CTNF 18/048,238 CTNF 96451 DETAILED ACTION Notice of Pre-AIA or AIA Status 07-03-aia AIA 15-10-aia The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA. Application Status and Withdrawn Rejections Applicant’s amendment filed April 1, 2026, amending claims 1, 14 and 66, and canceling claims 11-13 is acknowledged. Claims 1-2, 8-10, 14-21, 23-24, 31-34, 66, 107 and 118 are pending. Claims 107 and 118 remain withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to nonelected species, there being no allowable generic or linking claim. Claims 1-2, 8-10, 14-21, 23-24, 31-34 and 66 are under examination. Claim 1 was amended to incorporate the limitations from canceled claims 11, 12 and 13. The recited linker sequences are more specific than previously in canceled claim 13. The amendment to claim 1 adding the specific linker sequences overcomes all the §102, §103 and nonstatutory double patenting (NSDP) rejections of claim 1 and its dependent claims in the previous office action. The amendment to claim 1 reciting specific SEQ ID NOs for the attB and attP sites overcomes the §112(b) rejection. All the rejections of claim 1 and its dependent claims below are new and necessitated by amendment to claim 1. Claims 31-34 were not amended. The §101, §102 and NSDP rejections over those claims are maintained. Although Applicant argues that claims 31-34 were amended to recite a specific linker sequence (see Remarks page 11), they were not amended. Claims 31-34 do not depend from claim 1. Any other rejection or objection not reiterated herein has been overcome by amendment. Applicant’s amendments and arguments have been thoroughly reviewed, but are not persuasive to place the claims in condition for allowance for the reasons that follow. Claim Objections 07-29-01 AIA Claim s 1 and 66 are objected to because of the following informalities: Claims 1 and 66 appear to be missing the word “end” at the end of the wherein clause reciting various SEQ ID NOs for the attB nucleic acid sequence . Appropriate correction is required. Claim Rejections - 35 USC § 112(b) 07-30-02 AIA The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1-2, 14-21, 23-24, and 66, are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. This is a new rejection. Claim 1 recites “wherein any one of the attB nucleic acid sequences selected from the group consisting of SEQ ID NOs 17, 19… and 47 is truncated by 1 to 32 nucleotides from one or both of the 5’ end and 3’ [end], and wherein any one of the attP nucleic acid sequences selected from the group consisting of SEQ ID NOs 18, 20… and 48 is truncated by 1 to 32 nucleotides from one or both of the 5’ end and 3’ end…” Claim 1 is confusing because each of the recited sequences are 50 nucleotides in length and some are even shorter. For instance, SEQ ID NO 39 is only 31 nucleotides long. It is confusing how a sequence can be shortened by 1-64 nucleotides (i.e., 32 nucleotides from both ends) when it is only 31 or 50 nucleotides long. As such it is not clear what the minimum sequence requirement of the claimed attB and attP sites are. Claims 2, 14-21, 23-24 and 66 are rejected for depending from claim 1 and not remedying the indefiniteness. Claim Rejections - 35 USC § 112(d) 07-36 AIA The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph: Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. 07-36-01 AIA Claim s 8-10 are rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. This is a new rejection. Claims 8-9 recite “wherein the integrase binds to any one of the attB [attP] nucleic acid sequences selected form the group consisting of SEQ ID NOs: 17 [18]…” Claims 8-9 depend from claim 1 which recites that the attB and attP attachment sites are selected from the same SEQ ID NOs “truncated by 1 to 32 nucleotides from one or both of the 5’ end and 3’ end”. Thus, claim 1 requires a truncated attB and attP sites, whereas claims 8-9 require the full length in one of the embodiments. As such, claims 8-9 don’t include all the limitations of the claim from which they depend. Claim 10 also requires the integrase to bind attB and attP sites to comprise the full length SEQ ID NOs. As such, claim 10 doesn’t include all the limitations of the claim from which it depends . Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. Claim Rejections - 35 USC § 112(a) 07-30-01 AIA The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 1-2, 8-10, 14-21, 23-24, 31-34 and 66 rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a maintained rejection. It is modified from the previous rejection to address Applicant’s arguments. MPEP 2163.II.A3.(a).(i) states, “whether the specification shows that applicant was in possession of the claimed invention is not a single, simple determination, but rather is a factual determination reached by considering a number of factors. Factors to be considered in determining whether there is sufficient evidence of possession include the level of skill and knowledge in the art, partial structure, physical and/or chemical properties, functional characteristics alone or coupled with a known or disclosed correlation between structure and function, and the method of making the claimed invention.” For claims drawn to a genus, MPEP 2163.II.A3.(a).(ii) states, “written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species” where “representative number of species' means that the species which are adequately described are representative of the entire genus. Thus, when there is substantial variation within the genus, one must describe a sufficient variety of species to reflect the variation within the genus.” Claims 1 and 66 recite “An integrase of fragment thereof...” “Integrase” is only defined in the Specification as “a bacteriophage derived integrase” (page 26), and the Specification describes an integrase as having the capability of “binding an integration sequence” ([0069]) and “incorporating a nucleic acid at the integration site by integration” ([0074]). In accordance with the definition and description of “integrase” in the specification “An integrase” is interpreted as protein that is derived from a bacteriophage protein and has the function of integrating a nucleic acid into another nucleic acid at an integration sequence. Claim 1 also recites the integrase “comprising an amino acid sequence that is at least 80% identical to an amino acid sequence set forth in any one of SEQ ID NOs 1-16.” According to the specification SEQ ID NOs 1-16 are the amino acid sequences of naturally occurring enzymes from bacteriophages that can bind attB and attP integration sites (Table 2). The SEQ ID NOs range from 401-594 amino acids in length. SEQ ID NOs 1-16 share less than 50% sequence identity to each other, and some share as little as 15% sequence identity (See OA appendix in the 10/8/2026 office action, pages 1-8). As such, the genus of proteins that are 80% identical to one SEQ ID NO does not overlap with the genus of proteins that are 80% identical to another SEQ ID NO. For the smallest SEQ ID NO, the genus of proteins that are 80% identical to the naturally occurring integrase is ~10 189 different proteins. The genus of proteins that are 80% identical to the largest SEQ ID NO is ~10 280 different proteins. Thus, the genus of proteins that are 80% identical to one of SEQ ID NOs 1-16 is vast and structurally diverse given the lack of sequence identity shared between SEQ ID NOs 1-16. Lastly, claims 1 and 66 recite functional language for the integrases: capable of binding attB and attP sites that are truncated from the 5’ and/or 3’ end. This functional language is interpreted as the attB and attP sites are truncated compared to the native integrase-binding attB and attP sequences. For the reasons, described below, Applicant has not sufficiently described the structure of proteins that are 80% identical to SEQ ID NOs 1-16 and that also have the function of integrating a nucleic acid into another nucleic acid at an integration sequence that is truncated from the 5’ and/or 3’ end by 1-32 nucleotides. The Specification provides the sequences of 16 naturally occurring integrases and their integration site sequences (Table 2) and another ~1000 proteins that are predicted to have integrase function that were discovered through mining metagenomic sequence databases (Table 8). The specification does not provide the sequence identity between the amino acid sequences in table 2, which are SEQ ID NOs 1-16, and the amino acid sequences of table 8. However, a cursory review of the sequences of table 8 did not find a sequence that was 80% identical with at least SEQ ID NO 11, the elected integrase. Thus, it appears that none of the sequences in table 8 are within the genus of >10 280 proteins that are 80% identical to SEQ ID NOs 1-16. Of SEQ ID NOs 1-16, Applicant only demonstrates integration function of the Bxb1, Bce integrase, and Sac integrase, which are SEQ ID NOs 8, 11, and 14. Because SEQ ID NOs 1-7, 9-10, 12-13 and 15-16 are the same as the naturally occurring integrase, it is predictable that proteins having 100% identity to the above SEQ ID NOs would also having integration capabilities. However, Applicant does not attempt to engineer any of the naturally occurring integrases using rationale design principles or evolve the integrases to discover integrase variants that may have improved or altered integration activity compared to the native integrase. Additionally, the Specification fails to provide any teaching as to the residues that are critical for site recognition or catalytic activity that would provide a structure-function relationship to guide the skilled artisan as to which of the 80-118 residues could be altered and result in integrases that retain their integration activity. Applicant also discloses an “Integrase Discovery Platform” (pages 354-355) to identify novel