Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Applicant's amendments and remarks filed on June 3, 2026 are acknowledged. Claims 2-17, 19-25, 27-30, 36-45, 47-74, 77, 79, 81-82, 86-87, and 89-142 have been canceled. Claims 1, 84, and 144 were amended. Claims 1, 18, 26, 31-35, 46, 75, 76, 78, 80, 83, 84, 85, 88, and 143-145 are pending and are examined on the merits herein.
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on June 3, 2026 has been entered.
Priority
PNG
media_image1.png
170
428
media_image1.png
Greyscale
Withdrawn Objections
In view of Applicant’s amendments and response, the objections to the abstract, specification, and claim 84 are withdrawn.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1, 18, 26, 31-35, 75, 76, 78, and 88 are rejected under 35 U.S.C. 103 as being unpatentable over Shanahan Jr. et al. (US 8,518,904; reference previously cited by the Examiner) in view of Bleicher et al. (WO 2019/122282; reference cited by Applicant) and Bermingham et al. (WO 2020/117703).
The following is a new rejection, necessitated by the amendment to the claims in the reply filed June 3, 2026.
Regarding claims 1, 18, 26, 33-35, and 88, Shanahan Jr. et al. teaches compositions comprising oligonucleotides targeted to nucleic acid encoding STAT 6 [abstract]. Instant SEQ ID NO: 185 (designated as Qy) has a 100% match to positions 1994 through 1975 of Shanahan Jr. et al. SEQ ID NO: 4 (designated as Db) as shown in the alignment below.
Query Match 100.0%; Score 20; DB 1; Length 3046;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GCAAGATCCCGGATTCGGTC 20
||||||||||||||||||||
Db 1994 GCAAGATCCCGGATTCGGTC 1975
Shanahan Jr. et al. SEQ ID NO: 4 is the human STAT6 RNA (GenBank accession number NM_003153.1). Shanahan Jr. et al. teaches chimeric oligonucleotides “gapmers” that are 20 nucleotides in length composed of a central “gap” region consisting of ten 2’-deoxynucleotides which is flanked on both sides by five-nucleotide “wings”. The wings are composed of 2’-methoxyethyl (2’-MOE) nucleotides. The internucleoside linkages are phosphorothioate throughout the oligonucleotide and all cytidine residues are 5-methylcytidines [column 34, Example 15]. Shanahan Jr. et al. also teaches that preferred compounds are oligonucleotides about 15 to 30 nucleobases [column 6, lines 43-45] and that antisense oligonucleotides may contain modified backbones (e.g., phosphorothioates), one or more substituted sugar moieties (e.g., 2’-MOE, LNA), and nucleobase modifications or substitutions (e.g., 5-methylcytosine) [Section F, columns 12-15]. Further, Shanahan Jr. et al. teaches that 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability and are presently preferred base substitutions [column 15, lines 44-46].
Regarding claims 31, 32, 75, 76, and 78, Shanahan Jr. et al. teaches that chemically linking the oligonucleotide to one or more moieties or conjugates enhances the activity, cellular distribution, or cellular uptake of the oligonucleotide. Further, conjugate moieties include, but are not limited to, lipid moieties such as cholesterol [column 15, last paragraph bridging to column 16].
However, Shanahan Jr. et al. does not teach packaging of antisense oligonucleotides into extracellular vesicles, specifically exosomes. Shanahan Jr. et al. does not teach an antisense oligonucleotide or the antisense oligonucleotide design as recited in claim 1 wherein the ASO reduces STAT6 expression by at least 50% at 2 nM or wherein all of the cytosine nucleobases are 5’-methylcytosine (claim 18). Shanahan Jr. et al. also does not teach an exogenous targeting moiety wherein the exogenous targeting moiety comprises a peptide (claims 33-35).
Bleicher et al. teaches that antisense oligonucleotides may be effectively delivered via exosomes [page 56, lines 3-32]. Bleicher et al. also teaches that conjugation of the oligonucleotide to one or more non-nucleotide moieties may improve the pharmacology of the oligonucleotide, modify or enhance the pharmacokinetic properties of the oligonucleotide, or the conjugate may target the oligonucleotide to a specific organ, tissue or cell type wherein the non-nucleotide moiety (conjugate moiety) includes peptides [page 57, second and fifth paragraphs]. Bleicher et al. teaches that the overall length of the gapmer design F-G-F’ may be from 14 to 22 nucleotides [page 44, last paragraph] wherein one or more sugar modified nucleosides such as LNA in the F and F’ regions enhance the affinity of the oligonucleotide for the target nucleic acid [page 44, first full paragraph] and the gap region (region G) comprises DNA nucleosides which enables the oligonucleotide to recruit RNase H [page 45, lines 10-11] and consists of 14 contiguous DNA nucleosides [page 45, line 18].
Bermingham et al. teaches compositions to treat trinucleotide repeat expansion disorders [abstract]. Bermingham et al. also teaches that in some aspects, the oligonucleotide exhibits at least 50% mRNA inhibition at a 2 nM oligonucleotide concentration when determined using a cell assay when compared with a control cell [page 5, last paragraph bridging to page 6].
