37 each recite “a cell, a cell-free system, or other translation system, comprising” in lines 1-2 of claim 2, lines 2 and 5 of claim 29, lines 3 and 4-5 of claim 30, and lines 2 and 6 of claim 37, which appears to be typographical error including an extra comma after “system”. Appropriate correction is required. Claims 3, 13-16, 23, 27 each recite “VP1” without first writing out the terms for which they are abbreviated. Appropriate correction is required. Claim 4 recites, “listed in columns 4 or 5 of Table 1”. Where possible, claims are to be complete in themselves. Incorporation by reference to a specific figure or table “is permitted only in exceptional circumstances where there is no practical way to define the invention in words and where it is more concise to incorporate by reference than duplicating a drawing or table into the claim. Incorporation by reference is a necessity doctrine, not for applicant’s convenience.” Ex parte Fressola, 27 USPQ2d 1608, 1609 (Bd. Pat. App. & Inter. 1993) (citations omitted). See MPEP 2173.05(s). Appropriate correction is required. Claim 8 additionally recites, “SEQ ID NO: 325, by” which appears to be a typographical error improperly inserting a comma after “SEQ ID NO: 325”. Appropriate correction is required. Claim 15 additionally recites, “SEQ ID NO: 321, by” which appears to be a typographical error improperly inserting a comma after “SEQ ID NO: 321”. Appropriate correction is required. Claim 22 recites, “SEQ ID NOs: 333-336, by” which appears to be a typographical error improperly inserting a comma after “SEQ ID NOs: 333-336”. Appropriate correction is required. Claim 24 recites the abbreviations “VP1”, “VP2”, VP3”, and “AAP” without first writing out the terms for which they are abbreviated. Appropriate correction is required. Claims 36-37 and 39 each recite the abbreviation “MAAP” without first writing out the terms for which they are abbreviated. Appropriate correction is required. Claim Rejections - 35 USC § 112(b) The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 2, 7, 11, 14, 16, 18, 21, 23, 25, 27-29, 34, and 39 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. The term “similar” in claim 2 is a relative term which renders the claim indefinite. The term “similar” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. The claim recites “an otherwise similar nucleic acid that does not comprise the exogenous start codon”. It is unclear whether the claim requires the “otherwise similar” nucleic acid to be identical to the claimed nucleic acid other than the start codon change, or to what extent the “otherwise similar” nucleic acid may deviate from the claimed nucleic acid at other positions. As such, the metes and bounds of the claim cannot be determined. Claim 7 recites, “at least 90% sequence identity to SEQ ID NO: 325”, which is indefinite because it is unclear how a sequences can have sequence identity to a sequence identifier. As such, the metes and bounds of the claim cannot be determined. In the interest of compact prosecution, Examiner has interpreted this phrase to indicate “at least 90% sequence identity to the amino acid sequence according to SEQ ID NO: 325”. Claim 11 recites, “100% identity to any of SEQ ID NOs: 4, 8”, which is indefinite because it is unclear how a sequences can have sequence identity to a sequence identifier. As such, the metes and bounds of the claim cannot be determined. In the interest of compact prosecution, Examiner has interpreted this phrase to indicate “100% identity to any of the nucleic acid sequences according to SEQ ID NOs: 4, 8”. Claims 14 and 18 recite, “at least 90% sequence identity to SEQ ID NO: 321”, which is indefinite because it is unclear how a sequences can have sequence identity to a sequence identifier. As such, the metes and bounds of the claim cannot be determined. In the interest of compact prosecution, Examiner has interpreted this phrase to indicate “at least 90% sequence identity to the amino acid sequence according to SEQ ID NO: 321”. Claim 16 recites, “100% identity to any of SEQ ID NOs: 2, 6”, which is indefinite because it is unclear how a sequences can have sequence identity to a sequence identifier. As such, the metes and bounds of the claim cannot be determined. In the interest of compact prosecution, Examiner has interpreted this phrase to indicate “100% identity to any of the nucleic acid sequences according to SEQ ID NOs: 2, 6”. Claim 21 recites, “at least 90% sequence identity to any of SEQ ID NOs: 333”, which is indefinite because it is unclear how a sequences can have sequence identity to a sequence identifier. As such, the metes and bounds of the claim cannot be determined. In the interest of compact prosecution, Examiner has interpreted this phrase to indicate “at least 90% sequence identity to any of the amino acid sequence according to SEQ ID NOs: 333”. Claim 23 recites the limitation "the VP1, Cap, or Rep polypeptide”" in line 2. There is insufficient antecedent basis for this limitation in the claim. Claim 23 is dependent on claim 13, which is dependent on claim 1. None of claims 1, 13, nor 23 have any prior recitations of Cap or Rep polypeptide. As such, the metes and bounds of the claim cannot be determined. Claims 25 and 27 recite the limitation "the dependoparvovirus Cap gene”" in lines 2 of each claim. There is insufficient antecedent basis for this limitation in the claim. Claims 25 and 27 each dependent on claim 13, which is dependent on claim 1. None of claims 1, 13, 25, nor 27 have any prior recitations of a dependoparvovirus Cap gene. As such, the metes and bounds of the claim cannot be determined. Claim 28 recites the limitation "the Cap gene" in lines 2 and 5. There is insufficient antecedent basis for this limitation in the claim. Claim 28 is dependent on claim 17, which is dependent on claim 1. Claim 17 recites “a sequence encoding a dependoparvovirus Cap polypeptide” but does not recite any Cap gene. Additionally, claim 28 recites, “wherein the polypeptide produced from the Cap gene is functional, capable of packaging dependoparvovirus DNA into a dependoparvovirus capsid, or the dependoparvovirus capsid assembled from the polypeptide produced from the Cap gene is capable of infecting a target cell”, which is indefinite because the list is incongruent. It is unclear whether “capable of packaging dependoparvovirus DNA into a dependoparvovirus capsid” is meant to modify or exemplify “functional” or is meant to be an alternative option to “functional”. There appears to be a list of three alternatives, but the third alternative following “or” is not consistent with the structure of the first two items, which then leaves in question the relationship between the first two (e.g., “functional” and “capable”). As such, the metes and bounds of the claim cannot be determined. Claim 34 recites, “comprising the nucleic acid, vector, or particle of claim 1”. However, claim 1 is directed to a nucleic acid and does