integrases. The platform screened metagenomic data to identify possible integrase proteins and their potential attachment sites near phage boundaries (page 354). Applicant found that the naturally occurring integrases fell info found distinct clusters, INTa through INTd (Fig 5). However, Applicant provides no teachings for how to alter or engineer the discovered integrases to determine which amino acid residues are necessary for integration function and which can be altered to improve integration function or to recognize altered attB/P sequences. Accordingly, in view of the Specification, it is was unpredictable which amino acid structures in the claimed genus of >10 280 proteins would retain integration activity and which would not. Stark teaches that one group of DNA site-specific recombinases are serine integrases that are derived from bacteriophages, which were first discovered in the 1990’s ( Current Opinion in Microbiology (2017), 38: 130-136, of record; page 130, ¶2). Stark teaches serine proteases promote recombination between attP and attB attachment sites thus promoting both integration and excision in one direction (page 130, ¶3). Stark teaches that serine integrases are multi-domain proteins of typically greater than 400 amino acids and have a structurally similar 150 amino acid catalytic domain at the N-terminus (page 132, ¶3). Although serine integrases are a very large family, only ~20 systems have been characterized in depth (page 132, ¶4). Stark suggests that serine integrases are easy to find in databases because of the similarity of the N-terminal catalytic domain (page 132, ¶7). However, Stark indicates that only a few attempts have been made to engineer integrases, and does not teach which residues were altered. Sclimenti used directed evolution to improve genomic integration activity of phiC31 integrase (Sclimenti et al., Nucleic Acids Research (2001), 29: 5044-5051, of record). Sclimenti teaches that most of the amino acid changes were in the C-terminal DNA-recognition domain (Figure 3). Sclimenti teaches that a G134P and mutations at residues 2 and 89 resulted in increased catalytic activity. However, phiC31 and SEQ ID NO 11 share less than 22% identity and several of the identified residues in Sclimenti’s study (Supp Table 2) are not conserved (See OA appendix in the previous office action, pages 9-10). Keravala used a variety of mutational tools to engineer phiC31 integrase with higher catalytic activity (Keravala et al., Molecular Therapy (2009), 17: 112-120, of record). Like Sclimenti’s results though, none of the amino acid substitutions discovered in Keravala (Table 1), appear to be conserved between phiC31 and SEQ ID NO 11. Fauser fused variants of the Gin integrase catalytic domain and fused it to zinc finger DNA binding domains (US 20210130828 A1, of record; [0273]). Fauser teaches that F104N and H106Y substitutions in the Gin increased the recombination activity of the catalytic domain (Figure 1). However, neither the F104 or H106 residues are conserved between Gin and SEQ ID NO 11 (See OA appendix in the previous office action, pages 11-12). Therefore, each of Sclimenti’s, Keravala’s, and Fauser’s disclosures fail to provide a sufficient universal structure-function relationship for serine integrases such that the skilled artisan could predict which residues in SEQ ID NOs 1-16 could be altered and still retain integrase activity. A thorough search of the prior art did not provide any reference that engineered SEQ ID NO 11 (i.e., Bxb1 integrase) or any of the other SEQ ID NOs 1-10 and 12-16 to affect their integrase function. Accordingly, in view of the prior art, it is was unpredictable which amino acid structures in the claimed genus of >10 280 proteins would retain integration activity and which would not. In view of the extremely large genus of proteins encompassed by proteins with at least 80% identity to SEQ ID NOs 1-16, the lack of teaching in the Specification and the art regarding which residues in the 400-600-residue proteins can be altered and still retain integrase activity, and a general lack of understanding in the art of the structure-function relationship between the structure of serine integrases and their ability to recognize the attachment site and catalyze excision/integration activities, the skilled artisan would have concluded that Applicant did not possess the genus of proteins with integrase activity as claimed by the effective filing date of the claimed invention. Dependent claims Claim 2 recites “wherein the integrase fragment comprises integrase, recombinase or transposase activity. The analysis above for claim 1 focused on the size of the genus of protein with 80% identity to the full length of each of SEQ ID NO 1-16. However, the size of the genus is even larger than recited above because claim 1 also include “fragments thereof” of SEQ ID NOs 1-16. Claim 2 is interpreted as limited to “fragments thereof” but also requires the fragments to have integrase, recombinase or transposase activity. Because each of the fragments must be derived from SEQ ID NOs 1-16 and only require 80% identity to the fragment of SEQ ID NO 1-16, the fragments of claim 2 lack sufficient written description for the reasons outlined for claim 1. Namely, 1) the genus of fragments of SEQ ID NO 1-16 and with merely at least 80% identity to SEQ ID NO 1-16 is vast – greater than 10 280 proteins or peptides, 2) the Specification does not attempt to engineer/evolve even the full-length proteins of SEQ ID NOs 1-16, and 3) the general lack of understanding in the art of the relationship between the structure of serine integrases and their ability to recognize the attachment site and catalyze excision/integration activities. Claims 8-10, 14-21 and 23-24 do not limit the size of the genus of integrase proteins and are rejected for the same reasons outlined above for claim 1. Regarding claims 31-33 , because the genus of integrase proteins is not sufficiently described, the nucleic acids encoding the integrase proteins with at least 80% identity to SEQ ID NOs 1-16 also lack sufficient written description. Claim 34 recites integrase proteins with at least 80% identity to SEQ ID NOs 1-16 without functional requirement for binding truncated attB and attP sites. For the reasons described above for claim 1, claim 34 also lack sufficient written description. Response to Arguments - §112(a) Applicant argues that their novel repeat algorithm disclosed in the Specification is a strategic method to find and design integrase sequences, and that each of the integrases discovered fell into 4 distinct clades (Remarks, ¶ spanning pages 9-10). This argument has been fully considered but is not persuasive. The algorithm was only used to find integrases. The Specification provides no disclosure for using the algorithm to “design” integrase sequences. The Specification is completely devoid of any attempt to engineer the integrases either by site-directed mutagenesis or continuous evolution screening. The Specification does not provide an amino acid alignment or suggest which residues can be altered to maintain attachment site binding. The only prior art that discloses integrase engineering does so with an integrase that shares very little identity with any of the claimed SEQ ID NOs. As such, it is wholly unknown how to “design” the structure of the naturally occurring integrases that were found using the algorithm. Applicant argues that Applicant showed rational design of other integrases. Applicant sites to evidence in Figure 6A that the 50 base pair sequences that encode the attachment site were compatible with the PASTE system (i.e., Cas9-integrase fusions). Applicant argues that truncating the attachment sites was an “attempt to rationally design the integrases” (page 10, ¶2 and 5). This argument has been fully considered but is not persuasive. Applicant’s cited evidence support engineering/designing the attachment sites (i.e., SEQ ID NOs 17-48), but not for designing the integrases. The §112(a) rejection is for lack of written description of claimed integrase genus (at least 80% identical to SEQ ID NO 1-16) with the recited function. Therefore, the cited evidence lacks sufficient nexus to the rejection. Applicant argues that the Specification discloses testing integrases from the different clades, INTa and INTc, in the PASTE system and testing different linker/RT fusions (page 10, ¶3-4). This argument has been fully considered but is not persuasive because none of the cited evidence provides guidance on how to alter/design the integrase protein itself (i.e., SEQ ID NOs 1-16) to maintain, alter and/or improve its attachment site recognition and integration functions. Claim Rejections - 35 USC § 101 07-04-01 AIA 07-04 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claims 31-33 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a judicial exception (i.e., a law of nature, a natural phenomenon, or an abstract idea) without significantly more. The claims are drawn to integrases, i.e., natural phenomena. However, the claims do not include elements, when considered separately and in combination, that are sufficient to amount to significantly more than the judicial exceptions as outlined below. This is a maintained rejection. Subject Matter Eligibility Test for Products and Processes – Claim 1 Step 1 - Is the Claim to a Process, Machine, Manufacture or Composition of Matter? YES Claim 31 is directed to a polynucleotide comprising a nucleic acid encoding an integrase or fragment thereof. Thus, the claims are directed to a statutory category (e.g., a product). Step 2A, Prong One - Does the Claim Recite an Abstract Idea, Law of Nature, or Natural Phenomenon? YES Judicial exceptions have been identified by the courts by way of example, including natural products. Claim 1 recites 