Office Action Predictor
Last updated: April 16, 2026
Application No. 18/050,017

EXTRACELLULAR VESICLE-ASO CONSTRUCTS TARGETING STAT6

Final Rejection §103
Filed
Oct 26, 2022
Examiner
TRAN, CHRISTINA L
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Lonza Sales AG
OA Round
2 (Final)
43%
Grant Probability
Moderate
3-4
OA Rounds
3y 10m
To Grant
62%
With Interview

Examiner Intelligence

Grants 43% of resolved cases
43%
Career Allow Rate
19 granted / 44 resolved
-16.8% vs TC avg
Strong +19% interview lift
Without
With
+19.0%
Interview Lift
resolved cases with interview
Typical timeline
3y 10m
Avg Prosecution
55 currently pending
Career history
99
Total Applications
across all art units

Statute-Specific Performance

§101
6.4%
-33.6% vs TC avg
§103
30.2%
-9.8% vs TC avg
§102
14.1%
-25.9% vs TC avg
§112
35.6%
-4.4% vs TC avg
Black line = Tech Center average estimate • Based on career data from 44 resolved cases

Office Action

§103
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . DETAILED ACTION Applicant's amendments and remarks filed on December 23, 2025 are acknowledged. Claims 2-15, 17, 19-25, 27-30, 36-45, 47-74, 77, 79, 81-82, 86-87, and 89-142 have been canceled. Claims 46, 75, 83, 84, 143, and 144 were amended. Claims 1, 16, 18, 26, 31-35, 46, 75, 76, 78, 80, 83, 84, 85, 88, and 143-145 are pending and are examined on the merits herein. It is noted that the amendment to the claims filed on December 23, 2025 does not comply with the requirements of 37 CFR 1.121(c) because the amendment is not shown with markings relative to the immediate prior version of the claim. Specifically, claim 83 recites “The extracellular vesicle of claim 80, wherein the linker comprises a polyethylene glycol (PEG) Priority PNG media_image1.png 170 428 media_image1.png Greyscale Information Disclosure Statement The information disclosure statement (IDS) submitted on September 18, 2025 and December 23, 2025 is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statements are being considered by the examiner. Withdrawn Objections In view of Applicant’s amendments and response, the objections to the drawings and claims 46, 75, and 83 are withdrawn. Withdrawn Rejections In view of Applicant’s amendments and response, the 35 U.S.C 112(b) rejections are withdrawn. Drawings The replacement drawings were received on December 23, 2025. These drawings are found acceptable by the examiner. Specification It is noted that the amendment to the specification filed on December 23, 2025 does not comply with the requirements of 37 CFR 1.121(b) because the full text of replacement paragraph [0071] is not shown with markings relative to the immediate prior version of the paragraph. Specifically, paragraph [0071] of the specification filed on August 22, 2023 reads in part “2.5 µM”; however, amended paragraph [0071] reads in part “2.5 M”. Therefore, the amendment to the specification has not been entered. Applicant is reminded of the proper language and format for an abstract of the disclosure. The abstract should be in narrative form and generally limited to a single paragraph on a separate sheet within the range of 50 to 150 words in length. The abstract should describe the disclosure sufficiently to assist readers in deciding whether there is a need for consulting the full patent text for details. The language should be clear and concise and should not repeat information given in the title. It should avoid using phrases which can be implied, such as, “The disclosure concerns,” “The disclosure defined by this invention,” “The disclosure describes,” etc. In addition, the form and legal phraseology often used in patent claims, such as “means” and “said,” should be avoided. The abstract of the disclosure is objected to because of the use of legal phraseology ("e.g." stands for "exempli gratia", and should be removed or replaced with a non-Latin version, such as "for example"). A corrected abstract of the disclosure is required and must be presented on a separate sheet, apart from any other text. See MPEP § 608.01(b). The disclosure is objected to because of the following informalities: Paragraph [0049] discloses that Figures 2B-2E depict uptake of exosomes comprising antisense oligonucleotides in various cell types isolated from blood, liver, spleen, and a tumor. First, paragraph [0049] should read “FIGs. 2B-2F are graphical representations of Cy5 levels” (emphasis added). Second, the axis labels in Figures 2B-2F are replete with cell-type labels that are not clearly disclosed and/or defined in the associated description in the instant specification. For clarity, it would be remedial to clearly indicate the meaning of these cell-type labels. Paragraph [0051] reads “FIGs. 4A-4J are graphical representations of the expression…” and should read “FIGs. 4A-4N are graphical representations of the