Prosecution Insights
Last updated: April 19, 2026
Application No. 18/048,577

RNAi Agents for Inhibiting Expression of Matrix Metalloproteinase 7 (MMP7), Compositions Thereof, and Methods of Use

Final Rejection §103§DP
Filed
Oct 21, 2022
Examiner
VANHORN, ABIGAIL LOUISE
Art Unit
1636
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Arrowhead Pharmaceuticals, Inc.
OA Round
2 (Final)
47%
Grant Probability
Moderate
3-4
OA Rounds
3y 7m
To Grant
69%
With Interview

Examiner Intelligence

Grants 47% of resolved cases
47%
Career Allow Rate
557 granted / 1191 resolved
-13.2% vs TC avg
Strong +22% interview lift
Without
With
+21.9%
Interview Lift
resolved cases with interview
Typical timeline
3y 7m
Avg Prosecution
78 currently pending
Career history
1269
Total Applications
across all art units

Statute-Specific Performance

§101
1.1%
-38.9% vs TC avg
§103
42.6%
+2.6% vs TC avg
§102
9.9%
-30.1% vs TC avg
§112
23.1%
-16.9% vs TC avg
Black line = Tech Center average estimate • Based on career data from 1191 resolved cases

Office Action

§103 §DP
DETAILED ACTION Receipt of Arguments/Remarks filed on August 27 2025 is acknowledged. Claims 3-5, 7-8, 10-14, 19-22, 33, 40 and 42-60 were/stand cancelled. Claims 1-2, 6, 9, 15, 23-25 and 63 were amended. Claims 64-79 were added. Claims 1-2, 6, 9, 15-17, 23-32, 34-39, 41 and 61-79 are pending and are directed to the elected invention. Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Withdrawn Objections/Rejections The amendments to the specification and sequence listing filed August 27 2025 are sufficient to overcome the objection to the disclosure. Specifically, the sequence shown in Fig. 2 as well as paragraph 0225 are now associated with an appropriate SEQ ID No. The amendments to the specification filed August 27 2025 are sufficient to overcome the objection. The sequence listing is recited in bytes. The amendments filed August 27 2025 are sufficient to overcome the rejection of claim 25 under 35 USC 112(d). The claim now depends from a previously recited claim. Information Disclosure Statement The information disclosure statement (IDS) submitted on August 27 2025 is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner. Modified Rejection Based on Amendments in the reply filed on August 27 2025 Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102 of this title, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1-2, 6, 9, 11, 15, 64-67 and 69 are rejected under 35 U.S.C. 103 as being unpatentable over Feinstein et al. (WO2006092795, cited on IDS) in view of Ui-Tei et al. (Nucleic Acids Research, 2004). Applicant Claims The instant application claims an RNAi agent for inhibiting expression of a matrix metallopeptidase 7 gene, comprising an antisense strand and a sense strain comprising a nucleotide sequence that is at least partially complementary to the antisense strand, wherein at least one nucleotide of the RNAi agent is a modified nucleotide or includes a modified internucleoside linkage. As claimed the antisense strain comprises Seq ID No. 176 or 679 and the sense strand comprises Seq Id No. 726 and wherein the antisense and sense strand are each 19 to 21, 21 to 24, or 21-26 nucleotides in length. Determination of the Scope and Content of the Prior Art (MPEP §2141.01) Feinstein et al. is directed to oligoribonucleotides specifically double-stranded siRNA which down regulate the expression of a human MMP gene (abstract). Claimed is a compound having the following structure: PNG media_image1.png 176 542 media_image1.png Greyscale wherein each N and N’ may be modified or unmodified in its sugar residue and (N)x and (N’)y is an oligomer in which each consecutive N or N’ is joined to the next N or N’ by a covalent bond; wherein each of x and y is an integer between 19 and 40; Z and Z’ may be present or absent (claim 1). The Z and Z’ being absent is specifically claimed (claim 5). Modifications claimed are at the 2’ position results in the presence of a moiety selected from the group comprising amino, fluoro, methoxy, alkoxy and alkyl. 2’-O-methyl is specifically claimed (claims 10-11). Modification of at least one ribonucleotide is claimed (claim 8). As shown in Table J, MMP 7: 21mer siRNA are shown. Seq ID No. 679 (5’-3’) 1 UGACAUUCAAAAACCAACUGC 21 |||||||||||||||||||| Antisense Strand SiRNA 22 (Table J) (5’- 3’) 1 AGACAUUCAAAAACCAACUGC 21 Seq ID No. 726 (5’-3’) 1 GCAGUUGGUUUUUGAAUGUCA 21 |||||||||||||||||||| Sense Strand SiRNA 22 (Table J) (5’-3’) 1 GCAGUUGGUUUUUGAAUGUCU 21 Table J teaches other siRNA for MMP7. Covalent linkages between nucleotides include phosphodiester, a phosphothioate or a combination of both (pages 17-18). Taught is that modifications or analogs of nucleotides can be introduced to improve the therapeutic properties of the nucleotides. Improved properties include increased nuclease resistance and/or increased ability to permeate cell membranes (page 26). Taught is a composition comprising one or more of the compounds of the invention in a pharmaceutically acceptable carrier. The composition may comprise a mixture of two or more different siRNAs (page 28). It is taught that the MMP siRNA can be linked to molecules to achieve enhanced targeting for treatment of disease (page 29). The compounds of the invention can be administered by any of the conventional routes of administration. Routes of administration include intranasal. Liquid forms as well as aerosols for intranasal and like administration is taught. The compound can be administered as the pharmaceutically acceptable salt (page 24). Ascertainment of the Difference