1 judicial exception – an integrase, which is a product of nature. For natural products, products that are not “markedly different” than their naturally occurring counterpart are judicial exceptions. See MPEP 2016.04((b). MPEP 2106.04(c) outlines the markedly different analysis. Claim 31 recites “a polynucleotide comprising a nucleic acid sequence encoding an integrase… comprising an amino acid sequence that is at least 80% identical to an amino acid sequence set forth in any one of SEQ ID NOs 1-16. The Specification teaches that each of SEQ ID NOs 1-16 are integrase proteins isolated from a naturally occurring bacteriophage (Table 2). For instance, SEQ ID NO 11 is the amino acid sequence of the integrase from the Bxb1 phage of Mycobacterium. Indeed, a BLAST search of SEQ ID NO 11 returned the sequence of a natural occurring integrase from the Bxb1 phage (See OA appendix in previous office action, pages 13-15). Thus, the closest naturally occurring counterpart to the claimed polynucleotide integrase is the naturally occurring gene from Mycobacterium phage Bxb1 that encodes the integrase. The claimed polynucleotide is not markedly different than its naturally occurring counterpart and constitutes a judicial exception because they are 100% identical. Step 2A, Prong Two - Does the Claim Recite an Additional Elements that Integrate the Judicial Exception into a Practical Application? NO The Supreme Court has long distinguished between principles themselves, which are not patent eligible, and the integration of those principles into practical applications, which are patent eligible. The phrase "integration into a practical application" requires an additional element or a combination of additional elements in the claim to apply, rely on, or use the judicial exception in a manner that imposes a meaningful limit on the judicial exception, such that it is more than a drafting effort designed to monopolize the exception. In this case, no additional elements are recited that integrates the integrase-encoding polynucleotide into a practical application. Step 2B - Does the Claim Recite Additional Elements that Amount to Significantly More than the Judicial Exception? NO The Supreme Court has identified a number of considerations for determining whether a claim with additional elements amounts to "significantly more" than the judicial exception(s) itself. The claim as a whole is evaluated as to whether it amounts to significantly more than the recited exception, i.e., whether any additional element, or combination of additional elements, adds an inventive concept to the claim (MPEP 2106.05). However, no additional elements are recited in claim 31. Therefore, the claim does not amount to something significantly more than the judicial exception. Subject Matter Eligibility Test for Products and Processes – Dependent Claims Claim 32 recites a vector comprising the nucleic acid sequence of claim 31. The Specification defines “vector” as a recombinant DNA molecule containing a desired coding sequence and appropriate nucleic acid sequences necessary for the expression of the operably linked coding sequence in a host organism.” ([00184]). “Recombinant DNA” is not defined by the Specification and is interpreted as a process whereby various DNA can be attached together, including in ways that are 100% identical to the natural arrangement of DNA in a cell. Because the Bxb1 integrase is expressed in Mycobacteria cells, the DNA encoding it must have “appropriate nucleic acid sequences necessary for the expression” of Bxb1 in Mycobacteria. The naturally occurring Bxb1 gene from the Bxb1 phage is the closest naturally occurring counterpart to the claimed vector. The claimed vector is not markedly different than its naturally occurring counterpart and constitutes a judicial exception because they are identical to each other. Claim 32 does not recite any additional elements that integrate the natural product into a practical application or amount to significantly more than the natural products. Claim 33 recites a host cell comprising the vector of claim 32, which encompasses the naturally occurring Bxb1 gene from the Bxb1 phage. Muttucumaru teaches that Bxb1 mycobacteriophage is a temperate phage which forms stable lysogens following integration into the genome of Mycobacterium smegmatis (Muttucumaru et al., Curr. Issues Mol. Biol. (2004), 6: 145-158, of record; page 148, ¶4). Thus, an M. smegmatis bacterium infected with the Bxb1 phage is the closest naturally occurring counterpart to the claimed host cell. The claimed host cell is not markedly different than its naturally occurring counterpart and constitutes a judicial exception because they are identical to each other. Claim 33 does not recite any additional elements that integrate the natural product into a practical application or amount to significantly more than the natural product. Response to Arguments - §101 Applicant argues that the limitations from claim 13 were incorporated into claim 1, overcoming the §101 rejection (Remarks, page 11). This argument has been fully considered but is not persuasive because claims 31-33 do not depend from claim 1. Claim Rejections - 35 USC § 102 07-07-aia AIA 07-07 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – 07-08-aia AIA (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. 07-12-aia AIA (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. 07-15 AIA Claim 31-33 are rejected under 35 U.S.C. 102( a)(1 ) as being anticipated by Weiss (US 20170211061 A1, published July 27, 2017; of record). This is a maintained rejection . Regarding claim 31, Weiss teaches serine recombinases in table 1, SEQ ID NOs 21-78 mediate site-specific recombination reactions with strictly controlled directionality to integrate DNA, which include Bxb1 ([0101], [0103]). Weiss teaches the amino acid sequence of the Bxb1 integrase is SEQ ID NO 73 (Table 1). SEQ ID NO 73 in Weiss is 100% identical to SEQ ID NO 11 of the examined application (See OA Appendix in previous office action, page 16). Thus, Weiss teaches an integrase with 100% sequence identity with SEQ ID NO 11. Weiss teaches a polynucleotide encoding Bxb1 having SEQ ID NO 73 (Table 1, SEQ ID NO 74). Regarding claims 32-33 , Weiss teaches a vector comprising the coding sequence of Bxb1 ([0111]-[0117]). Weiss teaches transforming the vector into M. smegmatis cells (i.e., a host cell) ([0117]). Response to Arguments - §102 Applicant argues that the limitations from claim 13 were incorporated into claim 1, overcoming the §102 rejection (Remarks, page 11). This argument has been fully considered but is not persuasive because claims 31-33 do not depend from claim 1 . Claim Rejections - 35 USC § 103 07-20-aia AIA The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. 07-20-02-aia AIA This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. 07-21-aia AIA Claim s 1-2, 8-10, 14-21, 23-24, 34 and 66 are rejected under 35 U.S.C. 103 as being unpatentable over Cheng (US 20230295615 A1, priority to at least August 6, 2021; of record), as evidenced by Addgene (Plasmid #51552, pCMV-Bx, https://www.addgene.org/51552/ [retrieved June 2, 2026]), Weiss (US 20170211061 A1, published July 27, 2017; of record), and Singh (Singh et al., PLoS Genetics (2013), 9(5): e1003490; of record), and in view of Zhang (US 20170175144 A1). This is a new rejection . Regarding claims 1 and 18, Cheng teaches prime editing using CRISPR nucleases and reverse transcriptase (RT) to insert Bxb1 integrase attachment sites into genome of cells ([0054]; [0062]). Cheng teaches a composition comprising the Cas9 CRISPR nuclease that is a DNA-binding domain, an RT domain and a Bxb1 integrase (Fig 1A, [0062], [0152]). Cheng teaches a working example of a Cas9-nickase-RT fusion in combination with Bxb1 to integrate a donor DNA ([0294]-[0302]). Cheng teaches a fusion protein (i.e., components linked by a linker) comprising a type II CRISPR-Cas effector enzyme, a reverse transcriptase, and an integrase ([0072], [0222]). Cheng teaches in the fusion protein the functional domains (i.e., the RT and the integrase) are linked to the effector enzyme (i.e., the CRISPR Cas effector DNA-binding domain) “by a linker sequence of appropriate length to provide beneficial orientation and flexibility between the effector enzyme and the functional domains” ([0216]). Cheng teaches the Bxb1 integrase used in the working example was provided on Addgene plasmid #51552 ([0298]). Cheng also teaches Bxb1 attB and attP sites ([0295] and [0297]) which comprise SEQ ID NO 37 and 38. Cheng does not teach the amino acid sequence of Bxb1. Cheng does not teach Bxb1 can bind attB and attP sites that are truncated from SEQ ID NO 37 and 38. Cheng does not teach in a working example Cas9 nickase fused to Bxb1. Cheng does not teach specific linker sequences. Addgene teaches the amino acid sequence of Bxb1, which is 100% identical to SEQ ID NO 11 of the examined application. Thus, Cheng teaches using an integrase with 100% identity to SEQ ID NO 11 with a Cas9 nickase to integrate a donor DNA into a genome sequence. Weiss teaches serine recombinases in table 1, SEQ ID NOs 21-78 mediate site-specific recombination reactions with strictly controlled directionality to integrate DNA, which include Bxb1 ([0101], [0103]). Weiss teaches the amino acid sequence of the Bxb1 integrase is SEQ ID NO 73 (Table 1). SEQ ID NO 73 in Weiss is 100% identical to SEQ ID NO 11 of the examined application (See OA Appendix in 10/8/2025 office action, page 16). Regarding the attP site, Weiss teaches Bxbl can bind an attP site with 100% identity to SEQ ID NO 38. Regarding the attB site, Weiss teaches the sequence of the Bxbl attB site (Fig 4) which consists of SEQ ID NO 37 that is missing 4 nucleotides from the 5' end and 4 nucleotides from the 3' end, as shown below. Thus, Bxb1 is