expression…” (emphasis added). FIG. 14A contains the abbreviations “IT”, “TIW”, “IP”, and “DIW”; however, the figure itself and paragraph [0061] of the specification do not define the abbreviations. FIG. 17A contains the abbreviations “IT”, “TIW”, “IP”, and “DIW”; however, the figure itself and paragraph [0065] of the specification do not define the abbreviations. Paragraph [0066] reads “fusion constructs ttthat can be expressed” and should read “fusion constructs that can be expressed”. Paragraph [0071] reads “0.624” and should read “0.625” (emphasis added). Paragraph [0072] reads “scatter plot illustratring…Stat6 protein knowck down” and should read “scatter plot illustrating…Stat6 protein knock down”. FIG. 26A contains the abbreviations “TIW”, “IP”, and “DIW”; however, the figure itself and paragraph [0075] of the specification do not define the abbreviations. Paragraph [0075] reads “(FIGs. FIG. 26B-26D)” and should read “(FIGs. 26B-26D)”. Appropriate correction is required. Response to Arguments Applicant's arguments filed December 23, 2025 have been fully considered but they are not persuasive. It is noted that the amendment to the specification filed on December 23, 2025 does not comply with the requirements of 37 CFR 1.121(b) because the full text of replacement paragraph [0071] is not shown with markings relative to the immediate prior version of the paragraph. Specifically, paragraph [0071] of the specification filed on August 22, 2023 reads in part “2.5 µM”; however, amended paragraph [0071] reads in part “2.5 M”. Therefore, the amendment to the specification has not been entered. It is also noted that paragraph [0071] should disclose “2.5 µM” not “2.5 M”. Claim Objections Claim 84 is objected to because of the following informality: There are two (2) periods at the end of claim 84. Appropriate correction is required. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1, 16, 18, 26, 31-35, 75, 76, 78, and 88 are rejected under 35 U.S.C. 103 as being unpatentable over Shanahan Jr. et al. (US 8,518,904) in view of Bleicher et al. (WO 2019/122282; reference cited by Applicant). Regarding claims 1, 16, 18, 26, 33-35, and 88, Shanahan Jr. et al. teaches compositions comprising oligonucleotides targeted to nucleic acid encoding STAT 6 [abstract]. Instant SEQ ID NO: 185 (designated as Qy) has a 100% match to positions 1994 through 1975 of Shanahan Jr. et al. SEQ ID NO: 4 (designated as Db) as shown in the alignment below. Query Match 100.0%; Score 20; DB 1; Length 3046; Best Local Similarity 100.0%; Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GCAAGATCCCGGATTCGGTC 20 |||||||||||||||||||| Db 1994 GCAAGATCCCGGATTCGGTC 1975 Shanahan Jr. et al. SEQ ID NO: 4 is the human STAT6 RNA (GenBank accession number NM_003153.1). Shanahan Jr. et al. teaches chimeric oligonucleotides “gapmers” that are 20 nucleotides in length composed of a central “gap” region consisting of ten 2’-deoxynucleotides which is flanked on both sides by five-nucleotide “wings”. The wings are composed of 2’-methoxyethyl (2’-MOE) nucleotides. The internucleoside linkages are phosphorothioate throughout the oligonucleotide and all cytidine residues are 5-methylcytidines [column 34, Example 15]. Shanahan Jr. et al. also teaches that preferred compounds are oligonucleotides about 15 to 30 nucleobases [column 6, lines 43-45] and that antisense oligonucleotides may contain modified backbones (e.g., phosphorothioates), one or more substituted sugar moieties (e.g., 2’-MOE, LNA), and nucleobase modifications or substitutions (e.g., 5-methylcytosine) [Section F, columns 12-15]. Further, Shanahan Jr. et al. teaches that 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability and are presently preferred base substitutions [column 15, lines 44-46]. Regarding claims 31, 32, 75, 76, and 78, Shanahan Jr. et al. teaches that chemically linking the oligonucleotide to one or more moieties or conjugates enhances the activity, cellular distribution, or cellular uptake of the oligonucleotide. Further, conjugate moieties include, but are not limited to, lipid moieties such as cholesterol [column 15, last paragraph bridging to column 16]. However, Shanahan Jr. et al. does not teach packaging of antisense oligonucleotides into extracellular vesicles, specifically exosomes. Shanahan Jr. et al. also does not teach an antisense oligonucleotide or the antisense oligonucleotide design as recited in claims 1 or 16 or wherein all of the cytosine nucleobases are 5’-methylcytosine (claim 18). Shanahan Jr. et al. also does not teach an exogenous targeting moiety wherein the exogenous targeting moiety comprises a peptide (claims 33-35). Bleicher et al. teaches that antisense oligonucleotides may be effectively delivered via exosomes [page 56, lines 3-32]. Bleicher et al. also teaches that conjugation of the oligonucleotide