Between Scope the Prior Art and the Claims (MPEP §2141.02) While Feinstein et al. suggest siRNA with both a sense and anti-sense strand which inhibits expression of a matrix metallopeptidase 7 gene, the difference between the instant claims and sequence 22 of Feinstein et al. is the instant antisense strand contains a U (Seq ID 670) whereas the antisense strand of Feinstein et al. contains an A at position 1. Similarly the sense strand of the instant claims contains an A whereas Feinstein et al. contains a U at position 21. However, this deficiency is cured by Ui-Tei et al. Ui-Tei et al. is directed to guidelines for the selection of highly effective siRNA sequences for mammalian and chick RNA interference. It is taught that features which serve to discriminate highly effective siRNAs from those that are ineffective include, the 5’ AS (antisense strand) end of highly effective siRNAs may always be A or U with the ineffective siRNAs being G or C. The 5’ SS (sense strand) ends of highly effective siRNAs are preferably G or C, with the counterpart of ineffective siRNAs being A or U. The highly effective siRNAs have at least four out of seven nucleotides in the 5’terminal AS are A or U while the corresponding region of ineffective siRNAs are GC right (page 938-939, bridging paragraph). Finding of Prima Facie Obviousness Rationale and Motivation (MPEP §2142-2143) It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Feinstein et al. and Ui-Tei et al. and replace the 5’ antisense strand A of Seq ID No 22 of Feinstein et al. with U. One skilled in the art would have been motivated to replace this nucleotide as Ui-Tei et al. recognizes that at this position highly effective siRNAs have either an A or U suggesting either or could be utilized. One skilled in the art would have a reasonable expectation of success as the features of highly effective siRNA as taught by Ui-Tei et al. are possessed by the antisense/sense strands of Feinstein et al. suggesting that either U or A can be utilized at position 1 of the antisense strand. This corresponds to 3’end of the sense strand being modified from U to A. The instant specification teaches that the nucleotide in position 1 of the antisense strand (from 5’ end – 3’ end) forms an A:U or U:A base pair with the sense strand (see paragraph 0088 or 0112). Suggesting no criticality with regards to this nucleotide. The length is also 21 nucleotides reading on claim 1 and 64-67. Regarding the claimed Seq ID No. 176, claim 1 recites the antisense strand comprises this sequence. The antisense strand of Seq ID No. 22 of Feinstein et al. corresponds to instantly claimed Seq ID 679 which comprises Seq ID No. 176. Regarding the claimed for inhibiting expression of a matrix mellopeptidase 7 gene recited in claim 1, Seq ID No. 22 of Feinstein et al. is specifically taught as inhibiting expression of MMP7. Regarding the claimed wherein at least one nucleotide of the RNAi agent is a modified nucleotide or includes a modified internucleoside linkage. Feinstein et al. specifically claims that at least one nucleotide is modified and that this modification is a 2’-O-methyl (which is recited in instant claim 6). Feinstein et al. also teaches that covalent linkages between nucleotides include phosphodiester, a phosphothioate (i.e. a modified internucleoside linkage) or a combination of both. Therefore based on the teachings of Feinstein et al. one skilled in the art would immediately envision using at least one modified nucleotide and/or modified internucleoside linkage with the compounds. Regarding claim 15, the sense and antisense strands are of the same length and therefore the RNAi agent has two blunt ends. Regarding 60 claim Feinstein et al. teaches that the oligonucleotides can be synthesize separately and joined together post-synthetically (page 27, last paragraph). The strands are synthesized separately and then are annealed to each other (page 28, first complete paragraph). Claims 1-2, 6, 9, 11, 15-17, 23-32, 34-39, 41 and 61-79 are rejected under 35 U.S.C. 103 as being unpatentable over Feinstein et al. in view of Ui-Tei et al. as applied to claims 1-2, 6, 9, 11, 15, 64-67 and 69 above and in further view of Li et al. (WO2019089765, cited on IDS) and Chiu et al. (RNA, 2003). Applicant Claims The instant application claims the sense strand comprises one or two terminal caps. The instant application claims the sense strand comprises one or two inverted abasic residues. The examiner notes that as established in paragraph 0081 of the instant specification, the inverted abasic residues can also serve as capping residues. The instant application claims the RNAi agent comprises an antisense strand that comprises SEQ ID No. 406 and sense strand comprises the sequence of SEQ ID No. 526. The instant application claims the RNAi agent is linked to a targeting ligand. The examiner notes that the recitation of substantially all of the nucleotides on the antisense strand are modified is interpreted to encompasses four or fewer nucleotides being unmodified as established in paragraph 0076 of the instant specification. Determination of the Scope and Content of the Prior Art (MPEP §2141.01) The teachings of Feinstein et al. and Ui-Tei et al. are set forth above. Feinstein et al. taught is that modifications or analogs of nucleotides can be introduced to improve the therapeutic properties of the nucleotides. Improved properties include increased nuclease resistance and/or increased ability to permeate cell membranes (page 26). Feinstein et al. taught is a composition comprising one or more of