an integrase that inherently can bind to an attB nucleic acid that is SEQ ID NO 37 truncated by 4 nucleotides from both the 5' and 3' ends. Weiss attB: ggcttgtcgacgacggcggtctccgtcgtcaggatcat SEQ ID 37: ggccggcttgtcgacgacggcggtctccgtcgtcaggatcatccgg Singh teaches the attP recognition site for Bxbl, which is 100% identical to SEQ ID NO 38. Singh teaches the minimal binding sequence of the attP site does not include two nucleotides at either end of the sequence (Fig 1B, boxed is minimal sequence). Therefore, the Bxbl integrase protein taught in both Cheng and Weiss inherently could 1) bind attB sequences truncated by 4 nucleotides on each end of SEQ ID NO 37 and 2) bind attP sequence with 2 nucleotide truncations from the 5' and 3' end of SEQ ID NO 38. Zhang teaches genome editing using Cas9 nickases (Title). Zhang teaches Cas9 nickases can be linked to functional domains including integrase domains ([0575]). Zhang teaches linkers used in such Cas9-domain fusions include GlySer linkers ([0575]), including the highly flexible (GGGS) 3 and GGGGS ([0589]). Regarding claims 1, 2 and 18, it would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have used the Bxb1 integrase having SEQ ID NO 11, as taught in both Cheng and Weiss, in the generic Cas9n-RT-Integrase fusion protein taught in Cheng using Zhang’s (GGGS) 3 linker. It would have amounted to the simple combination of known elements by known means to yield predictable results. The skilled artisan would have predicted that the Bxb1 integrase sequence taught in Weiss and Addgene could be used in Cheng’s fusion protein, and been motivated to have done so, because Weiss teaches the Bxb1 protein is capable of site-specific integration between attB and attP sites, which is the purpose of using Cheng’s fusion protein. It also would have entirely predictable to use the (GGGS) 3 linker because Zhang teaches using such a linker to create a fusion protein with a Cas9 nickase and an effector domain such as an integrase. The skilled artisan would have been motivated to specifically use the (GGGS) 3 linker because Cheng suggests using a flexible linker, which is how Zhang characterizes the (GGGS) 3 linker. Regarding claim 8, as indicated above for claim 1, Weiss teaches the sequence of an attB site that Bxbl can bind (Fig 4), which is missing the first four and last four nucleotides from SEQ ID NO 37, resulting in a sequence that is 82% identical to SEQ ID NO 37. Cheng teaches Regarding claim 9, Weiss teaches the sequence of an attP site that Bxbl can bind (Fig 4), which is 100% identical to SEQ ID NO 38. Regarding claim 10, option (k), as indicated above for claims 8-9, Weiss teaches Bxbl can bind an attP site with 100% identity to SEQ ID NO 38. Singh teaches the sequence of the Bxbl integrase attB and attP sites (Fig 1B). Singh teaches an attB recognition sequence that is 100% identical to SEQ ID NO 37, and that the minimal binding sequence does not include the first four and last four nucleotides of the recognition sequence (Fig 1B). Singh teaches that Bxbl can bind the full-length attB recognition sequence that is 100% identical to SEQ ID NO 37 (Fig 5A-B). Therefore, the Bxbl integrase protein taught in Cheng and Weiss and used in the obvious Cas9n-Bxb1-RT fusion protein inherently could bind an attB sequence set forth in SEQ ID NO 37. Regarding claims 14-17 , Cheng teaches the effector domain in the fusion protein is a nicking Cas9 CRISPR effector protein, i.e., the DNA-binding domain is a DNA binding nuclease, an RNA-guided nuclease, a CRISPR nuclease, a Cas9 nuclease ([0181], [0298]). Regarding claim 19 , Cheng teaches the fusion protein can have a CRISPR Cas effector lacking HNH nuclease activity ([0072]). Cheng teaches the fusion protein has a Cas9 nickase having an H840A point mutation in the HNH domain ([0046]; [0180]). Regarding claim 20, as indicated above for claim 30, Cheng teaches a fusion protein (i.e., components linked by a linker) comprising a type II CRISPR-Cas effector enzyme (i.e., a DNA-binding nuclease), a reverse transcriptase, and an integrase ([0072], [0222]). The obviousness of using Addgene’s and Weiss’s specific Bxb1 integrase sequence for the generic Bxb1 integrase in Cheng’s fusion protein is recited above for claim 13. Regarding claims 21 and 23 , Cheng teaches the RT is the MMLV RT from Moloney murine leukemia virus with the D200N, T306K, W313F, T330P and L603W mutations ([0298]). Regarding claim 24 , the Specification does not define or otherwise give examples of a “cleavable linker” versus a “non-cleavable linker”. “A non-cleavable linker” is interpreted as a linker that does break under physiological cellular conditions. Cheng teaches the integrase and the Cas9 are in a “fusion protein”, indicating they are linked by a linker of at least a peptide bond ([0072]), which are known to be maintained under physiological conditions (i.e., a non-cleavable linker). Additionally, the (GGGS) 3 linker taught in Zhang and whose use was rendered obvious above for claim 1, is an amino-acid based linker and therefore interpreted as “non-cleavable”. Regarding claim 34, the obviousness of including Cheng’s and Weiss’s Bxb1 integrase with 100% identity to SEQ ID NO 11 in Cheng’s Cas9-RT-Integrase fusion protein is recited above as for claim 1. Regarding claim 66, the teachings of Cheng, Weiss, Singh and Zhang regarding the functional capabilities of the Bxb1 integrase recognizing truncated attB and attP sites is recited above as for claim 1. The obviousness of including Cheng’s and Weiss’s Bxb1 integrase with 100% identity to SEQ ID NO 11 in Cheng’s Cas9-RT-Integrase fusion protein is recited above as for claim 1. Weiss also teaches methods using integrases to insert genetic sequences into a genome that has the attachment (att) sites ([0076]). Cheng teaches (a) incorporating a Bxb1 attP integration site at a specific location in a genome using (i) Cas9 linked to an RT, such that the target DNA is nicked (i.e., the DNA binding nuclease comprises nickase activity), and (ii) a guide RNA comprising a primer binding sequence linked to the attP integration sequences such that the gRNA targets Cas9 to the genome location and the RT incorporates the attP integration sequences into the genomic location (FIG. 1A; [0062]). Cheng teaches (b) integrating CAGGS-Blast-2A-mScarlet-pA (i.e., a nucleic acid sequence) into the genome at the introduced attP integration sequences by introducing a (i) “Donor” comprising the nucleic acid sequence flanked by attB sequences (i.e., a sequence that is complementary to the integration site) and (ii) a Bxb1 integrase (FIG. 1A; [0062]). Cheng teaches Bxb1 integrates the nucleic acid by integration (FIG. 1A; [0062]). It would have been obvious to one skilled in the art the art before the effective filing date of the claimed invention to have used the Cas9n-RT-Bxb1 fusion protein comprising a (GGGS) 3 linker rendered obvious above, in Cheng’s method to integrate a nucleic acid sequence into a specific genomic location. It would have amounted to substituting a known Bxb1 integrase amino acid sequence for the generic Bxb1 integrase. The skilled artisan would have predicted that the obvious Cas9n-RT-Bxb1 fusion protein could be used in Cheng’s method because both Cheng and Weiss teaches the Bxb1 protein is capable of site-specific integration of a foreign sequence at attP sites in a genome, and Cheng suggests using a Cas9-RT-integrase fusion protein in the method. Response to Arguments - §103 Applicant argues that neither Cheng or Weiss recite the claimed linker sequences (Remarks, page 12, ¶2). This argument has been fully considered and is persuasive. The previous rejection not addressing the linker sequence limitations is withdrawn. However, the claims are still obvious over Cheng in view of Weiss and Zhang for the reasons recited in the §103 rejection above . Double Patenting 08-33 AIA The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg , 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman , 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi , 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum , 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel , 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington , 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA. A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA/25, or PTO/AIA/26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. 08-34 Claims 31-33 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-24 of U.S. Patent No 9691017. Although the claims at issue are not identical, they are not patentably distinct from each other. This is a maintained rejection. Patented claim 1 recites A synthetic logic and memory system operable in a single cell, the system comprising (a) a plurality of engineered nucleic acid sequences encoding at least two inducible promoters and at least two recombinases (i.e., a vector and polynucleotide). Patented claims 2-4 recites wherein the at least two recombinases are irreversible recombinases, serine recombinases, Bxb1. The patented Specification indicates that the Bxb1-encoding nucleic acid sequence is SEQ ID NO 8. Using the standard genetic code, patented SEQ ID NO 8 translates to an amino acid sequence that is 100% identical to SEQ ID NO 11 of the examined application. Thus, as properly construed, patented claim 4 encompasses a polynucleotide encoding an integrase that is at least 80% identical to SEQ ID NO 11 and a vector comprising the polynucleotide. Patented claim 24 recites a cell comprising at least one irreversible recombinase and at least two logic gates of the synthetic logic and memory system of claim 1. Thus, the patented claims anticipate examined claims 31-33. 