Although Shanahan Jr. et al. does not teach an antisense oligonucleotide, it would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to design an antisense oligonucleotide according to claim 1 wherein the ASO reduces STAT6 expression by at least 50% at 2 nM using the design principles taught by Shanahan Jr. et al. and Bleicher et al. because it would have amounted to applying known design principles to a known STAT6 RNA sequence to yield predictable results. One of ordinary skill in the art would have been motivated to do so because Shanahan Jr. et al. taught that there are no known therapeutic agents that effectively inhibit the synthesis of STAT 6 and thus there remains a long felt need for additional agents capable of effectively inhibiting STAT 6 function [column 2, last full paragraph]. Shanahan Jr. et al. also taught the human STAT6 RNA sequence and taught gapmers with 2’-MOE wings, phosphorothioate linkages, and 5-methylcytidines, Bleicher et al. taught that antisense gapmers are used to inhibit a target nucleic acid via RNase H mediated degradation [page 44, first full paragraph], and Bermingham et al. taught that 50% inhibition can be achieved at a concentration of 2 nM. Further, although Shanahan Jr. et al. does not explicitly teach wherein all of the cytosine nucleobases are 5’-methylcytosines, it would have been obvious to try because Shanahan Jr. et al. taught that there are no known therapeutic agents that effectively inhibit the synthesis of STAT 6 and thus there remains a long felt need for additional agents capable of effectively inhibiting STAT 6 function [column 2, last full paragraph]. Further, the antisense oligonucleotide consists of a finite number of nucleobases and thus one of ordinary skill in the art would have been motivated to test the effect of modifying the antisense oligonucleotide wherein all of the cytosine nucleobases are 5’-methylcytosines because Shanahan Jr. et al. taught that 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability and are presently preferred base substitutions.
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to package the oligonucleotide of Shanahan Jr. et al. and Bermingham et al. into an exosome because Shanahan Jr. et al. and Bermingham et al. taught an antisense oligonucleotide according to claim 1 wherein the ASO reduces STAT6 expression by at least 50% at 2 nM and Bleicher et al. taught that antisense oligonucleotides may be effectively delivered via exosomes. One of ordinary skill in the art would have made such a modification because it would have amounted to combining known prior art elements to yield predictable results.
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to further engineer the extracellular vesicle of Shanahan Jr. et al., Bleicher et al., and Bermingham et al. to comprise an exogenous peptide targeting moiety because Shanahan Jr. et al., Bleicher et al., and Bermingham et al. taught an exosome comprising an antisense oligonucleotide according to claim 1 wherein the ASO reduces STAT6 expression by at least 50% at 2 nM and Bleicher et al. taught that conjugation of an oligonucleotide to one or more non-nucleotide moieties may improve the pharmacology of the oligonucleotide, modify or enhance the pharmacokinetic properties of the oligonucleotide, or the conjugate may target the oligonucleotide to a specific organ, tissue or cell type wherein the non-nucleotide moiety (conjugate moiety) includes peptides. One of ordinary skill in the art would have made such a modification because it would have amounted to combining known prior art elements to yield predictable results.
Claim 46 is rejected under 35 U.S.C. 103 as being unpatentable over Shanahan Jr. et al. (US 8,518,904; reference previously cited by the Examiner) in view of Bleicher et al. (WO 2019/122282; reference cited by Applicant) and Bermingham et al. (WO 2020/117703) as applied to claims 1, 18, 26, 31-35, 75, 76, 78, and 88 above, and further in view of Villiger et al. (US 2019/0085284; reference previously cited by the Examiner).
Regarding claim 46, the teachings of Shanahan Jr. et al., Bleicher et al., and Bermingham et al. are discussed above.
However, Shanahan Jr. et al., Bleicher et al., and Bermingham et al. do not teach the extracellular vesicle of claim 1 wherein the extracellular vesicle is produced from a cell that overexpresses a PTGFRN protein.
Villiger et al. teaches the cells producing extracellular vesicles are engineered to overexpress one or more exosome-specific proteins, thereby generating extracellular vesicles overexpressing said one or more exosome-specific proteins wherein the one or more exosome-specific protein is a surface protein such as PTGFRN [0049].
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to use the method of Villiger et al. to produce the extracellular vesicle of Shanahan Jr. et al., Bleicher et al., and Bermingham et al. with a reasonable expectation of success because Villiger et al. taught that cells producing extracellular vesicles are engineered to overexpress one or more exosome-specific proteins, thereby generating extracellular vesicles overexpressing said one or more exosome-specific proteins wherein the one or more exosome-specific protein is a surface protein such as PTGFRN and Shanahan Jr. et al., Bleicher et al., and Bermingham et al. taught an extracellular vesicle comprising an antisense oligonucleotide according to claim 1 wherein the ASO reduces STAT6 expression by at least 50% at 2 nM. One of ordinary skill in the art would have made such a modification because it would have amounted to applying a known technique to yield predictable results.
Claims 80, 83, 84, 85, and 143 are rejected under 35 U.S.C. 103 as being unpatentable over Shanahan Jr. et al. (US 8,518,904; reference previously cited by the Examiner) in view of Bleicher et al. (WO 2019/122282; reference cited by Applicant) and Bermingham et al. (WO 2020/117703) as applied to claims 1, 18, 26, 31-35, 75, 76, 78, and 88 above, and further in view of Haraszti et al. (Molecular Therapy 2018; reference previously cited by the Examiner) and Musumeci et al. (Molecules 2012; reference previously cited by the Examiner).