not recite any vector nor any particle. As such, there is insufficient antecedent basis for this limitation in the claim. Therefore, the metes and bounds of the claim cannot be determined. Claim 39 recites, “100% identity to any of SEQ ID NOs: 3, 7”, which is indefinite because it is unclear how a sequences can have sequence identity to a sequence identifier. As such, the metes and bounds of the claim cannot be determined. In the interest of compact prosecution, Examiner has interpreted this phrase to indicate “100% identity to any of the amino acid sequences according to SEQ ID NOs: 3, 7”. Claim Rejections - 35 USC § 112(a)- Written Description The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 1, 7-8, 11, 14-16, 18-19, 21-22, and 39 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This rejection addresses three written description issues regarding each of 1) the MAAP polypeptide sequence; 2) the VP1/Cap polypeptide sequence; and 3) the Rep polypeptide sequence. Firstly (1), regarding the MAAP polypeptide sequence, claims 7-8 recite wherein the MAAP polypeptide has at least 90% sequence identity to SEQ ID NO: 325 or differs from SEQ ID NO: 325 by no more than 10 amino acids, respectively. Claims 11 recites wherein the ORF encoding MAAP comprises a nucleic acid sequence with at least 80% identity to SEQ ID NO: 4 (as elected). Claim 39 recites wherein the MAAP polypeptide comprises an amino acid sequence with at least 80% identity to SEQ ID NO: 3 (as elected). The specification generally teaches a reference sequence which is a wildtype sequence or a sequence with 90 or 95% identity to a wildtype sequence of SEQ ID NO: 331 [Enumerated embodiment 5, page 40 lines 8-10]; that the MAAP polypeptide comprises an animo acid sequence with at least 80%, 85%, 90%, or 95% sequence identity to SEQ ID NO: 325 [Enumerated embodiments 8-11]; that he MAAP polypeptide, except for the amino acid specified by the exogenous start codon, differs from the sequence of SEQ ID NO: 325, by no more than 20, 15, 10, 5, or 2 amino acid residues [Enumerated embodiments 12-16]; that the MAAP polypeptide differs from the sequence of SEQ ID NO: 325 in a pattern specified by a CIGAR string listed in column 8 of Table 1 [Enumerated embodiment 17, page 40 lines 12-16]; wherein the MAAP polypeptide comprises an amino acid sequence with at least 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% identity to any of SEQ ID NO: 3 [Enumerated embodiment 29, 128]; and wherein the MAAP polypeptide comprises an amino acid sequence that differs by no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 amino acids from the sequence of any of SEQ ID NO: 3 [Enumerated embodiment 30, 129]. The specification also teaches that a MAAP polypeptide encompasses a polypeptide comprising an amino acid sequence with at least 70% identity to a natural, mutant, artificial, or synthetic MAAP known in the art [page35 lines 14-17]. The specification additionally generally teaches wherein the ORF encoding MAAP comprises a nucleic acid sequence with at least 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% identity to any of SEQ ID NO: 4 [Enumerated embodiment 24] and wherein the ORF encoding MAAP comprises a nucleic acid sequence that differs by no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotides from the sequence of any of SEQ ID NO: 4 Enumerated embodiment 28]. Table 1 provides a list of 80 distinct variants of AAV5 MAAP which comprise sets of 1-4 specific positions which are mutated to encode exogenous ATG or CTG start codons, wherein 4 of the 80 (i.e., variants 1, 2, 39, and 43) have an ATG at the MAAP position 74 as elected. Table 1 also provides 4 SEQ ID NOs associated with each of the specific MAAP variants corresponding in numerical order to the VP1 polypeptide sequence, VP1 encoding sequence, MAAP polypeptide sequence, and MAAP encoding sequence; wherein variant 1 corresponds to the sequences of SEQ ID NOs: 1-4, variant 2 corresponds to the sequences of SEQ ID NOs: 5-8, variant 39 corresponds to the sequences of SEQ ID NOs: 153-156, and variant 43 corresponds to the sequences of SEQ ID NOs: 169-172. Note also that variants 1, 2, 39, and 43 each have a VP1 amino acid edit distance to AAV5 of 1, 2, 2, and 1, respectively, and 1, 3, 2, and 2 amino acid changes relative to MAAP, respectively [Table 1]. Note also that the exogenous start codon position at 74 (relative to the VP1 encoding sequences) itself results in a single amino acid insertion at the N-terminal end of the MAAP polypeptide (i.e., the starting methionine), which accounts for 1 of the amino acid changes relative to MAAP as taught in the CIGAR string of Table 1 Column 8. Therefore, the instant specification teaches only 4 variants which comprise the elected exogenous ATG start codon at position 74. Regarding the MAAP polypeptide sequence, one of the 4 disclosed variants corresponds to the elected sequence of SEQ ID NO: 3, and the other three have 1-2 amino acid changes relative to the sequence of SEQ ID NO: 3, and so are 99.2% and 98.3% identical to the elected sequence of SEQ ID NO: 3. Regarding the MAAP encoding sequence, one of the 4 disclosed variants corresponds to the elected sequence of SEQ ID NO: 4, and the other 3 have 3, 2, and 1 nucleotide changes relative to the sequence of SEQ ID NO: 4, and so are 98.7%, 99.1%, and 99.9% identical to the elected sequence of SEQ ID NO: 4. The disclosure further teaches variant dependoparvovirus production efficiencies relative to a wildtype AAV5, wherein the variants comprise an exogenous start codon in the VP1 +0, +1, and +2 frames [page 32 lines 9-22, Figure 1, 2]. Example 1 teaches that a library of mutant AAV5 sequences were generated and tested for changes in one or more characteristics, wherein they identified a “superpackager” variant resulting from introduction of new +1 frame ATGs proximal to the start of the MAAP encoding sequences, wherein the variant was characterized by an increased production efficiency [page 194lines 19-24]. These variants all included new +1 ATGs clustered around the start of MAAP [page 194 lines 24-25]. Example 2 teaches that introduction of CTG into AAV5 MAAP encoding sequence improves viral particle packaging compared to wildtype AAV5 MAAP [page 195 liens 5-16]. The specification does not teach which variants are specifically illustrated in Figures 1-2. The specification does not teach specific activities for variants listed in Table 1 other than log2(production efficiency relative to AAV5) values. Additionally, the specification does not teach any variants other than the specific start site variants listed in Table 1. The claims require a nucleic acid to encode an ORF for a functional dependoparvovirus B MAAP polypeptide, note that the specification teaches that the term “functional” refers to a dependoparvovirus MAAP polypeptide that either: increases the packaging and/or secretion of dependoparvovirus particles when present in a