08-34 Claims 31-33 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-9, 12-14 of U.S. Patent No 10480009. Although the claims at issue are not identical, they are not patentably distinct from each other. This is a maintained rejection. Patented claim 1 recites a system, comprising: (a) n serine recombinases, wherein n is greater than 2; and (b) an engineered nucleic acid comprising n(n−1) pairs of cognate recombination recognition sites (RRS). Patented claim 3 recites wherein the n serine recombinase is selected from Bxb1. Patented claim 5 recites wherein the system further comprises at least one engineered nucleic acid comprising at least one promoter operably linked to a nucleotide sequence encoding at least one of the n serine recombinases (i.e., a vector comprising a polynucleotide). The patented Specification indicates that the Bxb1-encoding nucleic acid sequence is SEQ ID NO 3. Using the standard genetic code, patented SEQ ID NO 3 translates to an amino acid sequence that is 99%% identical to SEQ ID NO 11 of the examined application. Thus, as properly construed, patented claim 3 encompasses an integrase that is at least 80% identical to SEQ ID NO 11 and patented claim 5 encompasses a polynucleotide encoding an integrase that is at least 80% identical to SEQ ID NO 11 and a vector comprising the polynucleotide. The patented Specification indicates that the Bxb1 attB and attP sites are SEQ ID NOs 14-15 (Table 3), which comprise SEQ ID NO 37 and 38, respectively. Thus, as properly construed, the patented Bxb1 integrase has the function of binding to sites with SEQ ID NOs 37-38. Patented claim 12 recites An isolated cell comprising the system of claim 1. Thus, the patented claims anticipate examined claims 1-2, 4, 8-10 and 31-33. 08-34 Claims 31-33 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 4-6 and 14 of U.S. Patent No 10731153. Although the claims at issue are not identical, they are not patentably distinct from each other. This is a maintained rejection. Patented claim 4 recites a method of integrating a plurality of genetic sequences or circuits into an isolated cell, comprising: delivering into the isolated cell of claim 1 a plurality of integrative vectors, each comprising an attP site, one or more genetic sequences or gene cassettes that express components of the genetic circuit, and a promoterless second selectable marker, wherein the isolated cell expresses the large serine recombinase. Patented claim 6 recites wherein the large serine recombinase is selected from the group consisting of: BxB1. Patented claim 14 recites wherein the recombinase is Bxb1 with SEQ ID NO 73, which is 100% identical to SEQ ID NO 11 of the examined application. The patented Specification indicates that Bxb1 is capable of 1) binding to an attP site that is 100% identical to SEQ ID NO 38 of the examined application, and 2) binding to an attB site that is SEQ ID NO 37 truncated by 4 nucleotides from both the 5’ and 3’ end. Additionally, the patented claims recite that the cell expressed the recombinase, which requires that the cell comprise a polynucleotide encoding the recombinase and the genetic elements necessary for expression from the polynucleotide. Thus, as properly construed, the patented claims anticipate the integrase of examined claims 1-2, 4, 8-9, 11 and 31-33. 08-36 AIA Claim s 1-2, 8-10, 14-21, 23-24, 31-34 and 66 are rejected on the ground of nonstatutory double patenting as being unpatentable over claim s 1-21 of U.S. Patent No. 11572556 . Claims 1-2, 8-10, 14-21, 23-24, 34 and 66 are rejected in view of Cheng (US 20230295615 A1, priority to at least August 6, 2021) and Singh (Singh et al., PLoS Genetics (2013), 9(5): e1003490) and Zhang (US 20170175144 A1). This is a new rejection necessitated by amendment of claims 1-2, 8-10, 14-21, 23-24, 34 and 66. It is a maintained rejection of claims 31-33 . Patented claim 1 recites A method of site-specifically integrating an exogenous nucleic acid sequence into a mammalian cell genome or intracellular target nucleic acid, the method comprising: (a) incorporating at least one integration sequence at a specific target site in the cell genome or intracellular target nucleic acid by introducing ex vivo into a mammalian cell: (i) an expressible polynucleotide construct encoding an editing polypeptide, wherein the editing polypeptide comprises a DNA binding nuclease domain linked via a linker to a reverse transcriptase domain, wherein the DNA binding nuclease domain comprises a nickase activity; and (ii) a guide RNA (gRNA) comprising a targeting sequence, a primer binding sequence, and a complement of the at least one integration sequence, wherein the gRNA interacts with the expressed editing polypeptide to target direct the editing polypeptide to the specific target site of the cell genome or intracellular target nucleic acid, wherein the DNA binding nuclease domain nicks a strand of the cell genome or intracellular target nucleic acid to form a nicked site, and wherein the reverse transcriptase domain reverse transcribes the complement of the at least one integration sequence within the gRNA and thereby incorporates the at least one integration sequence into the nicked site, thereby incorporating the at least one integration sequence at the specific target site of the cell genome or intracellular target nucleic acid; and (b) integrating an exogenous nucleic acid sequence into the cell genome or intracellular target nucleic acid by introducing into the cell: (i) the exogenous nucleic acid sequence linked to a sequence that is an integration cognate to the site-specifically incorporated-integration sequence; and (ii) an expressible polynucleotide construct encoding an integration enzyme, wherein the integration enzyme integrates the exogenous nucleic acid sequence into the cell genome or the intracellular target nucleic acid at the at least one site-specifically incorporated integration sequence, thereby site-specifically integrating the exogenous nucleic acid sequence into the cell genome or the intracellular target nucleic acid. Patented claims 7-8 recites wherein the linker is cleavable and non-cleavable, respectively. Patented claim 10 recites wherein the integration enzyme is Bxb1. Patented claim 11 recites wherein the integration sequence is an attB sequence and an attP sequence. Patented claim 12 recites wherein the DNA binding nuclease domain comprising a nickase activity is selected from Cas9-D10A, Cas9-H840A, and Cas12a/b nickase. Patented claim 14-15 recite wherein the reverse transcriptase domain is selected from the group consisting of Moloney Murine Leukemia Virus (M-MLV) reverse transcriptase domain comprising one or more mutations selected from the group consisting of D200N, T306K, W313F, T3301P, and L603W. The patent Specification indicates that the amino acid sequence of the Bxb1 integrase is SEQ ID NO 380 (Table 11), which is 99% identical to SEQ ID NO 11 of the instant specification . Therefore, the patented claims anticipate claims 31-33. The patented claims do not recite specific sequence for the Bxb1 attB and attP binding sites or that the integrases recognize truncated attB and attP sites. The patented claims do not recite that the integrase is in a fusion protein or somehow associated with the DNA-binding domain. The patented claims do not recite a linker sequence. Singh teaches the sequence of the Bxb1 Integrase attB and attP sites (Fig 1B). Singh teaches an attB recognition sequence that is 100% identical to SEQ ID NO 37, and that the minimal binding sequence does not include the first four and last four nucleotides of the recognition sequence (Fig 1B). Singh teaches that Bxb1 can bind the full-length attB recognition sequence that is 100% identical to SEQ ID NO 37 (Fig 5A-B). Singh teaches the attP recognition site for Bxb1, which is 100% identical to SEQ ID NO 38. Singh teaches the minimal binding sequence of the attP site does not include two nucleotides at either end of the sequence (Fig 1B, boxed is minimal sequence). Regarding the function of the patented integrase, it would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have claimed the Bxb1 integrase with the function of binding to attB and attP sites have smaller sequences than the native recognition sequences because Singh teaches that the attB and attP sequences do not require the 5’ and 3’ terminal nucleotides for binding. Thus, the patented Bxb1 integrase still as the function claimed in claims 8-12. Regarding claims 1-2, 8-10, 14-21, 23-24, 34 and 66, Cheng teaches prime editing using CRISPR nucleases and reverse transcriptase (RT) to insert Bxb1 integrase attachment sites into genome of cells ([0054]; [0062]). Cheng teaches a composition comprising the Cas9 CRISPR nuclease that is a DNA-binding domain, an RT domain and a Bxb1 integrase (Fig 1A, [0062]). Cheng teaches a fusion protein (i.e., components linked by a linker) comprising a type II CRISPR-Cas effector enzyme (i.e., a DNA-binding protein), a reverse transcriptase, and an integrase ([0072], [0222]). Cheng teaches the integrase can be Bxb1 ([0152]). Cheng teaches in the fusion protein the functional domains (i.e., the RT and the integrase) are linked to the effector enzyme (i.e., the CRISPR Cas effector DNA-binding domain) “by a linker sequence of appropriate length to provide beneficial orientation and flexibility between the effector enzyme and the functional domains” ([0216]). Cheng teaches the Bxb1 attB binding sites is SEQ ID NO 1 ([0295]), which comprises SEQ ID NO 37. Cheng teaches the Bxb1 attP binding site is SEQ ID NO 4 ([0297]), which comprises SEQ ID NO 38. Zhang teaches genome editing using Cas9 nickases (Title). Zhang teaches Cas9 nickases can be linked to functional domains including integrase domains ([0575]). Zhang teaches linkers used in such Cas9-domain fusions include GlySer linkers ([0575]), including the highly flexible (GGGS) 3 and GGGGS ([0589]). It would have been obvious to one skilled in the art the before the effective filing date of the claimed invention to have modified the patented method by linking the Bxb1 integrase to the Cas9-RT complex as taught in Cheng with the (GGGS) 3 linker of Zhang. It would have amounted to the simple combination of elements by known means to yield predictable results. The skilled artisan would have predicted that the claimed Cas9, RT and Bxb1 could be fused together because Cheng teaches such a fusion protein. One would have been motivated to do so to increase co-localization of the complex at the desired integration site. It also would have entirely predictable to use the (GGGS) 3 linker because Zhang teaches using such a linker to create a fusion protein with a Cas9 nickase and an effector domain such as an integrase. The skilled artisan would have been motivated to specifically use the (GGGS) 3 linker because Cheng suggests using a flexible linker in a Cas9-effector fusion protein, which is how Zhang characterizes the (GGGS) 3 linker . 