the compounds of the invention in a pharmaceutically acceptable carrier. The composition may comprise a mixture of two or more different siRNAs (page 28). It is taught that the MMP siRNA can be linked to molecules to achieve enhanced targeting for treatment of disease (page 29). Ascertainment of the Difference Between Scope the Prior Art and the Claims (MPEP §2141.02) While Feinstein et al. teach modifications of the nucleotides, Feinstein et al. does not expressly teach an inverted abasic residue, the combination of 2’-O methyl, 2’-fluoro and phosphorothioate or the instantly However, this deficiency is cured by Li et al. and Chiu et al. Li et al. is directed to integrin ligands and uses thereof. It is taught that αvβ6 integrin may regulate expression of matrix metalloproteases (MMPs). It is an attractive target as a tumor biomarker and potential therapeutic target in view of its role in expression of MMPs (paragraph 0002). Taught is compositions including one or more αvβ6 integrin ligands conjugated to one or more oligonucleotide-based compounds such as an RNAi agent (paragraph 0008). Specific ligands taught include structure 6.1 which comprises both structures of instant claim 30 (paragraph 0124). Structure 701c (page 76; paragraph 0268)) shows the ligand conjugated to an RNAi agent which is the same structure as that in instant claim 32 and therefore also encompasses the structures of claim 31. RNAi agents comprise a sense and antisense strand and are independently 17 to 26 nucleotides in length (paragraph 0279). These RNAi agents comprise modified nucleotides and/or one or more non-phosphodiester linkage. In embodiments at least 50% and up to 100% of the nucleotides are modified. Modifications include abasic nucleotides, 2’-modified nucleotides, inverted nucleotides, 2’-fluoro nucleotides (paragraph 0280). One or more nucleotides may be linked by non-standard linkages such as phosphothioates (paragraph 0281). The compositions can be administered in a number of ways including inhalation (paragraph 0294). It is taught that the non-nucleotide group can be covalently linked to the 3’ and/or 5’ end of either the sense strand and/or the antisense strand. In some embodiments they are linked to the sense strand, specifically the 5’ end (paragraph 0303). Linkers can be one, two or three abasic residues (paragraph 0305; 0308). Examples of linkers include NH2-C6 as well as cPrpus or cPrpu (Table A, page 90). Exemplified strands include a NH2-C6, 2’-O-methyl adenosine, cytidine, guanosine or uridine. The sequences also contain 2’-fluoro adenosine, cytidine, guanosine or uridine as well as inverted abasic nucleotides and phosphorothioate (page 199). Pharmaceutically acceptable salts are claimed. Chiu et al. is directed is directed to siRNA function in RNAi, a chemical modification analysis. To address issues of siRNA stability for prolonging the duration of dsRNA-mediated gene silencing, various chemically modified nucleotides predicted to affect siRNA stability were incorporated into siRNA to study whether specific modifications increased or decreased the efficacy and persistence of RNAi in vivo. The most important of these modifications was the 2’-OH that distinguishes RNA from DNA. Results show that the 2’-OH was not required for RNAi. 2’-Modified siRNA increase the persistence of RNAi in human cells (page 1035, left column). Figure 1 shows the structures of various modifications. These include 2’-OME, thioate linkage, 2’-fluoro-uridine, 2’-fluoro-cytidine (page 1036). Addition of the 2’-fluoro group should increase the stability of the siRNA by making the siRNAs less recognizable to RNases , thereby providing siRNAs protection from degradation (page 1036, right column). The 2’-OMe groups are thought to increase RNA stability by inducing an altered RNA conformation that is more resistance to nucleases. This modification is also though to increase RNA affinity for RNA targets and improved hybridization kinetics (page 1037). Modifications like the 2’-fluoro and P-S linkages both increased the half-life of siRNAs. Tests showed that increasing the half-life of siRNAs did, in fact, prolong the effects of RNAi (page 1045). Modifications at the 3’end overhang of the antisense strand are well tolerated (page 1046, left column). Finding of Prima Facie Obviousness Rationale and Motivation (MPEP §2142-2143) It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Feinstein et al., Ui-Tei et al., Li et al. and Chiu et al. and utilize modifications such as 2’-fluoro, 2’-OMe, phosphorothioate and/or inverted abasic nucleotides. One skilled in the art would have been motivated to utilize these modifications in order to increase the stability and/or half life of the RNAi. One skilled in the art would have a reasonable expectation of success as Feinstein et al. and Li et al. both suggest modifications of RNAi. Regarding claims 16-17, 23-24 as indicated above Feinstein et al. and Li et al. suggests modifications of the nucleotides. Li et al. suggest the use of phosphorothioate, cPrpu, 2’-fluoro and O-Me modifications. Chiu et al. teaches that eh 2’-OH is not required for RNAi and that modifications at this position increase stability and more resistance to nucleases. Chiu et al. suggests 2’-fluoro modifications include 2’-fluoro uridine and 2’-fluoro cytidine. Since Feinstein et al. and Ui-Tei et al. suggest the same base anti-sense and sense strands sequences corresponding to the unmodified forms of Seq ID No. 406 and 526, it would have been obvious to one of ordinary skill in the art to utilize known modifications to