host cell or provides at least 50% of the activity of a naturally occurring MAAP polypeptide [page 34 line 27- page 35 line 2]. However, the specification does not disclose which variants of the recited sequences would comprise nucleotides or amino acids which would retain the essential functional properties of the MAAP proteins nor which variants would disrupt such functions. The specification additionally does not disclose any % identity which would retain the necessary identity and functionality of the MAAP proteins. The specification teaches that “MAAP polypeptide” refers to “a naturally occurring dependoparvovirus membrane associated accessory protein (MAAP): a mutant, artificial, or synthetic MAAP known in the art; or a polypeptide comprising an amino acid sequence with at least 70, 75, 80, 85, 90, 95, 96, 97, 98, or 99% identity to the aforementioned”. However, this does not address the requirements for sequence identity percentages which would retain both the necessary identity and functionality. As such, the specification fails to provide any specific guidance as to which up to 10%, 20%, or 10 amino acids of the recited sequences could be changed to allow for functional MAAP proteins of the instant invention. Therefore, the description is not sufficient to adequately describe and demonstrate possession of any variants of SEQ ID NOs: 3, 4, or 325 other than the 3 specific variants described in Table 1 having the elected ATG at position 74, and particularly variants of SEQ ID NOs: 3, 4, or 325 which comprise up to 10%, 20%, or 10 amino acid sequence differences. The following guidance provided in MPEP 2163 is informative. To satisfy the written description requirement, a patent specification must describe the claimed invention in sufficient detail that one skilled in the art can reasonably conclude that the inventor had possession of the claimed invention. See, e.g., Moba, B.V. v. Diamond Automation, Inc., 325 F.3d 1306, 1319, 66 USPQ2d 1429, 1438 (Fed. Cir. 2003); Vas-Cath, Inc. v. Mahurkar, 935 F.2d at 1563, 19 USPQ2d at 1116. The written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice (see i)(A) above), reduction to drawings (see i)(B) above), or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus (see i)(C) above). See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406. An invention described solely in terms of a method of making and/or its function may lack written descriptive support where there is no described or art-recognized correlation between the disclosed function and the structure(s) responsible for the function. In other words, describing a composition by its function alone typically will not suffice to sufficiently describe the composition. See for example Eli Lilly, 119 F.3 at 1568, 43 USPQ2d at 1406 (Holding that description of a gene’s function will not enable claims to the gene "because it is only an indication of what the gene does, rather than what it is."); see also Fiers, 984 F.2d at 1169-71, 25 USPQ2d at 1605-06 (discussing Amgen Inc. v. Chugai Pharm. Co., 927 F.2d 1200, 18 USPQ2d 1016 (Fed. Cir. 1991)). An adequate written description of a chemical invention also requires a precise definition, such as by structure, formula, chemical name, or physical properties, and not merely a wish or plan for obtaining the chemical invention claimed. See, e.g., Univ. of Rochester v. G.D. Searle & Co., 358 F.3d 916, 927, 69 USPQ2d 1886, 1894-95 (Fed. Cir. 2004) (The patent at issue claimed a method of selectively inhibiting PGHS-2 activity by administering a non-steroidal compound that selectively inhibits activity of the PGHS- 2 gene product, however the patent did not disclose any compounds that can be used in the claimed methods. While there was a description of assays for screening compounds to identify those that inhibit the expression or activity of the PGHS-2 gene product, there was no disclosure of which peptides, polynucleotides, and small organic molecules selectively inhibit PGHS-2. The court held that "[w]ithout such disclosure, the claimed methods cannot be said to have been described."). Furthermore, written description issues may also arise if the knowledge and level of skill in the art would not have permitted the ordinary artisan to immediately envisage the claimed product arising from the disclosed process. See, e.g., Fujikawa v. Wattanasin, 93 F.3d 1559, 1571, 39 USPQ2d 1895, 1905 (Fed. Cir. 1996). While it has been held that what is conventional or well known to one of ordinary skill in the art need not be disclosed in detail, for inventions in emerging and unpredictable technologies, or for inventions characterized by factors not reasonably predictable which are known to one of ordinary skill in the art, more evidence is required to show possession. The specification, as discussed in detail above, provides guidance for 80 distinct MAAP variants, which each express specific ATG or CTG variants at specific locations within the MAAP encoding nucleic acid, wherein only 4 of the variants comprise the elected exogenous ATG start codon at the elected position, without providing sufficient detailed descriptions of the various variants beyond the elected start site substitutions which would have sufficient structural and functional properties of an MAAP protein while also maintaining sufficient structural and functional properties of the polypeptides expressed from the overlapping reading frames (i.e., Cap/VP1 proteins). As such, the specification fails to provide a description of a representative number of species by actual reduction to practice (see i)(A) above), reduction to drawings (see i)(B) above), or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the Applicant was in possession of any of the claimed genus of variants of SEQ ID NOs: 3, 4, or 325 comprising up to 10%, 20%, or 10 amino acid differences in nucleic acid or amino acid sequences. There is no disclosure of which nucleotides encode nor which amino acids are in the active sites, binding pockets, or hydrophobic cores of the proteins. There are no structure/function relationships taught for SEQ ID NOs: 3, 4, or 325. The specification only includes MAAP start codon variants, wherein ATG or CTG are substituted into 1-4 specific positions within the nucleic acid sequence, wherein only 4 of the variants comprise the elected ATG at the elected position. The scope of the claims as written encompass any variation in the amino acid sequence, which includes variations which change the nucleotide and/or amino acid sequence at any position to any other nucleotide and/or amino acid. As such, the claim as written encompasses variations which may change the structure sufficiently to adversely affect the function and/or alter the function of the MAAP gene and/or protein. Asokan teaches mutations in the MAAP sequence which abolish MAAP expression (e.g., MAAPΔ targeted deletion mutants), and that he ablation of MAAP expression results in a significant