Regarding claims 80, 83, 84, 85, and 143, the teachings of Shanahan Jr. et al., Bleicher et al., and Bermingham et al. are discussed above.
However, Shanahan Jr. et al., Bleicher et al., and Bermingham et al. do not teach the limitations of the linker as recited in instant claims 80, 83, 84, 85, and 143.
Haraszti et al. teaches that TEG and C7 linkers were used to conjugate cholesterol to siRNAs [page 1974, left column, last paragraph]. Haraszti et al. also discloses that cholesterol conjugation-mediated loading of siRNAs onto extracellular vesicles is among the most reproducible and scalable loading strategies [page 1973, right column, first full paragraph]. Furthermore, Haraszti et al. discloses the use of hydrophobic modification as a strategy for productive loading of RNA cargo onto extracellular vesicles and teaches that a similar optimization strategy is likely needed when taking advantage of extracellular vesicles for in vivo delivery of other oligonucleotide species such as antisense oligonucleotides [page 1978, left column, fourth full paragraph]. Haraszti et al. also teaches that introducing cleavable linkers enhances silencing activity of conjugated siRNAs [page 1977, left column, last paragraph].
Musumeci et al. teaches hexaethylene glycol (HEG) is a longer and more polar spacer than TEG [page 12380, first full paragraph]. Further, the HEG spacer has a higher flexibility compared to mono-ethylene glycol wherein the latter spacer may not be long enough to prevent cholesterol from partially hampering due to steric hindrance [page 12384, third full paragraph].
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the extracellular vesicle of Shanahan Jr. et al., Bleicher et al., and Bermingham et al. by conjugating the siRNA to hydrophobic cholesterol via a TEG and HEG linker because Shanahan Jr. et al., Bleicher et al., and Bermingham et al. taught an extracellular vesicle comprising an antisense oligonucleotide according to claim 1 wherein the ASO reduces STAT6 expression by at least 50% at 2 nM, both Haraszti et al. and Musumeci et al. taught that it is within the skill of the art to use linkers for cholesterol conjugation, Haraszti et al. taught the use of hydrophobic modification as a strategy for productive loading of RNA cargo onto extracellular vesicles and taught that a similar optimization strategy is likely needed when taking advantage of extracellular vesicles for in vivo delivery of other oligonucleotide species such as antisense oligonucleotides, and Musumeci et al. taught that the HEG spacer has a higher flexibility compared to mono-ethylene glycol wherein the latter spacer may not be long enough to prevent cholesterol from partially hampering due to steric hindrance. One of ordinary skill in the art would have made such a modification because it would have amounted to combining known prior art elements to yield predictable results.
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the extracellular vesicle of Shanahan Jr. et al., Bleicher et al., and Bermingham et al. by linking the antisense oligonucleotide to the anchoring moiety by a cleavable linker because Shanahan Jr. et al., Bleicher et al., and Bermingham et al. taught an extracellular vesicle comprising an antisense oligonucleotide according to claim 1 wherein the ASO reduces STAT6 expression by at least 50% at 2 nM and Haraszti et al. taught that introducing cleavable linkers enhances silencing activity of conjugated siRNAs. One of ordinary skill in the art would have made such a modification because it would have amounted to combining known prior art elements to yield predictable results.
Claims 144 and 145 are rejected under 35 U.S.C. 103 as being unpatentable over Shanahan Jr. et al. (US 8,518,904; reference previously cited by the Examiner) in view of Bleicher et al. (WO 2019/122282; reference cited by Applicant), Bermingham et al. (WO 2020/117703), Haraszti et al. (Molecular Therapy 2018; reference previously cited by the Examiner), and Musumeci et al. (Molecules 2012; reference previously cited by the Examiner).
Regarding claims 144 and 145, Shanahan Jr. et al. teaches compositions comprising oligonucleotides targeted to nucleic acid encoding STAT 6 [abstract]. Instant SEQ ID NO: 185 (designated as Qy) has a 100% match to positions 1994 through 1975 of Shanahan Jr. et al. SEQ ID NO: 4 (designated as Db) as shown in the alignment below.
Query Match 100.0%; Score 20; DB 1; Length 3046;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GCAAGATCCCGGATTCGGTC 20
||||||||||||||||||||
Db 1994 GCAAGATCCCGGATTCGGTC 1975
Shanahan Jr. et al. SEQ ID NO: 4 is the human STAT6 RNA (GenBank accession number NM_003153.1). Shanahan Jr. et al. teaches chimeric oligonucleotides “gapmers” that are 20 nucleotides in length composed of a central “gap” region consisting of ten 2’-deoxynucleotides which is flanked on both sides by five-nucleotide “wings”. The wings are composed of 2’-methoxyethyl (2’-MOE) nucleotides. The internucleoside linkages are phosphorothioate throughout the oligonucleotide and all cytidine residues are 5-methylcytidines [column 34, Example 15]. Shanahan Jr. et al. also teaches that preferred compounds are oligonucleotides about 15 to 30 nucleobases [column 6, lines 43-45] and that antisense oligonucleotides may contain modified backbones (e.g., phosphorothioates), one or more substituted sugar moieties (e.g., 2’-MOE, LNA), and nucleobase modifications or substitutions (e.g., 5-methylcytosine) [Section F, columns 12-15]. Further, Shanahan Jr. et al. teaches that 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability and are presently preferred base substitutions [column 15, lines 44-46]. Shanahan Jr. et al. teaches that chemically linking the oligonucleotide to one or more moieties or conjugates enhances the activity, cellular distribution, or cellular uptake of the oligonucleotide. Further, conjugate moieties include, but are not limited to, lipid moieties such as cholesterol [column 15, last paragraph bridging to column 16].