to one or more non-nucleotide moieties may improve the pharmacology of the oligonucleotide, modify or enhance the pharmacokinetic properties of the oligonucleotide, or the conjugate may target the oligonucleotide to a specific organ, tissue or cell type wherein the non-nucleotide moiety (conjugate moiety) includes peptides [page 57, second and fifth paragraphs]. Bleicher et al. teaches that the overall length of the gapmer design F-G-F’ may be from 14 to 22 nucleotides [page 44, last paragraph] wherein one or more sugar modified nucleosides such as LNA in the F and F’ regions enhance the affinity of the oligonucleotide for the target nucleic acid [page 44, first full paragraph] and the gap region (region G) comprises DNA nucleosides which enables the oligonucleotide to recruit RNase H [page 45, lines 10-11] and consists of 14 contiguous DNA nucleosides [page 45, line 18]. Although Shanahan Jr. et al. does not teach an antisense oligonucleotide, it would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to design an antisense oligonucleotide according to claim 1 using the design principles taught by Shanahan Jr. et al. and Bleicher et al. because it would have amounted to applying known design principles to a known STAT6 RNA sequence to yield predictable results. One would have been motivated to do so because Shanahan Jr. et al. taught the human STAT6 RNA sequence and taught gapmers with 2’-MOE wings, phosphorothioate linkages, and 5-methylcytidines, and Bleicher et al. taught that antisense gapmers are used to inhibit a target nucleic acid via RNase H mediated degradation [page 44, first full paragraph] wherein the antisense gapmer comprises the design recited in claim 16. Further, although Shanahan Jr. et al. does not explicitly teach wherein all of the cytosine nucleobases are 5’-methylcytosines, it would have been obvious to try because Shanahan Jr. et al. taught that 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability and are presently preferred base substitutions. It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to package the oligonucleotide of Shanahan Jr. et al. into an exosome as disclosed in Bleicher et al. One would have been motivated to make such a modification to effectively deliver the oligonucleotide because Bleicher et al. taught that antisense oligonucleotides may be effectively delivered via exosomes. It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to further engineer the extracellular vesicle of Shanahan Jr. et al. and Bleicher et al. to comprise an exogenous peptide targeting moiety. One would have been motivated to make such a modification to improve the pharmacology of the oligonucleotide as taught by Bleicher et al. Claim 46 is rejected under 35 U.S.C. 103 as being unpatentable over Shanahan Jr. et al. (US 8,518,904) in view of Bleicher et al. (WO 2019/122282; reference cited by Applicant) as applied to claims 1, 16, 18, 26, 31-35, 75, 76, 78, and 88 above, and further in view of Villiger et al. (US 2019/0085284). Regarding claim 46, the teachings of Shanahan Jr. et al. and Bleicher et al. are discussed above. However, Shanahan Jr. et al. and Bleicher et al. do not teach the extracellular vesicle of claim 1 wherein the extracellular vesicle is produced from a cell that overexpresses a PTGFRN protein. See “Claim Interpretation” section above. Villiger et al. teaches the cells producing extracellular vesicles are engineered to overexpress one or more exosome-specific proteins, thereby generating extracellular vesicles overexpressing said one or more exosome-specific proteins wherein the one or more exosome-specific protein is a surface protein such as PTGFRN [0049]. It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to use the method of Villiger et al. to produce the extracellular vesicle of Shanahan Jr. et al. and Bleicher et al. with a reasonable expectation of success because it would have amounted to applying a known technique to yield predictable results. One would have been motivated to do so because Villiger et al. teaches cells producing extracellular vesicles are engineered to overexpress one or more exosome-specific proteins such as PTGFRN. Claims 80, 83, 84, 85, and 143 are rejected under 35 U.S.C. 103 as being unpatentable over Shanahan Jr. et al. (US 8,518,904) in view of Bleicher et al. (WO 2019/122282; reference cited by Applicant) as applied to claims 1, 16, 18, 26, 31-35, 75, 76, 78, and 88 above, and further in view of Haraszti et al. (Molecular Therapy 2018) and Musumeci et al. (Molecules 2012). Regarding claims 80, 83, 84, 85, and 143, the teachings of Shanahan Jr. et al. and Bleicher et al. are discussed above. However, Shanahan Jr. et al. and Bleicher et al. do not teach the limitations of the linker as recited in instant claims 80, 83, 84, 85, and 143. Haraszti et al. teaches that