delay in the extracellular secretion of wildtype and recombinant AAV particles [Asokan et al. (US20240294576A1), published 5 September 2024, filed 5 May 2021, with priority to 05 May 2020, 0375-0377, Table 3, Figure 3A-C]. Asokan teaches point mutations in the MAAP encoding sequence which disrupt the expression of the VP2 protein (e.g., a mutation which disrupts the VP2 start codon) [0350, 0355]. Galibert teaches the introduction of stop codons into the MAAP sequence stops translation of full-length wildtype MAAP and that alternative mutations reduce expression of full-length wildtype MAAP [Galibert et al. (US20230374540A1), published 23 November 2023, filed 25 June 2021, with priority to 25 June 2020, 0016-0017, 0023-0025]. Specifically, Galibert teaches point mutations to stop MAAP translation which had to be carefully designed to avoid disruption to the VP1 amino acid sequence [0205]. Accordingly, given the dramatic effects single point mutations within the nucleic acid/amino acid sequences of MAAP can have on the function of the MAAP and/or VP1 functions, sufficient to prevent expression or disrupt function, and thereby delay AAV particle processing and secretion; the scope of the claim encompasses variants of the MAAP sequence which would result in non- or dys-functional proteins. As such, the variants of the MAAP nucleic acid and/or amino acid sequences of up to 10%, up to 20%, or up to 10 amino acid non-identities relative to the sequences of SEQ ID NOs: 3, 4, or 325 such that a functional MAAP protein are still encoded, were neither conventional nor predictable at the time of filing, and the knowledge and level of skill in the art at the time of filing would not have permitted the ordinary artisan to immediately envisage all the variations of the sequences of SEQ ID NOs: 3, 4, or 325, up to 10%, up to 20%, or up to 10 amino acid variant, which would still produce functional MAAP and/or VP1 proteins from the generic description provided by the specification. In view of these considerations, an ordinarily skilled artisan would not have viewed the teachings of the specification as sufficient to show that the Applicant was in possession of the claimed invention. Secondly (2), regarding the VP1/ Cap polypeptide sequences, claims 14-15 recite wherein the VP1 polypeptide has at least 90% sequence identity to SEQ ID NO: 321 or differs from SEQ ID NO: 321 by no more than 10 amino acids, respectively. Claim 16 recites wherein the sequence encoding VP1 polypeptide comprises a nucleic acid sequence with at least 80% identity to SEQ ID NO: 2 (as elected). Claims 18-19 recite wherein the Cap polypeptide has at least 90% sequence identity to SEQ ID NO: 321 or differs from SEQ ID NO: 321 by no more than 10 amino acids, respectively. The specification generally teaches wherein the VP1 polypeptide comprises an amino acid sequence with at least 80%, 85%, 90%, or 95% sequence identity to SEQ ID NO: 321 [Enumerated embodiment 37-40]; wherein the VP1 polypeptide, except for the amino acid specified by the exogenous start codon, differs from the sequence of SEQ ID NO: 321, by no more than 20, 15, 10, 5, or 2 amino acid residues [Enumerated embodiments 41-45]; and wherein the VP1 polypeptide differs from the sequence of SEQ ID NO: 321 in a pattern specified by a CIGAR string listed in column 7 of Table 1 [Enumerated embodiment 102]. The specification also generally teaches wherein the nucleic acid encoding VP1 polypeptide comprises a nucleic acid sequence with at least 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% identity to SEQ ID NO: 2 [Enumerated embodiment 46, 139] and wherein the sequence encoding the VP1 polypeptide comprises a nucleic acid sequence that, except for the amino acid specified by the exogenous start codon, differs by no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotides from the sequence of SEQ ID NOs: 2 [Enumerated embodiment 47, 140]. The specification additionally generally teaches wherein the VP1 polypeptide comprises an amino acid sequence with at least 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% identity to any of SEQ ID NOs: 1 [Enumerated embodiment 48, 141] and wherein the VP1 polypeptide comprises an amino acid sequence that, except for the amino acid specified by the exogenous start codon, differs by no more than 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 amino acids from the sequence of any of SEQ ID NOs: 1 [Enumerated embodiment 49, 142]. The specification also generally teaches wherein the Cap polypeptide comprises an amino acid sequence with at least 80%, 85%, 90%, or 95% sequence identity to SEQ ID NO: 321 [Enumerate embodiments 71-74] and wherein the Cap polypeptide, except for the amino acid specified by the exogenous start codon, differs from the sequence of SEQ ID NO: 321, by no more than 20, 15, 10, 5, or 2 amino acid residues [Enumerated embodiments 75-79]. Table 3 of the specification teaches sequences for exemplary reference sequences for wildtype MAAP encoding sequence, MAAP polypeptide sequences, Cap (VP1, VP2, VP3) polypeptide or nucleic acid sequence. The specification does not teach any specific Cap/VP1 mutations other than the MAAP variants presented in Table 1, as discussed above, wherein 4 of the variants comprise the elected ATG exogenous start codon at the elected position. The specification does not teach any effects on the Cap/VP1 capsid protein function resulting from these variants other than general teachings of the overall production efficiencies shown in Figures 1 and 2, the log2(production efficiency relative to AAV5) presented in Table 1 column 2, and the number of amino acid changes relative to AAV5 in Table 1 column 3. The claims require a nucleic acid to encode a functional Cap polypeptide and produce a functional dependoparvovirus. Note that the specification teaches that when used in reference to a polypeptide component of a dependoparvovirus capsid, the term “functional” refers to a polypeptide which provides at least 50% of the activity of a naturally occurring version of that polypeptide component [page 35 lines 4-8]. However, the specification does not disclose which variants of the recited sequences would comprise nucleotides or amino acids which would retain the essential functional properties of the VP1/Cap proteins nor which variants would disrupt such functions. The specification additionally does not disclose any % identity which would retain the necessary identity and functionality of the Cap/VP1 proteins. The specification teaches that the term “dependoparvovirus capsid” refers to “an assembled viral capsid comprising dependoparvovirus polypeptides”, which may be a functional dependoparvovirus capsid [page 33 lines 22-26]. However, this does not address the requirements for sequence identity percentages which would retain both the necessary identity and functionality for the overlapping MAAP and VP1/Cap open reading frames. As such, the specification