However, Shanahan Jr. et al. does not teach packaging of antisense oligonucleotides into extracellular vesicles, specifically exosomes. Shanahan Jr. et al. also does not teach an antisense oligonucleotide or the antisense oligonucleotide design as recited in claim 144 wherein the ASO reduces STAT6 expression by at least 50% at 2 nM. Further, Shanahan Jr. et al. does not teach an antisense oligonucleotide wherein all of the cytosine nucleobases are 5’-methylcytosine and wherein each of the internucleoside linkages is a phosphorothioate linkage. Shanahan Jr. et al. also does not teach wherein the antisense oligonucleotide is linked to cholesterol by a linker comprising TEG and HEG.
Bleicher et al. teaches that antisense oligonucleotides may be effectively delivered via exosomes [page 56, lines 3-32]. Bleicher et al. teaches that the overall length of the gapmer design F-G-F’ may be from 14 to 22 nucleotides [page 44, last paragraph] wherein one or more sugar modified nucleosides such as LNA in the F and F’ regions enhance the affinity of the oligonucleotide for the target nucleic acid [page 44, first full paragraph] and the gap region (region G) comprises DNA nucleosides which enables the oligonucleotide to recruit RNase H [page 45, lines 10-11] and consists of 14 contiguous DNA nucleosides [page 45, line 18]. Bleicher et al. also teaches that phosphorothioate internucleoside linkages are useful due to nuclease resistance, beneficial pharmacokinetics and ease of manufacture. Further, Bleicher et al. teaches that all of the internucleoside linkages of the oligonucleotide are phosphorothioate linkages [page 25, last paragraph bridging to page 26].
Bermingham et al. teaches compositions to treat trinucleotide repeat expansion disorders [abstract]. Bermingham et al. also teaches that in some aspects, the oligonucleotide exhibits at least 50% mRNA inhibition at a 2 nM oligonucleotide concentration when determined using a cell assay when compared with a control cell [page 5, last paragraph bridging to page 6].
Haraszti et al. teaches that TEG and C7 linkers were used to conjugate cholesterol to siRNAs [page 1974, left column, last paragraph]. Haraszti et al. also discloses that cholesterol conjugation-mediated loading of siRNAs onto extracellular vesicles is among the most reproducible and scalable loading strategies [page 1973, right column, first full paragraph]. Furthermore, Haraszti et al. discloses the use of hydrophobic modification as a strategy for productive loading of RNA cargo onto extracellular vesicles and teaches that a similar optimization strategy is likely needed when taking advantage of extracellular vesicles for in vivo delivery of other oligonucleotide species such as antisense oligonucleotides [page 1978, left column, fourth full paragraph].
Musumeci et al. teaches hexaethylene glycol (HEG) is a longer and more polar spacer than TEG [page 12380, first full paragraph]. Further, the HEG spacer has a higher flexibility compared to mono-ethylene glycol wherein the latter spacer may not be long enough to prevent cholesterol from partially hampering due to steric hindrance [page 12384, third full paragraph].
Although Shanahan Jr. et al. does not teach an antisense oligonucleotide, it would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to design an antisense oligonucleotide according to claim 144 wherein the ASO reduces STAT6 expression by at least 50% at 2 nM using the design principles taught by Shanahan Jr. et al. and Bleicher et al. because it would have amounted to applying known design principles to a known STAT6 RNA sequence to yield predictable results. One of ordinary skill in the art would have been motivated to do so because Shanahan Jr. et al. taught that there are no known therapeutic agents that effectively inhibit the synthesis of STAT 6 and thus there remains a long felt need for additional agents capable of effectively inhibiting STAT 6 function [column 2, last full paragraph]. Shanahan Jr. et al. also taught the human STAT6 RNA sequence and taught gapmers with 2’-MOE wings, phosphorothioate linkages, and 5-methylcytidines, Bleicher et al. taught that antisense gapmers are used to inhibit a target nucleic acid via RNase H mediated degradation [page 44, first full paragraph], and Bermingham et al. taught that 50% inhibition can be achieved at a concentration of 2 nM. Further, although Shanahan Jr. et al. does not explicitly teach wherein all of the cytosine nucleobases are 5’-methylcytosines, it would have been obvious to try because Shanahan Jr. et al. taught that there are no known therapeutic agents that effectively inhibit the synthesis of STAT 6 and thus there remains a long felt need for additional agents capable of effectively inhibiting STAT 6 function [column 2, last full paragraph]. Further, the antisense oligonucleotide consists of a finite number of nucleobases and thus one of ordinary skill in the art would have been motivated to test the effect of modifying the antisense oligonucleotide wherein all of the cytosine nucleobases are 5’-methylcytosines because Shanahan Jr. et al. taught that 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability and are presently preferred base substitutions.