TEG and C7 linkers were used to conjugate cholesterol to siRNAs [page 1974, left column, last paragraph]. Haraszti et al. also discloses that cholesterol conjugation-mediated loading of siRNAs onto extracellular vesicles is among the most reproducible and scalable loading strategies [page 1973, right column, first full paragraph]. Furthermore, Haraszti et al. discloses the use of hydrophobic modification as a strategy for productive loading of RNA cargo onto extracellular vesicles and teaches that a similar optimization strategy is likely needed when taking advantage of extracellular vesicles for in vivo delivery of other oligonucleotide species such as antisense oligonucleotides [page 1978, left column, fourth full paragraph]. Haraszti et al. also teaches that introducing cleavable linkers enhances silencing activity of conjugated siRNAs [page 1977, left column, last paragraph]. Musumeci et al. teaches hexaethylene glycol (HEG) is a longer and more polar spacer than TEG [page 12380, first full paragraph]. Further, the HEG spacer has a higher flexibility compared to mono-ethylene glycol wherein the latter spacer may not be long enough to prevent cholesterol from partially hampering due to steric hindrance [page 12384, third full paragraph]. It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the extracellular vesicle of Shanahan Jr. et al. and Bleicher et al. by conjugating the siRNA to hydrophobic cholesterol via a TEG and HEG linker because both Haraszti et al. and Musumeci et al. teach that it is within the skill of the art to use linkers for cholesterol conjugation. One would have been motivated to make such a modification to prevent steric clash of the oligonucleotide and to effectively mediate in vivo delivery of therapeutic oligonucleotides packaged into and anchored to extracellular vesicles. It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the extracellular vesicle of Shanahan Jr. et al. and Bleicher et al. by linking the antisense oligonucleotide to the anchoring moiety by a cleavable linker. One would have been motivated to make such a modification to enhance silencing activity of conjugated siRNAs as taught by Haraszti et al. Claims 144 and 145 are rejected under 35 U.S.C. 103 as being unpatentable over Shanahan Jr. et al. (US 8,518,904) in view of Bleicher et al. (WO 2019/122282; reference cited by Applicant), Haraszti et al. (Molecular Therapy 2018), and Musumeci et al. (Molecules 2012). Regarding claims 144 and 145, Shanahan Jr. et al. teaches compositions comprising oligonucleotides targeted to nucleic acid encoding STAT 6 [abstract]. Instant SEQ ID NO: 185 (designated as Qy) has a 100% match to positions 1994 through 1975 of Shanahan Jr. et al. SEQ ID NO: 4 (designated as Db) as shown in the alignment below. Query Match 100.0%; Score 20; DB 1; Length 3046; Best Local Similarity 100.0%; Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GCAAGATCCCGGATTCGGTC 20 |||||||||||||||||||| Db 1994 GCAAGATCCCGGATTCGGTC 1975 Shanahan Jr. et al. SEQ ID NO: 4 is the human STAT6 RNA (GenBank accession number NM_003153.1). Shanahan Jr. et al. teaches chimeric oligonucleotides “gapmers” that are 20 nucleotides in length composed of a central “gap” region consisting of ten 2’-deoxynucleotides which is flanked on both sides by five-nucleotide “wings”. The wings are composed of 2’-methoxyethyl (2’-MOE) nucleotides. The internucleoside linkages are phosphorothioate throughout the oligonucleotide and all cytidine residues are 5-methylcytidines [column 34, Example 15]. Shanahan Jr. et al. also teaches that preferred compounds are oligonucleotides about 15 to 30 nucleobases [column 6, lines 43-45] and that antisense oligonucleotides may contain modified backbones (e.g., phosphorothioates), one or more substituted sugar moieties (e.g., 2’-MOE, LNA), and nucleobase modifications or substitutions (e.g., 5-methylcytosine) [Section F, columns 12-15]. Further, Shanahan Jr. et al. teaches that 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability and are presently preferred base substitutions [column 15, lines 44-46]. Shanahan Jr. et al. teaches that chemically linking the oligonucleotide to one or more moieties or conjugates enhances the activity, cellular distribution, or cellular uptake of the oligonucleotide. Further, conjugate moieties include, but are not limited to, lipid moieties such as cholesterol [column 15, last paragraph bridging to column 16]. However, Shanahan Jr. et al. does not teach packaging of antisense oligonucleotides into extracellular vesicles, specifically exosomes. Shanahan Jr. et al. also does not teach an antisense oligonucleotide or the antisense oligonucleotide design as recited in claim 144. Further, Shanahan Jr. et al. does not teach an antisense oligonucleotide wherein all of the cytosine nucleobases are 5’-methylcytosine and