fails to provide any specific guidance as to which up to 10%, 20%, or 10 amino acids of the recited sequences could be changed to allow for functional MAAP and Cap/VP1 proteins of the instant invention. Therefore, the description is not sufficient to adequately describe and demonstrate possession of any variants of SEQ ID NOs: 2 or 321 other than the specific variants described in Table 1, and particularly variants of SEQ ID NOs: 2 or 321 which comprise up to 10%, 20%, or 10 amino acid sequence differences. The specification, as discussed in detail above, provides guidance for 80 MAAP variants which each express specific ATG or CTG variants at specific locations within the MAAP encoding nucleic acid, wherein only 4 have the elected exogenous ATG start codon at the elected position, without providing sufficient detailed descriptions of the various variants which would have sufficient structural and functional properties of an MAAP protein while maintaining sufficient structural and functional properties of the polypeptides expressed from the overlapping reading frames (i.e., Cap/VP1 proteins). As such, the specification fails to provide a description of a representative number of species by actual reduction to practice (see i)(A) above), reduction to drawings (see i)(B) above), or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the Applicant was in possession of any of the claimed genus of variants of SEQ ID NOs: 2 or 321 comprising up to 10%, 20%, or 10 amino acid differences in nucleic acid or amino acid sequences. There is no disclosure of which nucleotides encode nor which amino acids are in the active sites, binding pockets, or hydrophobic cores of the proteins. There are no structure/function relationships taught for SEQ ID NOs: 2 or 321. The specification only includes MAAP start codon variants, wherein ATG or CTG are substituted into 1-3 specific positions within the nucleic acid sequence encoding MAAP and VP1/Cap proteins, wherein only 4 of the variants comprise the elected exogenous ATG start codon at the elected position of 74 relative to the VP1 encoding sequence. The scope of the claims as written encompass any variation in the amino acid sequence, which includes variations which change the nucleotide and/or amino acid sequence at any position to any other nucleotide and/or amino acid. As such, the claim as written encompasses variations which may change the structure sufficiently to adversely affect the function and/or alter the function of the MAAP and/or Cap/VP1 genes and/or proteins. As discussed above, Asokan teaches point mutations in the MAAP encoding sequence which disrupt the expression of the VP2 protein (e.g., a mutation which disrupts the VP2 start codon) [0350, 0355]. Galibert teaches point mutations to stop MAAP translation which had to be carefully designed to avoid disruption to the VP1 amino acid sequence [0205]. Accordingly, given the dramatic effects single point mutations within the nucleic acid/amino acid sequences of MAAP/VP1/Cap can have on the function of the MAAP and/or VP1/Cap functions, sufficient to prevent expression or disrupt function, and thereby delay AAV particle processing and secretion; the scope of the claim encompasses variants of the MAAP/VP1/Cap sequences which would result in non- or dys-functional proteins. As such, the variants of the MAAP/VP1/CAp nucleic acid and/or amino acid sequences of up to 10%, up to 20%, or up to 10 amino acid non-identities relative to the sequences of SEQ ID NOs: 2 or 321 such that a functional MAAP/VP1/Cap protein are still encoded, were neither conventional nor predictable at the time of filing, and the knowledge and level of skill in the art at the time of filing would not have permitted the ordinary artisan to immediately envisage all the variations of the sequences of SEQ ID NOs: 2 or 321, up to 10%, up to 20%, or up to 10 amino acid variant, which would still produce functional MAAP and/or VP1/Cap proteins from the generic description provided by the specification. In view of these considerations, an ordinarily skilled artisan would not have viewed the teachings of the specification as sufficient to show that the Applicant was in possession of the claimed invention. Thirdly (3) , regarding the Rep polypeptide sequence, claims 21-22 recite wherein the Rep polypeptide has at least 90% sequence identity to SEQ ID NO: 333 (as elected) or differs from SEQ ID NO: 333 (as elected) by no more than 10 amino acids, respectively. The specification only generally teaches wherein the Rep polypeptide comprises an amino acid sequence with at least 80%, 85%, 90%, or 95% sequence identity to any of SEQ ID NOs: 333 [Enumerated Embodiments 82-84] and wherein the Rep polypeptide differs from the sequence of SEQ ID NOs: 333 by no more than 20, 15, 10, 5, or 2 amino acid residues [Enumerated embodiments 86-89]. Table 3 of the specification teaches sequences for an exemplary reference sequence of a Rep polypeptide sequence. The specification additionally provides no variants for a Rep protein and no structural and functional properties of Rep protein which must be retained. Additionally, Walker teaches that specific single amino acid mutations in Rep68 which disrupt the endonuclease, helicase, and/or DNA-binding activities [Walker et al. 1997, Journal of Virology, 71(4), 2722-2730, abstract]. Accordingly, given the dramatic effects single point mutations within the amino acid sequences of Rep can have on the function of the Rep protein, sufficient to disrupt the endonuclease, helicase, and/or DNA-binding activities; the scope of the claim encompasses variants of the Rep sequences which would result in non- or dys-functional proteins. As such, the variants of the Rep nucleic acid and/or amino acid sequences of up to 10% or up to 10 amino acid non-identities relative to the sequences of SEQ ID NO: 333 such that a functional Rep protein is still encoded, were neither conventional nor predictable at the time of filing, and the knowledge and level of skill in the art at the time of filing would not have permitted the ordinary artisan to immediately envisage all the variations of the sequences of SEQ ID NO: 333, up to 10% or up to 10 amino acid variant, which would still produce functional Rep proteins from the generic description provided by the specification. In view of these considerations, an ordinarily skilled artisan would not have viewed the teachings of the specification as sufficient to show that the Applicant was in possession of the claimed invention. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim(s) 1-25, 27-34, and 36-39 are rejected under 35 U.S.C. 103 as being unpatentable over Asokan [US20240294576A1, published 5 September 2024, filed 5 May 2021, with priority to 05 May 2020]; in view of Galibert et al. [US20230374540A1, published 23 November 2023, filed 25 June 2021, with priority to 25 June 2020]; Peabody [1989, The Journal of Biological Chemistry, 264(9), 5031-5035]; NCBI NC_006152.1 [2018, Adeno-associated virus 5, complete genome, retrieved on 19 February 2026 from: <https://www.ncbi.nlm.nih.gov/nucleotide/NC_006152.1?report=genbank&log$=nuclalign&blast_rank=1&RID=TEJ71783014>, published 13 August 2018]; and Bahou et al. [US20140155469A1, published 05 June 2014]. Regarding claim 1, Asokan teaches a nucleic acid sequence encoding an open reading frame (ORF) encoding a functional dependoparvovirus B (e.g., AAV5) membrane-associated accessory protein (MAAP) polypeptide, wherein the ORF comprises an exogenous start codon [0350, SEQ ID NO: 20]. Regarding claims 2 and 29-30, Asokan teaches that loss of MAAP expression decreases the extracellular secretion of rAAV particles, and that trans-complementation with MAAP fully rescues the extracellular secretion of rAAV particles, such that trans-complementation with recombinant MAAP restored cellular egress of multiple AAV serotypes and increased the homogeneity of EV-associated viral particles [0378-0380]. Asokan teaches that MAAP enables extracellular secretion of AAV particles in a serotype-independent manner [0380]. Asokan does not teach wherein a cell, cell-free system, or other translation system comprising the nucleic acid packages, secretes, and/or produces a dependoparvovirus particle at a level of at least 50% or more than that of a cell, cell-free system, or other translation system comprising an otherwise similar nucleic acid that does not comprise the exogenous start codon. However, Galibert teaches that modification of an AAV2 MAAP CTG start codon to a CGG start codon reduces the expression of the AAV2 MAAP, decreases the titers of AAV2 particles produced, decreases the specificity of packaging viral genomes vs contaminant genomes, and reduces the percentage of capsids which contain an AAV genome [Figure 1, 3, 4, 7, 8, 11, 12, 14]. Galibert also teaches nucleic acid constructs having MAAP driven by ATG start codons (e.g., p0280-MAAP, p0283-MAAP-GFP, and p0326-MAAP-start2) used to compare with the WT sequence to determine the primary start site used for translation of WT MAAP by Western blot [0229-0231, Table 1]. Therefore, an ordinarily skilled artisan at the time of filing the instant application would expect that substituting and/or inserting a CTG start codon for a CGG start codon would increase the expression of the AAV5 MAAP and would likewise increase the packaging, production, and secretion of rAAV particles compared to an rAAV particle comprising the endogenous non-canonical start codon. Additionally, Peabody teaches that expression levels from canonical AUG start codons are higher than expression levels from non-canonical start codons both in vitro and in vivo, wherein ACG and CUG are the most efficiently recognized non-AUG start codons [column 4 ¶ 1-column 5 ¶ 3, Figures 2, 3, 4, 6]. Therefore, an ordinarily skilled artisan would additionally be motivated to substitute a non-canonical start codon with a canonical ATG start codon to increase the expression of the resultant polypeptide to thereby increase the expression of the AAV5 MAAP and likewise increase the packaging, production, and secretion of rAAV particles compared to an rAAV particle comprising the endogenous non-canonical start codon. Regarding claim 3-4, Asokan teaches wherein the sequence comprises a change or mutation at a position between or including nucleotides 14 to 250 of a VP1 encoding sequence that creates an exogenous start codon at the position (e.g., SEQ ID NO: 20, which is an AAV5 VP1 coding sequence mutated at the MAAP start codon corresponding to nucleotides 77-79 of the VP1 coding sequence) [350, SEQ ID NO: 20]. Regarding claim 5, Asokan teaches wherein the change or mutation is relative to a reference sequence comprising a wildtype sequence, such that a wildtype MAAP comprises a non-canonical CTG (encoding Lysine for AAV1-4 and 6-13) or alternative (encoding Arginine for AAV5) start codon at nucleotides 77-79 [0347, 0350]. Regarding claim 6, Asokan teaches wherein the functional dependoparvovirus B MAAP polypeptide ORF allows for production of dependoparvovirus particles [Figure 1E-F]. Regarding claims 7-8, Asokan teaches wherein the MAAP polypeptide has at least 90% sequence identity to the sequence according to instant SEQ ID NO: 325 and wherein the MAAP polypeptide, except for the amino acid specified by the exogenous start codon, differs from the sequence of SEQ ID NO: 325 by no more than 10 amino acid residues (e.g., Asokan SEQ ID NO: 5 for AAV5 prior to substitution with the ATG start codon): PNG media_image2.png 171 586 media_image2.png Greyscale . Regarding claim 9, Asokan teaches wherein the exogenous start codon is an ATG [350]. Regarding claim 10, note that the limitations following the term “optionally” have been interpreted as though they are not required limitations of the claim. Asokan teaches wherein the MAAP polypeptide comprises at least 80 amino acids (e.g., 118 amino acids) [SEQ ID NO: 5]. Regarding claim 11, Asokan teaches wherein the ORF encoding MAAP comprises a nucleic acid sequence with at least 80% identity to the sequence according to elected SEQ ID NO: 4 (e.g., SEQ ID NO: 20): PNG media_image3.png 492 644 media_image3.png Greyscale . Regarding claim 12, Asokan teaches wherein the MAAP polypeptide is an AAV5 MAAP polypeptide [SEQ ID NOs: 5, 20, Table 1, 2, Figure 1E-F]. Regarding claim 13, Asokan teaches that the MAAP is expressed from a (+1) frameshifted open reading frame in the N-terminal region of the AAV capsid (Cap) gene encoding capsid proteins VP1, VP2, and VP3 [0007, 0057, 0346, Figure 1A, 2A, 2D, 3H]. Asokan also teaches the sequence of SEQ ID NO: 20, which comprises the cap gene coding sequence, including the VP1 coding sequence [0014]. Regarding claims 14-15, Asokan teaches wherein the VP1 polypeptide has at least 90% sequence identity to SEQ ID NO: 321 and, except for the amino acid specified by the exogenous start codon, differs from the sequence of SEQ ID NO: 321 by no more than 10 amino acids; see the alignment between the translated reading frame 1 of Asokan SEQ ID NO: 20 with instant SEQ ID NO: 321: PNG media_image4.png 998 642 media_image4.png Greyscale . Regarding claim 16, Asokan teaches wherein the sequence encoding the VP1 polypeptide comprises a nucleic acid sequence with at least 80% identity to the sequence according to instant SEQ ID NO: 2 (e.g., Asokan SEQ ID NO: 20): PNG media_image5.png 923 647 media_image5.png Greyscale PNG media_image6.png 927 647 media_image6.png Greyscale PNG media_image7.png 862 657 media_image7.png Greyscale . Regarding claim 17, Asokan teaches the nucleic acid of SEQ ID NO: 20 which comprises the coding sequence for both MAAP and capsid proteins [0188]. Additionally, Asokan teaches a nucleic acid comprising both a rep gene and a cap gene (which cap gene comprises the capsid genes VP1, VP2, and VP3 as well as the MAAP gene) [Figure 1A, 2A, 2D, 3H]. Asokan teaches a composition