In addition, it would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to conjugate the siRNA to hydrophobic cholesterol via a TEG and HEG linker and package the antisense oligonucleotide into an exosome because Shanahan Jr. et al., Bleicher et al., and Bermingham et al. taught an antisense oligonucleotide according to claim 144 wherein the ASO reduces STAT6 expression by at least 50% at 2 nM, Bleicher et al. also taught that antisense oligonucleotides may be effectively delivered via exosomes, both Haraszti et al. and Musumeci et al. taught that it is within the skill of the art to use linkers for cholesterol conjugation, Haraszti et al. taught the use of hydrophobic modification as a strategy for productive loading of RNA cargo onto extracellular vesicles and taught that a similar optimization strategy is likely needed when taking advantage of extracellular vesicles for in vivo delivery of other oligonucleotide species such as antisense oligonucleotides, and Musumeci et al. taught that the HEG spacer has a higher flexibility compared to mono-ethylene glycol wherein the latter spacer may not be long enough to prevent cholesterol from partially hampering due to steric hindrance. One of ordinary skill in the art would have made such a modification because it would have amounted to combining known prior art elements to yield predictable results.
Response to Arguments
Applicant's arguments filed June 3, 2026 have been fully considered but they are not persuasive.
Applicant asserts the following:
PNG
media_image2.png
366
798
media_image2.png
Greyscale
PNG
media_image3.png
246
794
media_image3.png
Greyscale
PNG
media_image4.png
362
810
media_image4.png
Greyscale
These arguments are not found persuasive. Shanahan Jr. et al. teaches compounds and compositions capable of modulating STAT6 expression wherein the compositions comprise oligonucleotides targeted to nucleic acid encoding STAT6 [abstract]. Shanahan Jr. et al. also teaches that a series of antisense compounds were designed to target different regions of the human STAT 6 RNA using published sequences (GenBank accession number NM_003153.1, SEQ ID NO: 4) [column 34, last paragraph]. Further, Shanahan Jr. et al. teaches that preferred target segments are locations on the target nucleic acid to which the preferred antisense compounds hybridize [column 9, first full paragraph]. While the specific sequences of certain preferred target segments are set forth, additional preferred target segments may be identified by one having ordinary skill [column 9, second full paragraph]. Finally, once one or more target regions, segments or sites have been identified, antisense compounds are chosen which are sufficiently complementary to the target to give the desired effect [column 9, fifth full paragraph]. Shanahan Jr. et al. teaches chimeric oligonucleotides “gapmers” that are 20 nucleotides in length composed of a central “gap” region consisting of ten 2’-deoxynucleotides which is flanked on both sides by five-nucleotide “wings”. The wings are composed of 2’-methoxyethyl (2’-MOE) nucleotides. The internucleoside linkages are phosphorothioate throughout the oligonucleotide and all cytidine residues are 5-methylcytidines [column 34, Example 15]. Shanahan Jr. et al. also teaches that preferred compounds are oligonucleotides about 15 to 30 nucleobases [column 6, lines 43-45] and that antisense oligonucleotides may contain modified backbones (e.g., phosphorothioates), one or more substituted sugar moieties (e.g., 2’-MOE, LNA), and nucleobase modifications or substitutions (e.g., 5-methylcytosine) [Section F, columns 12-15] (emphasis added).
Shanahan Jr. et al. does not teach that the ASO reduces STAT6 expression by at least 50% at 2 nM; however, Bermingham et al. does teach that an oligonucleotide exhibits at least 50% mRNA inhibition at a 2 nM oligonucleotide concentration. Therefore, based on the teachings of Bermingham et al., one of ordinary skill in the art before the effective filing date of the claimed invention would design an antisense oligonucleotide according to claim 1 wherein the ASO reduces STAT6 expression by at least 50% at 2 nM using the design principles taught by Shanahan Jr. et al. and Bleicher et al. because it would have amounted to applying known design principles to a known STAT6 RNA sequence to yield predictable results.
With respect to Applicant’s arguments regarding the Bleicher et al. reference, Bleicher et al. was used in combination with Shanahan Jr. et al. to render obvious the limitations of the claims because Shanahan Jr. et al. did not teach packaging of antisense oligonucleotides into extracellular vesicles (specifically, exosomes), Shanahan Jr. et al. did not teach an antisense oligonucleotide or the antisense oligonucleotide design as recited in claims 1 and 144, and Shanahan Jr. et al. did not teach an exogenous targeting moiety wherein the exogenous targeting moiety comprises a peptide.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1, 18, 26, 31-35, 46, 75, 76, 78, 80, 83, 84, 85, 88, and 143-145 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 2, 91, and 116 of copending Application No. 17/763,996 in view of Shanahan Jr. et al. (US 8,518,904; reference previously cited by the Examiner), Bleicher et al. (WO 2019/122282; reference cited by Applicant), Bermingham et al. (WO 2020/117703), Villiger et al. (US 2019/0085284; reference previously cited by the Examiner), Haraszti et al. (Molecular Therapy 2018; reference previously cited by the Examiner), and Musumeci et al. (Molecules 2012; reference previously cited by the Examiner).
PNG
media_image5.png
334
648
media_image5.png
Greyscale
PNG
media_image6.png
104
630
media_image6.png
Greyscale
PNG
media_image7.png
112
476
media_image7.png
Greyscale
PNG
media_image8.png
168
620
media_image8.png
Greyscale
Instant SEQ ID NO: 185 (designated as Qy) has a 100% match to ‘996 SEQ ID NO: 185 (designated as Db) as shown in the alignment below.