wherein each of the internucleoside linkages is a phosphorothioate linkage. Shanahan Jr. et al. also does not teach wherein the antisense oligonucleotide is linked to cholesterol by a linker comprising TEG and HEG. Bleicher et al. teaches that antisense oligonucleotides may be effectively delivered via exosomes [page 56, lines 3-32]. Bleicher et al. teaches that the overall length of the gapmer design F-G-F’ may be from 14 to 22 nucleotides [page 44, last paragraph] wherein one or more sugar modified nucleosides such as LNA in the F and F’ regions enhance the affinity of the oligonucleotide for the target nucleic acid [page 44, first full paragraph] and the gap region (region G) comprises DNA nucleosides which enables the oligonucleotide to recruit RNase H [page 45, lines 10-11] and consists of 14 contiguous DNA nucleosides [page 45, line 18]. Bleicher et al. also teaches that phosphorothioate internucleoside linkages are useful due to nuclease resistance, beneficial pharmacokinetics and ease of manufacture. Further, Bleicher et al. teaches that all of the internucleoside linkages of the oligonucleotide are phosphorothioate linkages [page 25, last paragraph bridging to page 26]. Haraszti et al. teaches that TEG and C7 linkers were used to conjugate cholesterol to siRNAs [page 1974, left column, last paragraph]. Haraszti et al. also discloses that cholesterol conjugation-mediated loading of siRNAs onto extracellular vesicles is among the most reproducible and scalable loading strategies [page 1973, right column, first full paragraph]. Furthermore, Haraszti et al. discloses the use of hydrophobic modification as a strategy for productive loading of RNA cargo onto extracellular vesicles and teaches that a similar optimization strategy is likely needed when taking advantage of extracellular vesicles for in vivo delivery of other oligonucleotide species such as antisense oligonucleotides [page 1978, left column, fourth full paragraph]. Musumeci et al. teaches hexaethylene glycol (HEG) is a longer and more polar spacer than TEG [page 12380, first full paragraph]. Further, the HEG spacer has a higher flexibility compared to mono-ethylene glycol wherein the latter spacer may not be long enough to prevent cholesterol from partially hampering due to steric hindrance [page 12384, third full paragraph]. Although Shanahan Jr. et al. does not teach an antisense oligonucleotide, it would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to design an antisense oligonucleotide according to claim 144 using the design principles taught by Shanahan Jr. et al. and Bleicher et al. because it would have amounted to applying known design principles to a known STAT6 RNA sequence to yield predictable results. One would have been motivated to do so because Shanahan Jr. et al. taught the human STAT6 RNA sequence and taught gapmers with 2’-MOE wings, phosphorothioate linkages, and 5-methylcytidines, and Bleicher et al. taught that antisense gapmers are used to inhibit a target nucleic acid via RNase H mediated degradation [page 44, first full paragraph] wherein the antisense gapmer comprises the design recited in claim 144. Further, although Shanahan Jr. et al. does not explicitly teach wherein all of the cytosine nucleobases are 5’-methylcytosines, it would have been obvious to try because Shanahan Jr. et al. taught that 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability and are presently preferred base substitutions. In addition, it would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to conjugate the siRNA to hydrophobic cholesterol via a TEG and HEG linker because both Haraszti et al. and Musumeci et al. teach that it is within the skill of the art to use linkers for cholesterol conjugation. One would have been motivated to make such a modification to prevent steric clash of the oligonucleotide and to effectively mediate in vivo delivery of therapeutic oligonucleotides packaged into and anchored to extracellular vesicles. Furthermore, it would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to package the modified oligonucleotide of Shanahan Jr. et al., Bleicher et al., Haraszti et al. and Musumeci et al. into an exosome as disclosed in Bleicher et al. One would have been motivated to make such a modification to effectively deliver the oligonucleotide because Bleicher et al. taught that antisense oligonucleotides may be effectively delivered via exosomes. Response to Arguments Applicant's arguments filed December 23, 2025 have been fully considered but they are not persuasive. Applicant asserts that the Office’s “obvious to try” rationale is contrary to the patentability rules outlined in the MPEP and traverses the hindsight reconstruction. Applicant asserts that SEQ ID NO: 185 is not disclosed in Shanahan Jr. et al. and although SEQ ID NO: 185 is complementary