comprising a nucleic acid comprising an AAV5 MAAP gene with an ATG start codon (pcDNA3.1(+)-C-HA or pcDNA3.1-C-eGFP) and a nucleic acid comprising a both an AAV2 rep gene and AAV8 cap gene (e.g., AAV8-Rep/Cap-VP or AAV8-Rep/Cap-MVP) [0350, 0355, 0355]. Regarding claims 18-19, as discussed above for claims 14-15, Asokan teaches a sequence encoding a Cap polypeptide (SEQ ID NO: 20) which has a sequence which is at least 90% identical to the sequence according to instant SEQ ID NO: 321, wherein, except for the amino acid specified by the exogenous start codon, differs from the sequence of SEQ ID NO: 321 by no more than 10 amino acids [see the alignment between the translated reading frame 1 of Asokan SEQ ID NO: 20 with instant SEQ ID NO: 321 above]. Regarding claim 20, as discussed above, Asokan teaches a nucleic acid comprising both a rep gene and a cap gene (which cap gene comprises the capsid genes VP1, VP2, and VP3 as well as the MAAP gene) [Figure 1A, 2A, 2D, 3H]. Asokan teaches nucleic acids comprising an AAV5 MAAP gene with an ATG start codon (pcDNA3.1(+)-C-HA or pcDNA3.1-C-eGFP) and a nucleic acid (e.g., an AAV helper plasmid) comprising both an AAV2 rep gene and AAV8 cap gene (e.g., AAV8-Rep/Cap-VP or AAV8-Rep/Cap-MVP) [0350, 0354, 0355, 0378]. Additionally, Asokan teaches to use the MAAP overexpression vector (e.g., MAAP-HA) in combination with the helper vector to produce AAV particles [0385, Figure 5G-H]. Regarding claims 21-22, Asokan does not teach wherein the Rep polypeptide has at least 90% sequence identity to the elected sequence of instant SEQ ID No: 333, nor that the Rep polypeptide differs from the sequence of SEQ ID NO: 333 by no more than 10 amino acid residues. However, Bahou teaches a functional, wild type AAV2 Rep68 sequence (e.g., SEQ ID NO: 5) which is 100% identical to the sequence of SEQ ID NO: 333 [0031, 0115, SEQ ID NO: 5, Figure 6]. Bahou also teaches that the AAV Rep gene encodes Rep78, Rep68, Rep 52, and Rep40 [0113]. Bahou further teaches that Rep78 and/or Rep68, along with AAV terminal repeats, are sufficient for site-specific viral DNA integration, and that Rep78 and/or Rep68 are required in trans for AAV replication and/or excision from the host genome [0112, 0115]. Therefore, an ordinarily skilled artisan at the time of filing the instant application would have been motivated to use a Rep polypeptide having a functional sequence, such as the wildtype AAV2 Rep68 sequence of Bahou SEQ ID NO: 5 having 100% identity to instant SEQ ID NO: 333, to promote AAV integration, replication, and/or excision. Regarding claim 23, Asokan teaches wherein the VP1 and Cap polypeptides are AAV5 polypeptides [SEQ ID NO: 20, Table 2]. Regarding claim 24, Asokan teaches a nucleic acid composition comprising a Cap gene that comprises a sequence encoding capsid proteins and Rep protein which are not naturally occurring in the AAV5 genome (e.g., AAV2 Cap and AAV8 Rep) [0350, 0355]. Regarding claim 25, Asokan teaches wherein the polypeptide sequence encoded by the dependoparvovirus Cap gene comprises a mutation corresponding to the exogenous start codon in the MAAP polypeptide ORF [0350, SEQ ID NO: 20]. Regarding claim 27, Asokan does not teach wherein the polypeptide sequence encoded by the dependoparvovirus Cap gene comprises a mutation corresponding to a difference between the sequence of SEQ ID NO: 1 (as elected) and a wildtype VP1 polypeptide sequence (e.g., E25D according to wildtype AAV5 numbering, see the alignment between the translated reading frame 1 of NCBI VP1 coding sequence nucleotides 2207-3000 with instant SEQ ID NO: 1: PNG media_image8.png 422 649 media_image8.png Greyscale ). However, Galibert teaches that AAV5 MAAP comprises a leading 15-25 amino acid sequence not seen in the other serotypes [0105, 0199], which corresponds to a start codon ranging from a TCA at VP1 nt position -2-+1 (encoding Ser corresponding to AA1 in SEQ ID NO: 5, see NCBI for the extended AAV5 sequence upstream of the VP1 coding sequence) to TGG at VP1 nt position +32-34, according to the AAV5 wildtype cap gene taught in Figure 21E, which has 99.6% identity with instant SEQ ID NO: 2: PNG media_image9.png 352 648 media_image9.png Greyscale . Therefore, Galibert suggests that the CGG codon in AAV5 at VP1 nucleotide position 77-79, which aligns with the CTG codons in other serotypes (see Asokan Figure 1B), may not be the true start codon for AAV5 MAAP [0199] and teaches uncertainty regarding the true start site of the AAV5 MAAP. Galibert also teaches that codons which have just a single nucleotide deviation from the canonical ATG start codon can theoretically be used as non-canonical start codons, such as CTG, AGG, or ACG [0200, 0222]. The coding sequence of the AAV5 VP1 sequence, as taught by Asokan SEQ ID NO: 20, Galibert SEQ ID NO: 5, and NCBI, comprises additional potential start codons in the +1 reading frame within the first 79 nucleotides which meet the requirements of deviating by only a single nucleotide from the canonical ATG start codon, including those highlighted in yellow and green below (the VP1 start codon is bolded and the CGG which aligns with the CTG non-canonical start codon of other serotypes is underlined): gtcatgtcttttgttgatcaccctccagattggttggaagaagttggtgaaggtcttcgcgagtttttgggccttgaagcgg [see NCBI for the extended sequence upstream of the VP1 ATG start codon]. Therefore, given the teachings of Galibert to modify the potential non-canonical start codons of an AAV MAAP to a canonical ATG start codon to compare with the wildtype protein to assess the wild-type start codon usage, the teachings of Galibert of uncertainty regarding the actual start site for AAV5 MAAP translation, and the teachings of Galibert that any codon which deviates from a canonical start codon by only one nucleotide can theoretically be used as a non-canonical translation start site, an ordinarily skilled artisan at the time of filing the instant application would have been motivated to mutate any one of the potential non-canonical start sites in the +1 reading frame of the VP1 protein, within the vicinity of the estimated CGG start site, to a canonical ATG start site to assess the MAAP protein production from the modified nucleic acid, including the AAG immediately upstream of the CGG corresponding to VP1 nt position 77-79. By replacing the putative AAG start codon at VP1 nt position 74-76 with an ATG codon, the corresponding codon of the VP1 reading frame would be altered from GAA to GAT, thereby introducing an E25D mutation into the VP1 polypeptide, which corresponds to the difference between instant SEQ ID NO: 1 and a wildtype AAV5 VP1 polypeptide sequence taught by NCBI. Further, as discussed above, Peabody teaches that expression levels from canonical AUG start codons are higher than expression levels from non-canonical start codons both in vitro and in vivo, wherein ACG and CUG are the most efficiently recognized non-AUG start codons [column 4 ¶ 1-column 