Query Match 100.0%; Score 20; DB 1; Length 20;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GCAAGATCCCGGATTCGGTC 20
||||||||||||||||||||
Db 1 GCAAGATCCCGGATTCGGTC 20
However, ‘996 does not teach the antisense oligonucleotide design as recited in the instant claims wherein the ASO reduces STAT6 expression by at least 50% at 2 nM, wherein all of the cytosine nucleobases in the ASO are 5’-methylcytosine nucleobases, wherein the ASO is linked to an exogenous targeting moiety comprising a peptide, wherein the EV is produced from a cell which overexpresses a PTGFRN protein, wherein the linker comprises a PEG or TEG or is a cleavable linker, or wherein the ASO is linked to cholesterol by a linker comprising TEG and HEG.
Shanahan Jr. et al. teaches chimeric oligonucleotides “gapmers” that are 20 nucleotides in length composed of a central “gap” region consisting of ten 2’-deoxynucleotides which is flanked on both sides by five-nucleotide “wings”. The wings are composed of 2’-methoxyethyl (2’-MOE) nucleotides. The internucleoside linkages are phosphorothioate throughout the oligonucleotide and all cytidine residues are 5-methylcytidines [column 34, Example 15]. Shanahan Jr. et al. also teaches that preferred compounds are oligonucleotides about 15 to 30 nucleobases [column 6, lines 43-45] and that antisense oligonucleotides may contain modified backbones (e.g., phosphorothioates), one or more substituted sugar moieties (e.g., 2’-MOE, LNA), and nucleobase modifications or substitutions (e.g., 5-methylcytosine) [Section F, columns 12-15]. Further, Shanahan Jr. et al. teaches that 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability and are presently preferred base substitutions [column 15, lines 44-46]. Shanahan Jr. et al. teaches that chemically linking the oligonucleotide to one or more moieties or conjugates enhances the activity, cellular distribution, or cellular uptake of the oligonucleotide. Further, conjugate moieties include, but are not limited to, lipid moieties such as cholesterol [column 15, last paragraph bridging to column 16].
Bleicher et al. teaches that antisense oligonucleotides may be effectively delivered via exosomes [page 56, lines 3-32]. Bleicher et al. also teaches that conjugation of the oligonucleotide to one or more non-nucleotide moieties may improve the pharmacology of the oligonucleotide, modify or enhance the pharmacokinetic properties of the oligonucleotide, or the conjugate may target the oligonucleotide to a specific organ, tissue or cell type wherein the non-nucleotide moiety (conjugate moiety) includes peptides [page 57, second and fifth paragraphs]. Bleicher et al. teaches that the overall length of the gapmer design F-G-F’ may be from 14 to 22 nucleotides [page 44, last paragraph] wherein one or more sugar modified nucleosides such as LNA in the F and F’ regions enhance the affinity of the oligonucleotide for the target nucleic acid [page 44, first full paragraph] and the gap region (region G) comprises DNA nucleosides which enables the oligonucleotide to recruit RNase H [page 45, lines 10-11] and consists of 14 contiguous DNA nucleosides [page 45, line 18].
Bermingham et al. teaches compositions to treat trinucleotide repeat expansion disorders [abstract]. Bermingham et al. also teaches that in some aspects, the oligonucleotide exhibits at least 50% mRNA inhibition at a 2 nM oligonucleotide concentration when determined using a cell assay when compared with a control cell [page 5, last paragraph bridging to page 6].
Villiger et al. teaches the cells producing extracellular vesicles are engineered to overexpress one or more exosome-specific proteins, thereby generating extracellular vesicles overexpressing said one or more exosome-specific proteins wherein the one or more exosome-specific protein is a surface protein such as PTGFRN [0049].
Haraszti et al. teaches that TEG and C7 linkers were used to conjugate cholesterol to siRNAs [page 1974, left column, last paragraph]. Haraszti et al. also discloses that cholesterol conjugation-mediated loading of siRNAs onto extracellular vesicles is among the most reproducible and scalable loading strategies [page 1973, right column, first full paragraph]. Furthermore, Haraszti et al. discloses the use of hydrophobic modification as a strategy for productive loading of RNA cargo onto extracellular vesicles and teaches that a similar optimization strategy is likely needed when taking advantage of extracellular vesicles for in vivo delivery of other oligonucleotide species such as antisense oligonucleotides [page 1978, left column, fourth full paragraph]. Haraszti et al. also teaches that introducing cleavable linkers enhances silencing activity of conjugated siRNAs [page 1977, left column, last paragraph].
Musumeci et al. teaches hexaethylene glycol (HEG) is a longer and more polar spacer than TEG [page 12380, first full paragraph]. Further, the HEG spacer has a higher flexibility compared to mono-ethylene glycol wherein the latter spacer may not be long enough to prevent cholesterol from partially hampering due to steric hindrance [page 12384, third full paragraph].