to the STAT6 sequence (SEQ ID NO: 4) does not mean that Shanahan Jr. et al. discloses that the antisense oligonucleotide is capable of reducing STAT6 expression. Applicant further asserts that the motivation to arrive at the claimed ASO is gleaned solely from Applicant’s disclosure. Applicant asserts that there is no apparent reason a person of ordinary skill would have chosen the particular ASO of claim 1 in combination with an EV. Applicant further asserts that the claimed invention does not present a finite number of options easily traversed to show obviousness. These arguments are not found persuasive. Shanahan Jr. et al. teaches compounds and compositions capable of modulating STAT6 expression wherein the compositions comprise oligonucleotides targeted to nucleic acid encoding STAT6 [abstract]. Shanahan Jr. et al. defines the term “modulation” and the phrase “modulation of expression” to mean either an increase (stimulation) or a decrease (inhibition) in the amount or levels of a nucleic acid molecule encoding the gene, e.g., DNA or RNA. Inhibition is often the preferred form of modulation of expression and mRNA is often a preferred target nucleic acid [column 3, last paragraph bridging to column 4]. Shanahan Jr. et al. also teaches that a series of antisense compounds were designed to target different regions of the human STAT 6 RNA using published sequences (GenBank accession number NM_003153.1, SEQ ID NO: 4) [column 34, last paragraph]. Further, Shanahan Jr. et al. teaches that preferred target segments are locations on the target nucleic acid to which the preferred antisense compounds hybridize [column 9, first full paragraph]. While the specific sequences of certain preferred target segments are set forth, additional preferred target segments may be identified by one having ordinary skill [column 9, second full paragraph]. Finally, once one or more target regions, segments or sites have been identified, antisense compounds are chosen which are sufficiently complementary to the target to give the desired effect [column 9, fifth full paragraph]. One of ordinary skill in the art would have been motivated to package the oligonucleotide of Shanahan Jr. et al. into an exosome as disclosed in Bleicher et al. to effectively deliver the oligonucleotide of Shanahan Jr. et al. Even if the STAT6 gene contains thousands of possible target sequences, this is a finite number of target sequences to test. Applicant asserts the following: PNG media_image2.png 344 808 media_image2.png Greyscale PNG media_image3.png 302 788 media_image3.png Greyscale These arguments are not found persuasive. Even if the STAT6 gene contains thousands of possible target sequences, this is a finite number of target sequences to test. Shanahan Jr. et al. also teaches compounds for modulation of STAT 6 expression capable of diagnosing and treating a disease associated with STAT 6 expression [abstract]. The Bleicher et al. reference was used in combination with Shanahan Jr. et al. because although Shanahan Jr. et al. taught SEQ ID NO: 4, a human STAT6 RNA sequence (GenBank accession number NM_003153.1), wherein positions 1994 through 1975 has a 100% match to instant SEQ ID NO: 185, Shanahan Jr. et al. did not teach packaging of antisense oligonucleotides into extracellular vesicles, specifically exosomes. Bleicher et al. teaches that antisense oligonucleotides may be effectively delivered via exosomes [page 56, lines 3-32]. Therefore, it would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to package the oligonucleotide of Shanahan Jr. et al. into an exosome as disclosed in Bleicher et al. One would have been motivated to make such a modification to effectively deliver the oligonucleotide because Bleicher et al. taught that antisense oligonucleotides may be effectively delivered via exosomes. It is noted that an opinion as to the levels of efficacy relative to different therapeutic modalities directed to different target genes has been made; however, no evidentiary support has been provided for the opinion. The arguments of counsel cannot take the place of evidence in the record. In re Schulze, 346 F.2d 600, 602, 145 USPQ 716, 718 (CCPA 1965); In re Geisler, 116 F.3d 1465, 43 USPQ2d 1362 (Fed. Cir. 1997) ("An assertion of what seems to follow from common experience is just attorney argument and not the kind of factual evidence that is required to rebut a prima facie case of obviousness."). See MPEP 2145(I) and 716.01(c)(II). Conclusion No claims are allowed. THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to CHRISTINA TRAN whose telephone number is (571)270-0550. The examiner can normally be reached M-F 7:30 - 5:00pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /C.T./ Examiner, Art Unit 1637 /Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637
Read full office action