08-34 Claims 31-32 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-23 of U.S. Patent No 11827881. Although the claims at issue are not identical, they are not patentably distinct from each other. This is a maintained rejection. Patented claim 1 recites a system capable of site-specifically integrating an exogenous nucleic acid into a mammalian cell genome at a desired target site, wherein the system comprises, in a single composition: (a) a nucleic acid encoding a DNA binding nickase domain linked to a reverse transcriptase domain; (b) a nucleic acid encoding a guide RNA (gRNA) comprising…, (c) a nucleic acid encoding an integration enzyme; and (d) an exogenous nucleic acid linked to a sequence that is an integration cognate of the integration recognition sequence. Patented claims 13 and 14 recite wherein the integration enzyme is Bxb1. Patented claim 23 recites wherein the nucleic acids are incorporated into one or more adenoviral vector genomes. The patent Specification indicates that the amino acid sequence of the Bxb1 integrase is SEQ ID NO 380 (Table 11), which is 99% identical to SEQ ID NO 11 of the instant specification . Thus, as properly construed the patented claims anticipate examined claims 31-32. 08-36 AIA Claim s 1-2, 8-10, 14-21, 23-24, 31-34 and 66 are rejected on the ground of nonstatutory double patenting as being unpatentable over claim s 1-21 of U.S. Patent No. 11834658 . Claims 1-2, 8-10, 14-21, 23-24, 34 and 66 are rejected in view of Cheng (US 20230295615 A1, priority to at least August 6, 2021) and Singh (Singh et al., PLoS Genetics (2013), 9(5): e1003490) and Zhang (US 20170175144 A1). This is a new rejection, necessitated by amendment, of claims 1-2, 8-10, 14-21, 23-24, 34 and 66. It is a maintained rejection of claims 31-33 . Patented claim 1 recites A method of site-specifically integrating an exogenous nucleic acid sequence into a mammalian cell genome or intracellular target nucleic acid, the method comprising: (a) incorporating at least one integration sequence at a specific target site in the cell genome or intracellular target nucleic acid by introducing ex vivo into a mammalian cell: (i) an expressible polynucleotide construct encoding an editing polypeptide, wherein the editing polypeptide comprises a DNA binding nuclease domain linked via a linker to a reverse transcriptase domain, wherein the DNA binding nuclease domain comprises a nickase activity; and (ii) at least two guide RNAs (gRNAs), each comprising a targeting sequence, a primer binding sequence, and a complement of the at least one integration sequence… wherein the DNA binding nuclease domain nicks a strand of the cell genome or intracellular target nucleic acid to form a nicked site, and wherein the reverse transcriptase domain reverse transcribes the complement of the at least one integration sequence within each of the gRNAs and thereby incorporates the at least one integration sequence into the nicked site, thereby incorporating the at least one integration sequence at the specific target site of the cell genome or intracellular target nucleic acid; and (b) integrating an exogenous nucleic acid sequence into the cell genome or intracellular target nucleic acid by introducing into the cell: (i) the exogenous nucleic acid sequence linked to a sequence that is an integration cognate to the at least one site-specifically incorporated-integration sequence; and (ii) an expressible polynucleotide construct encoding an integration enzyme, wherein the integration enzyme integrates the exogenous nucleic acid sequence into the cell genome or the intracellular target nucleic acid at the at least one site-specifically incorporated integration sequence, thereby site-specifically integrating the exogenous nucleic acid sequence into the cell genome or the intracellular target nucleic acid. Patented claims 7-8 recite wherein the linker is cleavable or non-cleavable. Patented claim 9 recites wherein the linker is two associating binding domains of the DNA binding nuclease linked to a reverse transcriptase. Patented claim 10 recites wherein the integration enzyme is Bxb1. Patented claim 11 recites wherein the integration sequence is an attB or attP sequence. Patented claim 12 recites wherein the DNA binding nuclease domain comprising a nickase activity is selected from Cas9-D10A, Cas9-H840A, and Cas12a/b nickase. Patented claims 14-15 recite wherein the reverse transcriptase domain is selected from the group consisting of Moloney Murine Leukemia Virus (M-MLV) reverse transcriptase domain [comprising] one or more mutations selected from the group consisting of D200N, T306K, W313F, T330P, and L603W. The patent Specification indicates that the amino acid sequence of the Bxb1 integrase is SEQ ID NO 380 (Table 11), which is 99% identical to SEQ ID NO 11 of the instant specification . Thus, as properly construed the patented claims anticipate examined claims 31-33. The patented claims do not recite specific sequence for the Bxb1 attB and attP binding sites or that the integrases recognize truncated attB and attP sites. The patented claims do not recite that the integrase is in a fusion protein or somehow associated with the DNA-binding domain. The patented claims do not recite a linker sequence. Regarding the functional limitations of the patented Bxb1 integrase, the teachings of Singh are recited above in paragraph 85. The obviousness of including a known function of the Bxb1 enzyme in the patented claims is recited above in paragraph 85. Regarding claims 1-2, 8-10, 14-21, 23-24, 34 and 66, the teachings of Cheng and Zhang are recited above in paragraph 87 and 88. The obviousness of having modified the patented method by linking the Bxb1 integrase to the patented Cas9-RT complex as taught in Cheng using the (GSSS) 3 linker is recited above in paragraph 89 . 08-34 Claims 31-33 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-23 of U.S. Patent No 11952571. Although the claims at issue are not identical, they are not patentably distinct from each other. This is maintained rejection. A system capable of site-specifically integrating an exogenous nucleic acid into a mammalian cell genome at a desired target site, wherein the system comprises, in a single composition: (a) a nucleic acid encoding a DNA binding nickase domain linked to a reverse transcriptase domain; (b) a nucleic acid encoding a guide RNA (gRNA) comprising…, (c) a nucleic acid encoding an integration enzyme; and (d) an exogenous nucleic acid linked to a sequence that is an integration cognate of the integration recognition sequence. Patented claims 13 and 14 recite wherein the integration enzyme is Bxb1. Patented claim 23 recites wherein the nucleic acids are introduced into the mammalian cell in an AAV or adenoviral vector genomes. The patent Specification indicates that the amino acid sequence of the Bxb1 integrase is SEQ ID NO 380 (Table 11), which is 99% identical to SEQ ID NO 11 of the instant specification . Thus, as properly construed the patented claims anticipate examined claims 31-32. Regarding claim 33, it would have been obvious to include the patented into a mammalian cell because patented claim 23 indicates that is the intended use of the patented vector. 08-36 AIA Claim s 1-2, 4, 8-10, 14-21, 23-24, 31-34 and 66 are rejected on the ground of nonstatutory double patenting as being unpatentable over claim s 1-23 of U.S. Patent No 12195733. Claims 1-2, 8-10, 14-21, 23-24, 34 and 66 are rejected in view of Singh (Singh et al., PLoS Genetics (2013), 9(5): e1003490). This is a maintained rejection . Patented claim 1 recites a system capable of site-specifically integrating an exogenous nucleic acid into a mammalian cell genome at a desired target site, wherein the system comprises, concurrently within the mammalian cell: (a) a nucleic acid encoding a DNA binding nickase domain linked to a reverse transcriptase domain, wherein the linked nickase-RT domains are further linked to a serine integration enzyme via a linker selected from P2A, (GGGS) 3 , GGGGS, PAPAP, (EAAAK) 3 , XTEN, (GGS) 6 , and EAAAK; (b) a guide RNA,… wherein the gRNA is capable of guiding the linked nickase-reverse transcriptase domains to the genomic target site; (c) an exogenous nucleic acid linked to a sequence that is an integration cognate of the integration recognition sequence, whereby the system site specifically integrates the exogenous nucleic acid into the mammalian cell genome at the desired target site. Patented claim 5 recites wherein the DNA binding nickase domain is selected from Cas9-D10A, Cas9-H840A, and Cas12a/b nickase. Patented claim 6-6 recite, wherein the reverse transcriptase domain is selected from the group consisting of Moloney Murine Leukemia Virus (M-MLV) reverse transcriptase domain [comprising] one or more mutations selected from the group consisting of D200N, T306K, W313F, T330P, and L603W. Patented claims 12-13 recite wherein the serine integration enzyme is Bxb1. Patented claim 20 recites wherein (a)-(c) are introduced into the mammalian cell as an adeno-associated virus (AAV) or an adenovirus (AdV) (i.e., the polynucleotide encoding Bxb1 comprised in a vector, which is within a cell). The patented Specification indicates that the Bxb1 integrase has SEQ ID NO 380 (Table 11), which is 99% identical to SEQ ID NO 11. Thus, as properly construed, the patented claims anticipate examined claims 31-32 . The patented claims do not recite a method of genome integration. The patented claims do not recite specific sequence for the Bxb1 attB and attP binding sites or truncations of known attB or attP binding sites. Regarding claims 1-2, 8-10, 14-21, 23-24, 33-34 and 66, the teachings of Singh are recited above in paragraph 85. The obviousness of including a known function of the Bxb1 enzyme in the patented claims is recited above in paragraph 85. It would have been obvious to use the patented system comprising nucleic acids to integrate an exogenous nucleic acid into the genome of a cell because the patented claims recite such active/functional steps for the nucleic acids . 