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the antisense oligonucleotide of ‘996 and arrive at the instantly claimed antisense oligonucleotide wherein the ASO reduces STAT6 expression by at least 50% at 2 nM using the design principles taught by Shanahan Jr. et al. and Bleicher et al. because it would have amounted to applying known design principles to yield predictable results. One of ordinary skill in the art would have been motivated to do so because Shanahan Jr. et al. taught that there are no known therapeutic agents that effectively inhibit the synthesis of STAT 6 and thus there remains a long felt need for additional agents capable of effectively inhibiting STAT 6 function [column 2, last full paragraph]. Shanahan Jr. et al. taught gapmers with 2’-MOE wings, phosphorothioate linkages, and 5-methylcytidines, Bleicher et al. taught that antisense gapmers are used to inhibit a target nucleic acid via RNase H mediated degradation [page 44, first full paragraph], and Bermingham et al. taught that 50% inhibition can be achieved at a concentration of 2 nM. Further, although Shanahan Jr. et al. does not explicitly teach wherein all of the cytosine nucleobases are 5’-methylcytosines, it would have been obvious to try because Shanahan Jr. et al. taught that there are no known therapeutic agents that effectively inhibit the synthesis of STAT 6 and thus there remains a long felt need for additional agents capable of effectively inhibiting STAT 6 function [column 2, last full paragraph]. Further, the antisense oligonucleotide consists of a finite number of nucleobases and thus one of ordinary skill in the art would have been motivated to test the effect of modifying the antisense oligonucleotide wherein all of the cytosine nucleobases are 5’-methylcytosines because Shanahan Jr. et al. taught that 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability and are presently preferred base substitutions.
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to further engineer the extracellular vesicle of ‘996 to comprise an exogenous peptide targeting moiety because ‘996, Shanahan Jr. et al., Bleicher et al., and Bermingham et al. taught an exosome comprising an antisense oligonucleotide according to the instant claims wherein the ASO reduces STAT6 expression by at least 50% at 2 nM and Bleicher et al. taught that conjugation of an oligonucleotide to one or more non-nucleotide moieties may improve the pharmacology of the oligonucleotide, modify or enhance the pharmacokinetic properties of the oligonucleotide, or the conjugate may target the oligonucleotide to a specific organ, tissue or cell type wherein the non-nucleotide moiety (conjugate moiety) includes peptides. One of ordinary skill in the art would have made such a modification because it would have amounted to combining known prior art elements to yield predictable results.
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to use the method of Villiger et al. to produce the extracellular vesicle of ‘996, Shanahan Jr. et al., Bleicher et al., and Bermingham et al. with a reasonable expectation of success because Villiger et al. taught that cells producing extracellular vesicles are engineered to overexpress one or more exosome-specific proteins, thereby generating extracellular vesicles overexpressing said one or more exosome-specific proteins wherein the one or more exosome-specific protein is a surface protein such as PTGFRN and ‘996, Shanahan Jr. et al., Bleicher et al., and Bermingham et al. taught an extracellular vesicle comprising an antisense oligonucleotide according to the instant claims wherein the ASO reduces STAT6 expression by at least 50% at 2 nM. One of ordinary skill in the art would have made such a modification because it would have amounted to applying a known technique to yield predictable results.
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the extracellular vesicle of ‘996, Shanahan Jr. et al., Bleicher et al., and Bermingham et al. by conjugating the siRNA to hydrophobic cholesterol via a TEG and HEG linker because ‘996, Shanahan Jr. et al., Bleicher et al., and Bermingham et al. taught an extracellular vesicle comprising an antisense oligonucleotide according to the instant claims wherein the ASO reduces STAT6 expression by at least 50% at 2 nM, both Haraszti et al. and Musumeci et al. taught that it is within the skill of the art to use linkers for cholesterol conjugation, Haraszti et al. taught the use of hydrophobic modification as a strategy for productive loading of RNA cargo onto extracellular vesicles and taught that a similar optimization strategy is likely needed when taking advantage of extracellular vesicles for in vivo delivery of other oligonucleotide species such as antisense oligonucleotides, and Musumeci et al. taught that the HEG spacer has a higher flexibility compared to mono-ethylene glycol wherein the latter spacer may not be long enough to prevent cholesterol from partially hampering due to steric hindrance. One of ordinary skill in the art would have made such a modification because it would have amounted to combining known prior art elements to yield predictable results.
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the extracellular vesicle of ‘996, Shanahan Jr. et al., Bleicher et al., and Bermingham et al. by linking the antisense oligonucleotide to the anchoring moiety by a cleavable linker because ‘996, Shanahan Jr. et al., Bleicher et al., and Bermingham et al. taught an extracellular vesicle comprising an antisense oligonucleotide according to the instant claims wherein the ASO reduces STAT6 expression by at least 50% at 2 nM and Haraszti et al. taught that introducing cleavable linkers enhances silencing activity of conjugated siRNAs. One of ordinary skill in the art would have made such a modification because it would have amounted to combining known prior art elements to yield predictable results.
This is a provisional nonstatutory double patenting rejection.
Claims 1, 18, 26, 31-35, 46, 75, 76, 78, 80, 83, 84, 85, 88, and 143-145 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 57, 59, and 64 of copending Application No. 18/552,778 in view of Shanahan Jr. et al. (US 8,518,904; reference previously cited by the Examiner), Bleicher et al. (WO 2019/122282; reference cited by Applicant), Bermingham et al. (WO 2020/117703), Villiger et al. (US 2019/0085284; reference previously cited by the Examiner), Haraszti et al. (Molecular Therapy 2018; reference previously cited by the Examiner), and Musumeci et al. (Molecules 2012; reference previously cited by the Examiner).
