Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Response to Amendment and Arguments
The Amendment filed on 2/9/2026 in response to the previous Non-Final Office Action (7/31/2026) is acknowledged and has been entered.
Claim 68 is added.
Claims 1-50 and 65 have been cancelled.
Claims 51-64 and 66-68 are pending and under consideration for a kit comprising a regent for detecting expression of RAS associated binding protein 5 (RAB5) and a reagent for detecting of HER2 protein.
In this Office action, terms Rab and RAB is interchangeable.
The following office action contains NEW GROUNDS of rejection-based on the amendment.
Information Disclosure Statement
The information disclosure statement (s) (IDS) submitted on 1/2/2026 and 3/17/2026 are/is considered by the examiner and initialed copies/copy of the PTO-1449 are/is enclosed.
Rejections/Objection Withdrawn
The objection of Claim 62 is withdrawn in view of the claim amendment.
The rejection of Claims 51-62 under 35 U.S.C. 103 as being unpatentable over anti-Rab5 antibody clone ERP17321(Abcam.com. Early endosome marker 2015) in view of Zhao et al (BioMed Research International 2015, Article ID 107149) is withdrawn in view of the amendment to the claims.
The rejection of Claims 51-62 and 66 under 35 U.S.C. 103 as being unpatentable over Frittoli et al (JBC 206:307-328, Nov 2014) or anti-Rab5 antibody clone ERP17321(Abcam.com. Early endosome marker 2015) in view of Zhao et al (BioMed Research International 2015, Article ID 107149) is withdrawn in view of the amendment to the claims.
Rejection Maintained and Response to Arguments:
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102 of this title, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 51-64 and 67 remain and are rejected under 35 U.S.C. 103 as being unpatentable over anti-Rab5 antibody clone ERP17321 (Abcam.com. Early endosome marker 2015) in view of Li et al (BMC Cancer 16:910, 2016) and Zhao et al (BioMed Research International 2015, Article ID 107149).
In view of the amendment to the claims, rejection has been modified with the same references.
Abcam.com discloses a rabbit recombinant monoclonal anti-Rab5A antibody for immunoassay including western blot and immunohistochemistry to detect antigen Rab5A on human samples (page 2, line 1-2 and figures).
Abcam.com does not teach that the antibody is in a kit for detecting the expression levels of Rab5 in samples and not teach the reagent for detection HER2 protein by immunohistochemistry and analyzing the data by computer to clinician.
Li et al teach method for detecting surface expressed HER1-4 on cancer cells by immunohistochemistry and data and statistical analysis thereafter with a computer system to predict value for a clinical usage (pages 2-3, figure 2, and table 1 and table 2-3). Li et al teach a kit comprising antibodies used for detections of HER family proteins (page 3, left col). Li et al specifically teach prognostic significance of protein expressions in pancreatic cancer (entire document and figure 3 and table 4 in particular).
Zhao et al teach a kit used for western blotting after primary antibody staining, the kits comprise streptavidin-Horseradish Peroxidase (HRP)-conjugated secondary antibody and detecting agent and teach BrdU immunohistochemistry (IHC) kit (ab125306) for detecting paraformaldehyde treated tissue samples (page 3, left, section 2.5 and 2.6).
It would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention was made to combine the methods to form a kit comprising detecting surface markers of RAB5 and HER1-3 expression on cancer cells with expected result. In order to increase the efficacy of cancer detection one of ordinary skill in the art before the effective filing date of was made would have been motivated with reasonable expectation of success to form a kit with all the reagents for the marker because Abcam.com has shown anti-Rab5 monoclonal antibody used by clinician use as a marker for disease detection, Li et al have shown surface expressed HER1-4 and roles in cancer invasion detected by immunohistochemistry with antibody, and Zhao et al have shown a method of forming kit for immunoassays comprising western blotting and immunohistochemical staining. Therefore, the references in combination teach every limitation of the claims and the invention as a whole would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the invention was made, absent unexpected results.
Claims 51-64, 66, and 67 remain and are rejected under 35 U.S.C. 103 as being unpatentable over anti-Rab5 antibody clone ERP17321 (Abcam.com. Early endosome marker 2015), Li et al (BMC Cancer 16:910, 2016) and Zhao et al (BioMed Research International 2015, Article ID 107149), as set forth above, and further in view of Frittoli et al (JBC 206:307-328, Nov 2014).
The rejection has been modified with the same references.
The teachings of Abcam, Li, and Zhao et al on a kit comprising reagents to detecting RAB5 and HER family including HER2 are set forth above. The references do not teach a reagent for detecting RAB4 set forth in claim 66.
Frittoli et al teach anti-Rab5A and anti-Rab4A antibodies used for immunohistochemical staining of human or mouse tumor tissue samples to determine RAB5A and RAB4 expressions that play a role in tumor cell by promoting tumor cell invasion and metastasis (entire document). Frittoli et al also teach HRP conjugated secondary antibodies used to detect the primary antibody stained and score the signal intensity (page 328, left col) and figure 1-F, figure 2-D etc).