08-37 AIA Claim s 1-2, 8-10 and 14-21, 23-24, 34 and 66 provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 87-91, 95, 99-106, 109-111, 114-119, 120-122 and 134 of copending Application No. 18067214 in view of Singh (Singh et al., PLoS Genetics (2013), 9(5): e1003490) and Zhang (US 20170175144 A1). This is a new rejection, necessitated by amendment. Copending claim 87 recites A complex for genome editing comprising: (i) an RNA-guided nuclease; (ii) a fusion protein comprising a reverse transcriptase domain linked to a nucleic acid binding protein; and (iii) at least one guide RNA (gRNA) comprising a 5' end and a 3' end and comprising at least one protein-recruiting stem-loop nucleic acid sequence, wherein the protein-recruiting stem-loop nucleic acid sequence binds to the nucleic acid binding protein. Copending claim 110 recites wherein one or both of the RNA- guided nuclease and fusion protein are linked to an integration enzyme or fragment thereof. Copending claims 111 and 114 recites wherein the integration enzyme is Bxb1 and has an amino acid sequence that is at least 90% identical to an amino acid sequence set forth in any one of SEQ ID NOs: 1-16. Copending SEQ ID NOs 1-16 are 100% identical to SEQ ID NOs 1-16 of the instant application. Copending claim 119 recites wherein the attB and/or attP nucleic acid sequence comprises one or more truncations. Copending claim 120 recites wherein the integration enzyme binds to any one of the attB nucleic acid sequences selected from the group consisting of SEQ ID NOs: 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, and 47, which are 100% identical to the same SEQ ID NOs of the examined application. Copending claim 121 recites wherein the integration enzyme binds to any one of the attP nucleic acid sequences selected from the group consisting of SEQ ID NOs: 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, and 48, which are 100% identical to the same SEQ ID NOs of the examined application. Copending claim 99-102 recites wherein the RNA-guided nuclease comprises a CRISPR nuclease, that is Cas9 or Cas 12, comprises nickase activity and is selected from Cas9-D10A, Cas9-H840A, and Cas12a/b nickase. Copending claims 103 and 105 recite wherein the reverse transcriptase domain is selected from the group consisting of Moloney Murine Leukemia Virus (M-MLV) reverse transcriptase domain [comprising] one or more mutations selected from the group consisting of D200N, T306K, W313F, T330P, L603W, and L139P. Copending claim 106 recites Copending claim 134 recites A method of site-specific integration of a nucleic acid into a cell genome, the method comprising: (a) incorporating an integration site at a desired location in the cell genome by introducing into the cell: i. an RNA-guided nuclease comprising a nickase activity; ii. a fusion protein comprising a reverse transcriptase domain linked to a nucleic acid binding protein; and iii. a guide RNA (gRNA)… wherein the gRNA interacts with the RNA-guided nuclease and targets the desired location in the cell genome, wherein the RNA-guided nuclease nicks a strand of the cell genome and the reverse transcriptase domain incorporates the integration sequence of the gRNA into the nicked site, thereby providing the integration site at the desired location of the cell genome; and (b) integrating the nucleic acid into the cell genome by introducing into the cell: i. a DNA or RNA strand comprising the nucleic acid linked to a sequence that is complementary or associated to the integration site; and ii. an integration enzyme or fragment thereof, wherein the integration enzyme or fragment thereof incorporates the nucleic acid into the cell genome at the integration site by integration, recombination, or reverse transcription of the sequence that is complementary or associated to the integration site, thereby introducing the nucleic acid into the desired location of the cell genome of the cell. The copending claims do not recite truncated sequences for the Bxb1 attB and attP binding sites. The copending claims do not recite specific means for linking the integrase to the RNA-guided nuclease. Regarding the functional limitations of the patented Bxb1 integrase, the teachings of Singh are recited above in paragraph 85. The obviousness of including a known function of the Bxb1 enzyme in the patented claims is recited above in paragraph 85. Regarding claims 1-2, 8-10, 14-21, 23-24, 34 and 66, the teachings Zhang are recited above in paragraph 88. The obviousness of having modified the patented method by linking the Bxb1 integrase to the patented Cas9-RT complex as taught in Cheng using the (GSSS) 3 linker is recited above in paragraph 89 . This is a provisional nonstatutory double patenting rejection. 08-37 AIA Claim s 1-2, 8-10, 14-21, 23-24, 34 and 66 provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 1, 3, 5-7, 10-12, 19, 21-24, 27-30, 32 and 36-37 of copending Application No. 18303527 in view of Singh (Singh et al., PLoS Genetics (2013), 9(5): e1003490) and Zhang (US 20170175144 A1). This is a new rejection, necessitated by amendment. Copending claim 1 recites A composition comprising a DNA binding nickase, an a reverse transcriptase (RT), an integration enzyme that is an integrase, and a guide RNA pair comprising a first heterologous gRNA and a second heterologous gRNA, each comprising a spacer sequence, a scaffold sequence, a reverse transcription template sequence that comprises at least a portion of an at least integration recognition sequence; a primer binding sequence, wherein the first heterologous RNA and the second heterologous RNA collectively encode the entirety of the integration recognition sequence, wherein the DNA binding nickase, the RT and the integrase enzyme are linked via a linker. Copending claim 22 recites wherein the DNA binding nickase is a Cas9- D10A, a Cas9-H840A, a Cas12a nickase, or a Cas12b nickase. Copending claims 23 and 27 recite wherein the reverse transcriptase is derived from Moloney Murine Leukemia Virus (M-MLV) reverse transcriptase [comprising] one or more of the mutations selected from the group consisting of D200N, T306K, W313F, T330P, and L603W. Copending claim 30 recites wherein the integration enzyme is Bxb1. Copending claim 32 recites wherein the integration sequence is an attB sequence, an attP sequence. Copending claim 36 recites wherein said DNA binding nickase is a Cas9-H840A. Copending claim 37 recites A method of site-specifically integrating an exogenous nucleic acid into a cell genome, the method comprising:(a) incorporating an integration sequence at a target location in the cell genome by introducing into a cell: i. a DNA binding nickase or a functional fragment or variant thereof; ii. a reverse transcriptase (RT) or a functional fragment or variant thereof; and iii. a guide RNA (gRNA) pair comprising: a first heterologous gRNA or functional fragments and a second heterologous gRNA, each comprising: a spacer sequence, a scaffold sequence, a reverse transcription template sequence that comprises at least a portion of a first integration recognition sequence; a primer binding sequence wherein: the first and second heterologous gRNAs interact with the DNA binding nickase and target the target location in the cell genome, the DNA binding nickase nicks a strand of the cell genome, and the reverse transcriptase reverse transcribes (i) the first reverse transcription template sequence into a first extended sequence that encodes the at least first portion of the first integration recognition sequence and (ii) the second reverse transcription template sequence into a second extended sequence that encodes the at least second portion of the first integration recognition sequence, wherein annealing of the complementary nucleotides forms a duplex which results in the insertion of the at least first integration recognition sequence into the target location; and (b) integrating the nucleic acid into the cell genome by introducing into the cell: i. a DNA or RNA strand comprising the nucleic acid linked to a sequence that is complementary or associated to the integration sequence; and ii. an integration enzyme consisting of an integrase, a recombinase, and a reverse transcriptase… thereby introducing the nucleic acid into the target location of the cell genome of the cell. The copending Specification indicates that the amino acid sequence of the Bxb1 integrase is SEQ ID NO 405 (Table 8), which is 99% identical to SEQ ID NO 11 of the examined application. Thus, as properly construed, the copending claims anticipate examined claims 1-2, 4 and 66. The copending claims do not recite specific sequence for the Bxb1 attB and attP binding sites or truncations of binding sites. The copending claims do not recite a specific means for linking the Cas9 and integrase. Regarding the functional limitations of the patented Bxb1 integrase, the teachings of Singh are recited above in paragraph 85. The obviousness of including a known function of the Bxb1 enzyme in the patented claims is recited above in paragraph 85. Regarding claims 1-2, 8-10, 14-21, 23-24, 34 and 66, the teachings Zhang are recited above in paragraph 88. The obviousness of having modified the copending method by linking the Bxb1 integrase to Cas9 using the linker of Zhang is recited above in paragraph 89 . This is a provisional nonstatutory double patenting rejection. 