5 ¶ 3, Figures 2, 3, 4, 6]. Therefore, an ordinarily skilled artisan would additionally be motivated to substitute a non-canonical start codon with a canonical ATG start codon to increase the expression of the resultant polypeptide to thereby increase the expression of the AAV5 MAAP and likewise increase the packaging, production, and secretion of rAAV particles compared to an rAAV particle comprising the endogenous non-canonical start codon. Regarding claim 28, Asokan teaches wherein the polypeptide produced by the Cap gene is functional, capable of packaging dependoparvovirus DNA into a dependoparvovirus capsid, and the dependoparvovirus capsid assembled from the polypeptide produced from the Cap gene is capable of infecting a target cell [0065-0069, 0071-078, 0125, 0360, Figure 1I-J, 2A-L, 11]. Regarding claim 31-32, Asokan teaches production of dependoparvovirus particles (e.g., AAV particles), wherein the AAV particles comprise a ssDNA AAV genome, and wherein the MAAP protein is encoded within the AAV genome [0004, 0008-0009]. Asokan does not explicitly teach a dependoparvovirus particle produced with a nucleic acid encoding an AAV5 MAAP comprising an exogenous start codon. However, as discussed above, Galibert teaches the association between increased MAAP expression, increased titer, increased packaging specificity, and increased percentage of capsids containing AAV genomes [Figure 1, 3, 4, 7, 8, 11, 12, 14]. Additionally, as described above, Peabody teaches the motivation to substitute a non-canonical start codon with a canonical ATG start codon to increase the expression of the resultant polypeptide [column 4 ¶ 1-column 5 ¶ 3, Figures 2, 3, 4, 6].. Therefore, given the teachings of Asokan of a MAAP comprising an exogenous start codon, the teachings of AAV particles comprising an AAV genome comprising a MAAP coding sequence, and the motivation taught by Galibert and Peabody to substitute a non-canonical start codon with a canonical ATG start codon to increase the expression of the resultant polypeptide to thereby increase the expression of the AAV5 MAAP and likewise increase the packaging, production, and secretion of rAAV particles, an ordinarily skilled artisan would be motivated to introduce an exogenous start codon in to a MAAP coding sequence within an AAV genome to increase production of the AAV particles formed thereby. Accordingly, an ordinarily skilled artisan would be motivated to produce a dependoparvovirus particle (e.g., AAV particle) having a MAAP coding sequence comprising an exogenous start codon. Regarding claim 33, Asokan teaches wherein the nucleic acid comprising an AAV5 MAAP gene with an ATG start codon is comprised in a pcDNA3.1(+)-C-HA or pcDNA3.1-C-eGFP vector [0350]. Regarding claim 34, Asokan teaches a cell comprising the nucleic acid comprising an AAV5 MAAP gene with an ATG start codon [0350, 0352, Figure 1E-F]. Regarding claim 36, Asokan teaches an AAV5 MAAP polypeptide encoded by the nucleic acid comprising an AAV5 MAAP gene with an ATG start codon [0350, 0352, Figure 1E-F]. Regarding claim 37, as discussed above for claims 2 and 29-30, Galibert and Peabody teach the expectation that inserting and/or substituting an ATG or CTG start codon for a CGG start codon and/or would increase the expression of the AAV5 MAAP and would likewise increase the packaging, production, and secretion of rAAV particles compared to an rAAV particle comprising the endogenous non-canonical start codon. Regarding claim 38, Asokan teaches wherein the exogenous start codon is ATG, and as such, the amino acid corresponding to the exogenous start codon comprises a methionine [0350]. Regarding claim 39, Asokan teaches wherein the AAV5 MAAP polypeptide comprises an amino acid sequence with at least 80% identity to the sequence of elected SEQ ID NO: 3 (e.g., SEQ ID NO: 5): PNG media_image10.png 206 659 media_image10.png Greyscale . Therefore, given the motivation taught by Galibert and Peabody to substitute a non-canonical start codon with a canonical ATG start codon to increase the expression of the resultant polypeptide to thereby increase the expression of the AAV5 MAAP and likewise increase the packaging, production, and secretion of rAAV particles compared to an rAAV particle comprising the endogenous non-canonical start codon; the motivation taught by Bahou to use a Rep polypeptide having a functional sequence, such as the wildtype AAV2 Rep68 sequence of Bahou SEQ ID NO: 5 having 100% identity to instant SEQ ID NO: 333, to promote AAV integration, replication, and/or excision; the motivation taught by Galibert to mutate any one of the potential non-canonical start sites in the +1 reading frame of the VP1 protein, within the vicinity of the estimated CGG start site, to a canonical ATG start site to assess the MAAP protein production from the modified nucleic acid, including the AAG immediately upstream of the CGG corresponding to VP1 nt position 77-79, thereby introducing an E25D mutation into the VP1 polypeptide; it would have been prima facie obvious to an ordinarily skilled artisan at the time of filing the instant application to modify the nucleic acid composition of Asokan to include an AAV5 MAAP comprising an exogenous ATG start codon which introduces an E25D mutation into the wildtype AAV5 VP1 sequence and to include a Rep sequence according to SEQ ID NO: 333, wherein the AAV5 MAAP promotes increased secretion of AAV particles with a reasonable expectation of success. Conclusion No claim is allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Dr. KATIE L PENNINGTON whose telephone number is (703)756-4622. The examiner can normally be reached M-Th 8:30 am - 5:30 pm, Friday 8:30 am - 12:30 pm CT. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Maria G. Leavitt can be reached on (571) 272-1085. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. DR. KATIE L. PENNINGTON Examiner Art Unit 1634 /KATIE L PENNINGTON/Examiner, Art Unit 1634 Dr. A.M.S. Wehbé /ANNE MARIE S WEHBE/Primary Examiner, Art Unit 1634
Read full office action

Prosecution Timeline

Feb 24, 2023
Application Filed
Feb 20, 2026
Non-Final Rejection — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12583896
CAGED-DEGRON-BASED MOLECULAR FEEDBACK CIRCUITS AND METHODS OF USING THE SAME
2y 5m to grant Granted Mar 24, 2026
Patent 12582106
IL-15 HUMANIZED MOUSE MODEL AND USE THEREOF
2y 5m to grant Granted Mar 24, 2026
Patent 12559760
VECTORS AND EXPRESSION SYSTEMS FOR PRODUCING RECOMBINANT PROTEINS
2y 5m to grant Granted Feb 24, 2026
Patent 12402611
Genetically Modified Mice and Engraftment
2y 5m to grant Granted Sep 02, 2025
Patent 12398374
METHOD FOR PREPARING INDUCED PLURIPOTENT STEM CELLS BY REPROGRAMMING SOMATIC CELLS
2y 5m to grant Granted Aug 26, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
26%
Grant Probability
82%
With Interview (+56.9%)
3y 10m
Median Time to Grant
Low
PTA Risk
Based on 51 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month