Prosecution Timeline

Oct 26, 2022
Application Filed
Nov 16, 2023
Response after Non-Final Action
Sep 17, 2025
Non-Final Rejection — §103
Dec 23, 2025
Response Filed
Feb 02, 2026
Final Rejection — §103
Apr 03, 2026
Response after Non-Final Action

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12584126
MICRORNA INHIBITORS FOR USE IN TREATING METABOLIC DISEASES
2y 5m to grant Granted Mar 24, 2026
Patent 12570707
CODON-OPTIMISED COMPLEMENT FACTOR I
2y 5m to grant Granted Mar 10, 2026
Patent 12545893
RECOMBINANT NERVOUS SYSTEM CELLS AND METHODS TO GENERATE THEM
2y 5m to grant Granted Feb 10, 2026
Patent 12529057
THERAPEUTICS FOR SYNGAP HAPLOINSUFFICIENCY
2y 5m to grant Granted Jan 20, 2026
Patent 12522818
METHOD FOR INDUCING DELETION IN GENOMIC DNA
2y 5m to grant Granted Jan 13, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
43%
Grant Probability
62%
With Interview (+19.0%)
3y 10m
Median Time to Grant
Moderate
PTA Risk
Based on 44 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in for Full Analysis

Enter your email to receive a magic link. No password needed.

Free tier: 3 strategy analyses per month