provide for the expected effect of stability and/or half-life and resistance to nucleases which Feinstein et al. recognizes is a desire of the modification. Li et al. suggests the RNAi can have up to 100% modification. Since, Feinstein et al., Li et al. and Chiu et al. are all directed to RNAi there is a reasonable expectation of success. Regarding claim 25 and 63, Li et al. suggests that the inverted abasic residue can be the linker and that the linker can be at the 3’ or 5’ end of either the anti-sense or sense strand. Li et al. also suggests one, two or three inverted abasic residues for linking. Regarding claims 26-32, 34-35, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Feinstein et al., Ui-Tei et al., Li et al. and Chiu et al. and utilize αvβ6 integrin ligand of structure 701c and attach the ligand to the 5’ end of the sense strand. One skilled in the art would have been motivated to utilize 701c as it is a targeting ligand for MMP as taught by Li et al. One skilled in the art would have been motivated to attach to the sense strand as Li et al. teaches the ligand can be covalently linked to the 3’ and/or 5’ end of either the sense strand and/or the antisense strand. Since there are only 4 choices one skilled in the art would immediately envision using the ligand any of those positions. There is a reasonable expectation of success as Feinstein et al. suggests that the oligonucleotides can be linked to a targeting ligand and Li et al. suggest 701c can be linked to a RNAi target. Regarding claims 36-39, 41, 61-62, Feinstein et al. teaches compositions and pharmaceutically acceptable salts. Feinstein et al. also suggest that these compositions include pharmaceutically acceptable excipients such as those to allow for aerosol delivery (inhalation). Feinstein et al. also suggests that multiple RNAi agents which inhibit the expression of MMP expression. Additionally multiple RNAi agents also read on one or more additional therapeutics. Li et al. also suggests pharmaceutically acceptable salts. The structure of 701c includes a carboxylic acid. Thus pharmaceutically acceptable salts would include positively charged salts such as sodium. Regarding claims 70-72 and 75-77, sequences of 21 nucleotides are taught. Regarding claim 68, 73-74 and 78-79, Feinstein shows the sense and antisense strands are of the same length and therefore the RNAi agent has two blunt ends. Regarding 60 claim Feinstein et al. teaches that the oligonucleotides can be synthesize separately and joined together post-synthetically (page 27, last paragraph). The strands are synthesized separately and then are annealed to each other (page 28, first complete paragraph). Chiu et al. teaches that modifications in overhangs are well tolerated. Ui-Tei et al. also suggests overhangs (see for example Fig. 8). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Feinstein et al., Ui-Tei et al., Li et al. and Chiu et al. and utilize either blunt ends or overhangs. Since modifications are taught as being well tolerated by Chiu et al. and the art teaches both blunt ends and overhangs. One skilled in the art would have been motivated to utilize either form. Response to Arguments Applicants’ arguments filed August 27 2025 have been fully considered but they are not persuasive. Applicants argue that (1) there is no motivation to select MMP_22 from Table J. It is argued Feinstein teaches generating anti-MMP siRNAs with proprietary algorithms and selecting the siRNA for activity. It is argued that Feinstein discloses 68 19-mer and 35 21-mer siRNAs targeting MMP7 (104 total). None of the siRNAs were tested. None of the tests were performed for siRNAs over MMP-7. One would not have selected any of these without hindsight. Regarding Applicants first arguments, as indicated in the arguments Feinstein teaches 104 total siRNAs which are taught as targeting MMP7. The expectation is that all of them would serve as siRNAs for MMP7. Therefore, one would have been motivated to select any of the siRNA from the finite list of siRNA which target MMP7.The rejection is made under 103 and does not need to exemplify all embodiments, only suggest. “Disclosed examples and preferred embodiments do not constitute a teaching away from the broader disclosure or non-preferred embodiment.” In re Susi, 440 F.2d 442, 169 USPQ 423 (CCPA 1971). MPEP 2123. Therefore, while the siRNA which target MMP7 might not have been tested, this does not make the selection of the siRNA which target MMP7 any less obvious. The instant claims are directed to a product. All that is required to render obvious the instant claims is the antisense and sense strand. In response to applicant's argument that the examiner's conclusion of obviousness is based upon improper hindsight reasoning, it must be recognized that any judgment on obviousness is in a sense necessarily a reconstruction based upon hindsight reasoning. But so long as it takes into account only knowledge which was within the level of ordinary skill at the time the claimed invention was made, and does not include knowledge gleaned only from the applicant's disclosure, such a reconstruction is proper. See In re McLaughlin, 443 F.2d 1392, 170 USPQ 209 (CCPA 1971). Here, shown in Table J is a 21mer siRNA which would be expected to target MMP7. This is not based on hindsight but on the specific teachings in Feinstein et al. Applicants argue that (2) Ui-Tei does not teach modifying MMP_22 to arrive at the claimed siRNA. It is argued that just like in Feinstein, the siRNAs of Ui-Tei have perfect complementarity to their target region. Thus