It would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention was made to combine the methods to form a kit comprising further detecting Rab4 expression on cancer cells with expected result. In order to increase the efficacy of cancer detection, one of ordinary skill in the art before the effective filing date of was made would have been motivated with reasonable expectation of success to form a kit comprising one or more biomarker detections because Abram has shown anti-Rab5, Frittoli et al have shown both anti-RAB5 and anti-RAB4 monoclonal antibodies together used for detecting the expressions of the proteins on tumor cells, Li et al have shown antibodies detecting HER family including HER1-4 as addressed in the teaching above, and Zhao et al have shown a method of forming and using a kit for immunoassays comprising western blotting and immunohistochemical staining which could be used for protein detection in cells and tissues. Therefore, the references in combination teach every limitation of the claims and the invention as a whole would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the invention was made, absent unexpected results.
Response to applicant’s argument:
Applicant is noted that remained rejections are modified according to the amended claims. The response below is based on the teaching of the references.
From page 6-8, applicant argues:
Abcam lists products comprising recombinant monoclonal antibody to RAB5A, but not teach of suggest RAB5 detection in combination with HER2 detection (newly amended), and does not discuss cancer diagnosis or patient’s response to surface therapy.
Zhao’s teaching is unrelated to cancer diagnosis, RAB5 and HER2 detection.
Frittoli teaches expression of RAB5A and focus on role of RAB5A in promoting tumor invasion and metastasis, but not teach or suggest RAB5 detection in combination with HER2 detection.
Li’s teaching on HER1-4 on cancer but no significant association between HER1 and HER2 expression and survival of the patients.
In response, the application claims a product, a kit comprising detection reagent for cancer markers. As set forth in the rejections, each of the references teaches the role of the biomarkers in cancer condition, detection, which leads to a cancer diagnosis, possible treatment, one skill in the art would be motivated to combine the reagents for the markers in one kit to perform detections which would or could result in the expression determination in cancer cell and further diagnosis or prognosis.
Regarding with the combination of RAB5 detection with HER2 detection by one kit (newly amended claims), the Office made the rejections under 35 U.S.C. 103(a) is based on the guideline of MPEP 2141 (rejection under 35 USC 103), particularly, MPEP 2141.02, which states
In determining the difference between the prior art and the claims, the question under 35 USC103 is not whether the difference themselves would have been obvious, but whether the claimed invention as a whole would have been obvious.
It is improper to argue and discuss the references cited under USC 103 rejected individually without clearly addressing the combined teachings. It must be remembered that the references are relied upon in combination and are not meant to be considered separately. One skilled in the art have realized as the time past, more and more cancer markers are identified, which could be used as biomarkers for detection and diagnostic purposes in order to benefit the early detection and/or treating the cancers. Thus, one skilled in the art would be motivated with high expectation of success to combine the marker detection reagents to form a new kit as described in Zhao and Li et al because the roles of RAB5 and HER2 in the cancer diagnosis and prognosis have been suggested by Li and Frittoli et al. One skilled in the art would been motivated with high expectation of success to make a new kit with all the reagents as set forth in the references to arrive at current invention.
Thus, Applicant’s arguments have not been found persuasive, and the rejection is maintained.
The following is a New Ground of rejection- based on newly added claim 68
Claims 51 and 68 are rejected under 35 U.S.C. 103 as being unpatentable over Li et al (BMC Cancer 16:910, 2016) in view of GenBank Homo sapiens RAB5A cDNA Clone MGC 17504 (July 2006) evidenced by Origene’s Oligonucleotide Primers.
Abcam.com discloses a rabbit recombinant monoclonal anti-Rab5A antibody for immunoassay including western blot and immunohistochemistry to detect antigen Rab5A on human samples (page 2, line 1-2 and figures), as set forth above
Li et al teach method of detecting surface expressed HER1-4 on cancer cells by immunohistochemistry and data and statistical analysis thereafter with a computer system to predict value for a clinical usage (pages 2-3, figure 2, and table 1 and table 2-3). Li et al teach a kit comprising antibodies used for such detections of HER family proteins (page 3, left col), as set forth above.
Li et al do not teach Rab5 being detected by amplification oligonucleotide as set forth in new claim 68.
Designing Amplification oligonucleotide primers based on cDNA sequence is within the purview of one skilled in the art. RAB5A cDNA Clone MGC 17504 has been submitted in year 2006. The cDNA has been used in the field for designing PCR primers to detect RAB5 expression at mRNA levels since, which is also evidenced by and commercially available as oligonucleotide Primers at Origene, wherein the forward primer sequence is ACTTCTGGGAGAGTCCGCTGTT and reverse primer sequence is GTGTCATCAAGACATACAGTTTGG.
It would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention was made to combine the methods to form a kit comprising amplification oligonucleotide for detecting RAB5 expression levels with expected result. One of ordinary skill in the art before the effective filing date of was made would have been motivated with reasonable expectation of success to form a kit comprising reagents for HER2 detection and amplification oligonucleotide primer set for RAB5 detection because Li et al have shown a kit comprising antibodies detecting HER family including HER1-4 and GenBank has provided RAB5A cDNA Clone MGC 17504 evidenced by Origene-oligonucleotide Primers showing cDNA and primers designed for detecting RAB5 mRNA in PCR. Therefore, the references in combination teach every limitation of the claims and the invention as a whole would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the invention was made, absent unexpected results.
Conclusion
No claim is allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any extension fee pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Lei Yao, whose telephone number is (571) 272-3112. The examiner can normally be reached on 8:00am-6:00pm Monday-Friday.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Samira Jean-Louis, can be reached on (571) 270-3503. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/LEI YAO/ Primary Examiner, Art Unit 1642