08-37 AIA Claim s 1-2, 8-10, 14-21, 23-24, 31-34 and 66 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim s 1, 5, 7-9, 18-19, 21, 30, 35, 46-48, 52-54, 58, 68, 72-73 of copending Application No. 18303533. Claims 1-2, 8-10, 14-21, 23-24, 32-33 and 66 are rejected in view of Singh (Singh et al., PLoS Genetics (2013), 9(5): e1003490) and Zhang (US 20170175144 A1). This is a new rejection, necessitated by amendment. Copending claim 1 recites an editing polypeptide that comprises (i) a DNA binding nickase, (ii) a reverse transcriptase, (iii) an aptamer binding protein, and (iv) an integrase; wherein each of said DNA binding nickase, reverse transcriptase, aptamer binding protein, and integrase, are each operably connected in any order by a linker. Copending claim 8 recites wherein said DNA binding nickase is a Cas9-D10A, a Cas9-H840A, a Cas12a nickase, or a Cas12b nickase, or a functional fragment or variant thereof. Copending claim 9 recites wherein said reverse transcriptase is derived from a Moloney Murine Leukemia Virus (M-MLV) reverse transcriptase domain. The copending Specification indicates that the M-MLV derived RT has D200N, T306K, T330P,L603W and W313F mutations relative to wild type. The Copending claim 7 recites wherein said integrase is Bxb1. The copending specification indicates that the Bxb1 integrase has an amino acid sequence of SEQ ID NO 12 (Table 5), which is 99% identical to SEQ ID NO 11 of the examined application. Thus as properly construed, the copending claims anticipate examined claims 31 and 34. Copending claim 30 recites a composition comprising a polynucleotide encoding [the polypeptide of claim 1] and a trans-template RNA (ttRNA) comprising (i) a primer binding site, (ii) a reverse transcription template sequence that comprises an integration recognition sequence, and (iii) at least one aptamer; and (c) at least one targeting guide RNA (gRNA) comprising:(i) a spacer and (ii) a scaffold. Copending claim 72 recites A method of site-specifically integrating a polynucleotide of interest into a target dsDNA polynucleotide in a cell, the method comprising: (1) incorporating an integration recognition sequence into a target location in said target dsDNA polynucleotide by contacting said target dsDNA polynucleotide with: (a) an editing polypeptide [of claim 1], (b) a targeting guide RNA (gRNA) comprising (i) a spacer and (ii) a scaffold; and(c) a trans-template RNA (ttRNA) comprising (i) a primer binding site, (ii) a reverse transcription template sequence that comprises an integration recognition sequence , and (iii) an aptamer; wherein said editing polypeptide's DNA binding nickase nicks a strand of said target dsDNA polynucleotide, and said reverse transcriptase reverse transcribes the reverse transcription template sequence into an extended sequence that encodes the first integration recognition sequence or a complement thereof and the extended sequence is incorporated; and (2) integrating said polynucleotide of interest into said target dsDNA polynucleotide, by contacting said target dsDNA polynucleotide with a polynucleotide that comprises said polynucleotide of interest operably connected to a polynucleotide that comprises a sequence complementary or associated to said integration recognition sequence; wherein said integrase incorporates said polynucleotide of interest into said target dsDNA polynucleotide by integration of said sequence that is complementary or associated to said integration recognition sequence to thereby site-specifically integrate said polynucleotide of interest into said target dsDNA polynucleotide. The copending claims do not recite specific sequence for the Bxb1 attB and attP binding sites or truncations thereof. The copending claims do not recite the copending polynucleotide in a cell comprised in a vector. The copending claims do not recite a specific linker sequence to connect the DNA binding nickase and an integrase. Regarding the functional limitations of the patented Bxb1 integrase, the teachings of Singh are recited above in paragraph 85. The obviousness of including a known function of the Bxb1 enzyme in the patented claims is recited above in paragraph 85. Regarding claims 32-33, it would have been obvious to one skilled in the art to have modified the copending method of integrating a polynucleotide of interest in a cell by introducing the fusion polypeptide into the cell as a vector comprising the copending polynucleotide that encodes it. It would have amounted to introducing editing complexes into cells by known means to yield predictable results. The skilled artisan would have predicted that the copending method could be modified as such and been motivated to do it since delivering expression cassettes encoding gene editing polypeptides is well known in the art. Regarding claims 1-2, 8-10, 14-21, 23-24 and 66, the teachings Zhang are recited above in paragraph 88. The obviousness of having modified the copending method by linking the Bxb1 integrase to Cas9 using the linker of Zhang is recited above in paragraph 89 . This is a provisional nonstatutory double patenting rejection. Claims 31-33 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 92-118 of copending Application No. 18962390 . This is a maintained rejection. Copending claim 92 recites a nucleic acid encoding a serine integration enzyme. Copending claims 104-105 recite wherein the integration enzyme is Bxb1. Copending claim 92 recites wherein [the nucleic acid encoding the serine integration enzyme] are introduced into the mammalian cell as an adeno-associated virus (AAV) or an adenovirus (AdV) (i.e., a vector). The copending Specification indicates that the amino acid sequence of the Bxb1 integrase is SEQ ID NO 380 (Table 11), which is 99% identical to SEQ ID NO 11 of the instant specification . Thus, as properly construed the copending claims anticipate examined claims 31-32. Regarding claim 33, it would have been obvious to include the copending vector into a mammalian cell because copending claim 112 indicates that is the intended use of the copending vector. This is a provisional nonstatutory double patenting rejection. Response to Arguments – NSDP Applicant indicates that upon a finding of allowability for the claims herein, a terminal disclaimer will be filed if appropriate (Remarks, pages 12-14). Because the claims are not in condition for allowance, and no terminal disclaimers have been filed, the nonstatutory double patenting rejections remain on the record as maintained or modified, as necessitated by amendment. Conclusion No claims are allowable. Any inquiry concerning this communication or earlier communications from the examiner should be directed to CATHERINE KONOPKA whose telephone number is (571)272-0330. The examiner can normally be reached Mon - Fri 7- 4. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /CATHERINE KONOPKA/Primary Examiner, Art Unit 1635 Application/Control Number: 18/048,238 Page 2 Art Unit: 1635 Application/Control Number: 18/048,238 Page 3 Art Unit: 1635 Application/Control Number: 18/048,238 Page 5 Art Unit: 1635 Application/Control Number: 18/048,238 Page 6 Art Unit: 1635 Application/Control Number: 18/048,238 Page 8 Art Unit: 1635 Application/Control Number: 18/048,238 Page 9 Art Unit: 1635 Application/Control Number: 18/048,238 Page 10 Art Unit: 1635 Application/Control Number: 18/048,238 Page 11 Art Unit: 1635 Application/Control Number: 18/048,238 Page 12 Art Unit: 1635 Application/Control Number: 18/048,238 Page 13 Art Unit: 1635 Application/Control Number: 18/048,238 Page 14 Art Unit: 1635 Application/Control Number: 18/048,238 Page 15 Art Unit: 1635 Application/Control Number: 18/048,238 Page 16 Art Unit: 1635 Application/Control Number: 18/048,238 Page 17 Art Unit: 1635 Application/Control Number: 18/048,238 Page 18 Art Unit: 1635 Application/Control Number: 18/048,238 Page 19 Art Unit: 1635 Application/Control Number: 18/048,238 Page 20 Art Unit: 1635 Application/Control Number: 18/048,238 Page 21 Art Unit: 1635 Application/Control Number: 18/048,238 Page 22 Art Unit: 1635 Application/Control Number: 18/048,238 Page 23 Art Unit: 1635 Application/Control Number: 18/048,238 Page 25 Art Unit: 1635 Application/Control Number: 18/048,238 Page 26 Art Unit: 1635 Application/Control Number: 18/048,238 Page 27 Art Unit: 1635 Application/Control Number: 18/048,238 Page 28 Art Unit: 1635 Application/Control Number: 18/048,238 Page 29 Art Unit: 1635 Application/Control Number: 18/048,238 Page 30 Art Unit: 1635 Application/Control Number: 18/048,238 Page 32 Art Unit: 1635 Application/Control Number: 18/048,238 Page 33 Art Unit: 1635 Application/Control Number: 18/048,238 Page 34 Art Unit: 1635 Application/Control Number: 18/048,238 Page 35 Art Unit: 1635 Application/Control Number: 18/048,238 Page 36 Art Unit: 1635 Application/Control Number: 18/048,238 Page 37 Art Unit: 1635 Application/Control Number: 18/048,238 Page 38 Art Unit: 1635 Application/Control Number: 18/048,238 Page 40 Art Unit: 1635
Prosecution Insights