Ui-Tei teaches selecting the target region so that the antisense strand has an A or U at the 5’ end while having perfect complementarity to the target. Substitution resulting in non-perfect complementarity with the target is not taught. Instantly claimed SEQ ID No: 176 and 679 contain a mismatch with the target sequence. Feinstein teaches the 5’ end is an A thus it already is a highly effective in light of the teachings of Ui-Tei. Based on the teachings of Ui-Tei the design of highly effective siRNAs would be designed to have as many of the four characteristics taught as possible. Regarding Applicants’ second argument, while the sequences may be complementary, nothing in Ui-Tei et al. teaches that complementary at all positions is a requirement. While Applicants are correct and Ui-Tei et al. teaches four conditions, the examiner cannot agree that these four conditions are not met by Feinstein. Ui-Tei et al. teaches (i) A/U at the 5′ end of the antisense strand; (ii) G/C at the 5′ end of the sense strand; (iii) at least five A/U residues in the 5′ terminal one-third of the antisense strand; and (iv) the absence of any GC stretch of more than 9 nt in length. Looking to the sequence of Feinstein: Antisense Strand SiRNA 22 (Table J) (5’- 3’) 1 AGACAUUCAAAAACCAACUGC 21 Sense Strand SiRNA 22 (Table J) (5’-3’) 1 GCAGUUGGUUUUUGAAUGUCU 21 Feinstein et al. teaches a G/C at the 5’ end of the sense stranding meeting rule (ii); at least 5 A/U residues in the 5’ terminal 1/3 of the antisense strand (which corresponds to 7 nucleotides) reading on rule (iii) and the absence of any GC stretch of more than 9 nt reading on rule (iv). Since there are only two nucleotides taught as being effective at the 5’ end of the antisense strand, the examiner cannot agree that it wouldn’t have been obvious to utilize either A or U at the 5’ end. Therefore, the examiner cannot agree that the instantly claimed sequence is not obvious in light of the teachings of Ui-Tei et al. Applicants argue that (3) neither Li or Chiu cure the deficiencies of Feinstein and Ui-Tei. Regarding Applicants’ third arguments, the arguments are not persuasive for the reasons set forth above. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1-2, 6, 9, 11, 15-17, 23-32, 34-39, 41 and 61-79 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-24 of U.S. Patent No. 11597701 in view of Feinstein et al., Ui-Tei et al. and Chiu et al. Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope. The instant application claims an RNAi agent for inhibiting expression of a matrix metallopeptidase 7 gene, comprising an antisense strand and a sense strain comprising a nucleotide sequence that is at least partially complementary to the antisense strand, wherein at least one nucleotide of the RNAi agent is a modified nucleotide or includes a modified internucleoside linkage and wherein the antisense and sense strand are each 19 to 21, 21 to 24 or 21-26 nucleotides in length. As claimed the antisense strain comprises Seq ID No. 176 or 679 and the sense strand comprises Seq Id No. 726. Patent ‘701 claims an αvβ6 integrin ligand. The integrin ligands claims are the same as instantly claimed. Claimed is structure 701c which is the integrin ligand connected to an RNAi which corresponds to the structure of instant claim 32. Claimed is a composition comprising the ligand and an excipient. While Patent ‘701 claims an RNAi, Patent ‘701 does not claim the specific sense and anti-sense strand claimed. However, that deficiency is cured by Feinstein et al., Ui-Tei et al. and Chiu et al. The teachings of Feinstein et al., Ui-Tei et al. and Chiu et al. are set forth above. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘701, Feinstein et al., Ui-Tei et al. and Chiu et al. and utilize sequence 22 of Feinstein et al. One skilled in the art would have been motivated to utilize the RNAi agents of Feinstein et al. as it for reducing expression of MMP-7 as taught by Feinstein et al. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘701, Feinstein et al., Ui-Tei et al. and Chiu et al. and replace the 5’ antisense strand A of Seq ID No 22 of Feinstein et al. with U. One skilled in the art would have been motivated to replace this nucleotide as Ui-Tei et al. recognizes that at this position highly effective siRNAs have either an A or U suggesting either or could be utilized. One skilled in the art would have a reasonable expectation of success as the features of highly effective siRNA as taught by Ui-Tei et al. are possessed by the antisense/sense strands of Feinstein et al. suggesting that either U or A can be utilized at position 1 of the antisense strand. This corresponds to 3’ end of the sense strand being modified from U to A. The instant specification teaches that the nucleotide in position 1 of the antisense strand (from 5’ end – 3’ end) forms an A:U or U:A base pair with the sense strand (see paragraph 0088 or 0112). Suggesting no criticality with regards to this nucleotide. Regarding the claimed Seq ID No. 176., claim 1 recites the antisense strand comprises this sequence. The antisense strand of Seq ID No. 22 of Feinstein et al. corresponds to instantly claimed Seq ID 679 which comprises Seq ID No. 176. Regarding the claimed for inhibiting expression of a matrix mellopeptidase 7 gene recited in claim 1, Seq ID No. 22 of Feinstein et al. is specifically taught as inhibiting expression of MMP7. Regarding the claimed wherein at least one nucleotide of the RNAi agent is a modified nucleotide or includes a modified internucleoside linkage. Feinstein et al. specifically claims that at least one nucleotide is modified and that this modification is a 2’-O-methyl (which is recited in instant claim 6). Feinstein et al. also teaches that covalent linkages between nucleotides include phosphodiester, a phosphothioate (i.e. a modified internucleoside linkage) or a combination of both. Therefore based on the teachings of Feinstein et al. one skilled in the art would immediately envision using at least one modified nucleotide and/or modified internucleoside linkage with the compounds. Regarding claim 15, the sense and antisense strands are of the same length and therefore the RNAi agent has two blunt ends. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘701, Feinstein et al., Ui-Tei et al. and Chiu et al. and utilize modifications such as 2’-fluoro, 2’-OMe, phosphorothioate and/or inverted abasic nucleotides. One skilled in the art would have been motivated to utilize these modifications in order to increase the stability and/or half-life of the RNAi. One skilled in the art would have a reasonable expectation of success as Feinstein et al. and Chiu et al. both suggest modifications of RNAi. Regarding claims 16-17, 23-24 as indicated above Feinstein et al. suggests modifications of the nucleotides. Chiu et al. suggests 2’-fluoro modifications include 2’-fluoro uridine and 2’-fluoro cytidine. Since Feinstein et al. and Ui-Tei et al. suggest the same base anti-sense and sense strands sequences corresponding to the unmodified forms of Seq ID No. 406 and 526, it would have been obvious to one of ordinary skill in the art to utilize known modifications to provide for the expected effect of stability and/or half-life. Since, Feinstein et al., Patent ‘701 and Chiu et al. are all directed to RNAi there is a reasonable expectation of success. Regarding claim 25 and 63, Patent ‘701 claims a linking group. The inverted abasic residue can be the linker and that the linker can be at the 3’ or 5’ end of either the anti-sense or sense strand. Regarding claims 36-39, 41, 61-62, Feinstein et al. teaches compositions and pharmaceutically acceptable salts. Feinstein et al. also suggest that these compositions include pharmaceutically acceptable excipients such as those to allow for aerosol delivery (inhalation). Feinstein et al. also suggests that multiple RNAi agents which inhibit the expression of MMP expression. Additionally multiple RNAi agents also read on one or more additional therapeutics. Patent ‘701 also suggests pharmaceutically acceptable salts. The structure of 701c includes a carboxylic acid. Thus pharmaceutically acceptable salts would include positively charged salts such as sodium. Regarding claims 64-67, 70-72 and 75-77, sequences of 21 nucleotides are taught. Regarding claim 68-69, 73-74 and 78-79, Feinstein shows the sense and antisense strands are of the same length and therefore the RNAi agent has two blunt ends. Regarding 60 claim Feinstein et al. teaches that the oligonucleotides can be synthesize separately and joined together post-synthetically (page 27, last paragraph). The strands are synthesized separately and then are annealed to each other (page 28, first complete paragraph). Chiu et al. teaches that modifications in overhangs are well tolerated. Ui-Tei et al. also suggests overhangs (see for example Fig. 8). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘701, Feinstein et al., Ui-Tei et al., Li et al. and Chiu et al. and utilize either blunt ends or overhangs. Since modifications are taught as being well tolerated by Chiu et al. and the art teaches both blunt ends and overhangs. One skilled in the art would have been motivated to utilize either form. Claims 1-2, 6, 9, 11, 15-17, 23-32, 34-39, 41 and 61-79 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 7-18 and 25-28 of copending Application No. 18160114 (USPGPUB No. 20240076270) in view of Feinstein et al., Ui-Tei et al. and Chiu et al. Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope. This is a provisional nonstatutory double patenting rejection. The instant claims are set forth above. Copending ‘114 claims an αvβ6 integrin ligand. The claimed structures of the ligands overlap with the instant claimed scope with structure 6.1 and 300a would result in the claimed ligand of instant claim 32. Claimed is a composition comprising the ligand and a pharmaceutically acceptable excipient. Cargo molecules are connected to the ligands. Cargo molecules claimed include natural or modified nucleic acid oligonucleotides. Pharmaceutically acceptable salts are claimed. RNAi agents are claimed. While Copending ‘114 claims an RNAi, Copending ‘114 does not claim the specific sense and anti-sense strand claimed. However, that deficiency is cured by Feinstein et al., Ui-Tei et al. and Chiu et al. The teachings of Feinstein et al., Ui-Tei et al. and Chiu et al. are set forth above. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Copending ‘114, Feinstein et al., Ui-Tei et al. and Chiu et al. and utilize sequence 22 of Feinstein et al. One skilled in the art would have been motivated to utilize the RNAi agents of Feinstein et al. as it for reducing expression of MMP-7 as taught by Feinstein et al. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Copending ‘411, Feinstein et al., Ui-Tei et al. and Chiu et al. and replace the 5’ antisense strand A of Seq ID No 22 of Feinstein et al. with U. One skilled in the art would have been motivated to replace this nucleotide as Ui-Tei et al. recognizes that at this position highly effective siRNAs have either an A or U suggesting either or could be utilized. One skilled in the art would have a reasonable expectation of success as the features of highly effective siRNA as taught by Ui-Tei et al. are possessed by the antisense/sense strands of Feinstein et al. suggesting that either U or A can be utilized at position 1 of the antisense strand. This corresponds to 3’end of the sense strand being modified from U to A. The instant specification teaches that the nucleotide in position 1 of the antisense strand (from 5’ end – 3’ end) forms an A:U or U:A base pair with the sense strand (see paragraph 0088 or 0112). Suggesting no criticality with regards to this nucleotide. Regarding the claimed Seq ID No. 176., claim 1 recites the antisense strand comprises this sequence. The antisense strand of Seq ID No. 22 of Feinstein et al. corresponds to instantly claimed Seq ID 679 which comprises Seq ID No. 176. Regarding the claimed for inhibiting expression of a matrix mellopeptidase 7 gene recited in claim 1, Seq ID No. 22 of Feinstein et al. is specifically taught as inhibiting expression of MMP7. Regarding the claimed wherein at least one nucleotide of the RNAi agent is a modified nucleotide or includes a modified internucleoside linkage. Feinstein et al. specifically claims that at least one nucleotide is modified and that this modification is a 2’-O-methyl (which is recited in instant claim 6). Feinstein et al. also teaches that covalent linkages between nucleotides include phosphodiester, a phosphothioate (i.e. a modified internucleoside linkage) or a combination of both. Therefore based on the teachings of Feinstein et al. one skilled in the art would immediately envision using at least one modified nucleotide and/or modified internucleoside linkage with the compounds. Regarding claim 15, the sense and antisense strands are of the same length and therefore the RNAi agent has two blunt ends. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Copending ‘114, Feinstein et al., Ui-Tei et al. and Chiu et al. and utilize modifications such as 2’-fluoro, 2’-OMe, phosphorothioate and/or inverted abasic nucleotides. One skilled in the art would have been motivated to utilize these modifications in order to increase the stability and/or half-life of the RNAi. One skilled in the art would have a reasonable expectation of success as Feinstein et al. and Chiu et al. both suggest modifications of RNAi. Regarding claims 16-17, 23-24 as indicated above Feinstein et al. suggests modifications of the nucleotides. Chiu et al. suggests 2’-fluoro modifications include 2’-fluoro uridine and 2’-fluoro cytidine. Since Feinstein et al. and Ui-Tei et al. suggest the same base anti-sense and sense strands sequences corresponding to the unmodified forms of Seq ID No. 406 and 526, it would have been obvious to one of ordinary skill in the art to utilize known modifications to provide for the expected effect of stability and/or half-life. Since, Feinstein et al., Copending ‘114 and Chiu et al. are all directed to RNAi there is a reasonable expectation of success. Regarding claim 25 and 63, Copending ‘114 claims a linking group. The inverted abasic residue can be the linker and that the linker can be at the 3’ or 5’ end of either the anti-sense or sense strand. Regarding claims 36-39, 41, 61-62, Feinstein et al. teaches compositions and pharmaceutically acceptable salts. Feinstein et al. also suggest that these compositions include pharmaceutically acceptable excipients such as those to allow for aerosol delivery (inhalation). Feinstein et al. also suggests that multiple RNAi agents which inhibit the expression of MMP expression. Additionally multiple RNAi agents also read on one or more additional therapeutics. Copending ‘114 also suggests pharmaceutically acceptable salts. The structure of the ligands include a carboxylic acid. Thus pharmaceutically acceptable salts would include positively charged salts such as sodium. Regarding claims 64-67, 70-72 and 75-77, sequences of 21 nucleotides are taught. Regarding claim 68-69, 73-74 and 78-79, Feinstein shows the sense and antisense strands are of the same length and therefore the RNAi agent has two blunt ends. Regarding 60 claim Feinstein et al. teaches that the oligonucleotides can be synthesize separately and joined together post-synthetically (page 27, last paragraph). The strands are synthesized separately and then are annealed to each other (page 28, first complete paragraph). Chiu et al. teaches that modifications in overhangs are well tolerated. Ui-Tei et al. also suggests overhangs (see for example Fig. 8). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Copending ‘114, Feinstein et al., Ui-Tei et al., Li et al. and Chiu et al. and utilize either blunt ends or overhangs. Since modifications are taught as being well tolerated by Chiu et al. and the art teaches both blunt ends and overhangs. One skilled in the art would have been motivated to utilize either form. Claims 1-2, 6, 9, 11, 15-17, 23-32, 34-39, 41 and 61-79 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-5, 8, 16, 22-24, 26-28, 30-35 of copending Application No. 18181340 (USPGPUB No. 20230407313) in view of Feinstein et al., Ui-Tei et al. and Chiu et al. Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope. This is a provisional nonstatutory double patenting rejection. The instant claims are set forth above. Copending ‘340 claims compounds such as 45b which can be bound to the 5’ end of the sense strand of an RNAi agent. Azide linking moieties are claimed. Wherein alkyne reactive moieties are claimed. A composition comprising the compound and an excipient are claimed. While Copending ‘340 claims an RNAi, Copending ‘340 does not claim the specific sense and anti-sense strand claimed. However, that deficiency is cured by Feinstein et al., Ui-Tei et al. and Chiu et al. The teachings of Feinstein et al., Ui-Tei et al. and Chiu et al. are set forth above. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Copending ‘340, Feinstein et al., Ui-Tei et al. and Chiu et al. and utilize sequence 22 of Feinstein et al. One skilled in the art would have been motivated to utilize the RNAi agents of Feinstein et al. as it for reducing expression of MMP-7 as taught by Feinstein et al. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Copending ‘340, Feinstein et al., Ui-Tei et al. and Chiu et al. and replace the 5’ antisense strand A of Seq ID No 22 of Feinstein et al. with U. One skilled in the art would have been motivated to replace this nucleotide as Ui-Tei et al. recognizes that at this position highly effective siRNAs have either an A or U suggesting either or could be utilized. One skilled in the art would have a reasonable expectation of success as the features of highly effective siRNA as taught by Ui-Tei et al. are possessed by the antisense/sense strands of Feinstein et al. suggesting that either U or A can be utilized at position 1 of the antisense strand. This corresponds to 3’end of the sense strand being modified from U to A. The instant specification teaches that the nucleotide in position 1 of the antisense strand (from 5’ end – 3’ end) forms an A:U or U:A base pair with the sense strand (see paragraph 0088 or 0112). Suggesting no criticality with regards to this nucleotide. Regarding the claimed Seq ID No. 176., claim 1 recites the antisense strand comprises this sequence. The antisense strand of Seq ID No. 22 of Feinstein et al. corresponds to instantly claimed Seq ID 679 which comprises Seq ID No. 176. Regarding the claimed for inhibiting expression of a matrix mellopeptidase 7 gene recited in claim 1, Seq ID No. 22 of Feinstein et al. is specifically taught as inhibiting expression of MMP7. Regarding the claimed wherein at least one nucleotide of the RNAi agent is a modified nucleotide or includes a modified internucleoside linkage. Feinstein et al. specifically claims that at least one nucleotide is modified and that this modification is a 2’-O-methyl (which is recited in instant claim 6). Feinstein et al. also teaches that covalent linkages between nucleotides include phosphodiester, a phosphothioate (i.e. a modified internucleoside linkage) or a combination of both. Therefore based on the teachings of Feinstein et al. one skilled in the art would immediately envision using at least one modified nucleotide and/or modified internucleoside linkage with the compounds. Regarding claim 15, the sense and antisense strands are of the same length and therefore the RNAi agent has two blunt ends. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Copending ‘340, Feinstein et al., Ui-Tei et al. and Chiu et al. and utilize modifications such as 2’-fluoro, 2’-OMe, phosphorothioate and/or inverted abasic nucleotides. One skilled in the art would have been motivated to utilize these modifications in order to increase the stability and/or half-life of the RNAi. One skilled in the art would have a reasonable expectation of success as Feinstein et al. and Chiu et al. both suggest modifications of RNAi. Regarding claims 16-17, 23-24 as indicated above Feinstein et al. suggests modifications of the nucleotides. Chiu et al. suggests 2’-fluoro modifications include 2’-fluoro uridine and 2’-fluoro cytidine. Since Feinstein et al. and Ui-Tei et al. suggest the same base anti-sense and sense strands sequences corresponding to the unmodified forms of Seq ID No. 406 and 526, it would have been obvious to one of ordinary skill in the art to utilize known modifications to provide for the expected effect of stability and/or half-life. Since, Feinstein et al., Copending ‘340 and Chiu et al. are all directed to RNAi there is a reasonable expectation of success. Regarding claims 36-39, 41, 61-62, Feinstein et al. teaches compositions and pharmaceutically acceptable salts. Feinstein et al. also suggest that these compositions include pharmaceutically acceptable excipients such as those to allow for aerosol delivery (inhalation). Feinstein et al. also suggests that multiple RNAi agents which inhibit the expression of MMP expression. Additionally multiple RNAi agents also read on one or more additional therapeutics. Copending ‘340 also
Read full office action

Prosecution Timeline

Oct 21, 2022
Application Filed
Feb 23, 2025
Non-Final Rejection — §103, §DP
Aug 27, 2025
Response Filed
Nov 17, 2025
Final Rejection — §103, §DP
Feb 27, 2026
Interview Requested
Mar 05, 2026
Examiner Interview Summary

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12600972
LIPOPOLYSACCHARIDE (LPS) APTAMERS AND ASSOCIATED METHODS
2y 5m to grant Granted Apr 14, 2026
Patent 12582609
CANCER VACCINES
2y 5m to grant Granted Mar 24, 2026
Patent 12577271
MODIFIED NUCLEOTIDES AND USES THEREOF
2y 5m to grant Granted Mar 17, 2026
Patent 12553081
METHODS AND CONTROL COMPOSITIONS FOR A QUANTITATIVE POLYMERASE CHAIN REACTION
2y 5m to grant Granted Feb 17, 2026
Patent 12540323
NUCLEIC ACID, PHARMACEUTICAL COMPOSITION, CONJUGATE, PREPARATION METHOD, AND USE
2y 5m to grant Granted Feb 03, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
47%
Grant Probability
69%
With Interview (+21.9%)
3y 7m
Median Time to Grant
Moderate
PTA Risk
Based on 1191 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month