PNG
media_image9.png
232
646
media_image9.png
Greyscale
PNG
media_image10.png
54
636
media_image10.png
Greyscale
PNG
media_image11.png
248
642
media_image11.png
Greyscale
PNG
media_image12.png
50
650
media_image12.png
Greyscale
Instant SEQ ID NO: 185 (designated as Qy) has a 100% match to ‘778 SEQ ID NO: 185 (designated as Db) as shown in the alignment below.
Query Match 100.0%; Score 20; DB 1; Length 20;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GCAAGATCCCGGATTCGGTC 20
||||||||||||||||||||
Db 1 GCAAGATCCCGGATTCGGTC 20
However, ‘778 does not teach the antisense oligonucleotide design as recited in the instant claims wherein the ASO reduces STAT6 expression by at least 50% at 2 nM, wherein all of the cytosine nucleobases in the ASO are 5’-methylcytosine nucleobases, wherein the ASO is linked to an exogenous targeting moiety comprising a peptide, wherein the EV is produced from a cell which overexpresses a PTGFRN protein, wherein the linker comprises a PEG or TEG or is a cleavable linker, or wherein the ASO is linked to cholesterol by a linker comprising TEG and HEG.
Shanahan Jr. et al. teaches chimeric oligonucleotides “gapmers” that are 20 nucleotides in length composed of a central “gap” region consisting of ten 2’-deoxynucleotides which is flanked on both sides by five-nucleotide “wings”. The wings are composed of 2’-methoxyethyl (2’-MOE) nucleotides. The internucleoside linkages are phosphorothioate throughout the oligonucleotide and all cytidine residues are 5-methylcytidines [column 34, Example 15]. Shanahan Jr. et al. also teaches that preferred compounds are oligonucleotides about 15 to 30 nucleobases [column 6, lines 43-45] and that antisense oligonucleotides may contain modified backbones (e.g., phosphorothioates), one or more substituted sugar moieties (e.g., 2’-MOE, LNA), and nucleobase modifications or substitutions (e.g., 5-methylcytosine) [Section F, columns 12-15]. Further, Shanahan Jr. et al. teaches that 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability and are presently preferred base substitutions [column 15, lines 44-46]. Shanahan Jr. et al. teaches that chemically linking the oligonucleotide to one or more moieties or conjugates enhances the activity, cellular distribution, or cellular uptake of the oligonucleotide. Further, conjugate moieties include, but are not limited to, lipid moieties such as cholesterol [column 15, last paragraph bridging to column 16].
Bleicher et al. teaches that antisense oligonucleotides may be effectively delivered via exosomes [page 56, lines 3-32]. Bleicher et al. also teaches that conjugation of the oligonucleotide to one or more non-nucleotide moieties may improve the pharmacology of the oligonucleotide, modify or enhance the pharmacokinetic properties of the oligonucleotide, or the conjugate may target the oligonucleotide to a specific organ, tissue or cell type wherein the non-nucleotide moiety (conjugate moiety) includes peptides [page 57, second and fifth paragraphs]. Bleicher et al. teaches that the overall length of the gapmer design F-G-F’ may be from 14 to 22 nucleotides [page 44, last paragraph] wherein one or more sugar modified nucleosides such as LNA in the F and F’ regions enhance the affinity of the oligonucleotide for the target nucleic acid [page 44, first full paragraph] and the gap region (region G) comprises DNA nucleosides which enables the oligonucleotide to recruit RNase H [page 45, lines 10-11] and consists of 14 contiguous DNA nucleosides [page 45, line 18].
Bermingham et al. teaches compositions to treat trinucleotide repeat expansion disorders [abstract]. Bermingham et al. also teaches that in some aspects, the oligonucleotide exhibits at least 50% mRNA inhibition at a 2 nM oligonucleotide concentration when determined using a cell assay when compared with a control cell [page 5, last paragraph bridging to page 6].
Villiger et al. teaches the cells producing extracellular vesicles are engineered to overexpress one or more exosome-specific proteins, thereby generating extracellular vesicles overexpressing said one or more exosome-specific proteins wherein the one or more exosome-specific protein is a surface protein such as PTGFRN [0049].
Haraszti et al. teaches that TEG and C7 linkers were used to conjugate cholesterol to siRNAs [page 1974, left column, last paragraph]. Haraszti et al. also discloses that cholesterol conjugation-mediated loading of siRNAs onto extracellular vesicles is among the most reproducible and scalable loading strategies [page 1973, right column, first full paragraph]. Furthermore, Haraszti et al. discloses the use of hydrophobic modification as a strategy for productive loading of RNA cargo onto extracellular vesicles and teaches that a similar optimization strategy is likely needed when taking advantage of extracellular vesicles for in vivo delivery of other oligonucleotide species such as antisense oligonucleotides [page 1978, left column, fourth full paragraph]. Haraszti et al. also teaches that introducing cleavable linkers enhances silencing activity of conjugated siRNAs [page 1977, left column, last paragraph].
Musumeci et al. teaches hexaethylene glycol (HEG) is a longer and more polar spacer than TEG [page 12380, first full paragraph]. Further, the HEG spacer has a higher flexibility compared to mono-ethylene glycol wherein the latter spacer may not be long enough to prevent cholesterol from partially hampering due to steric hindrance [page 12384, third full paragraph].
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the antisense oligonucleotide of ‘778 and arrive at the instantly claimed antisense oligonucleotide wherein the ASO reduces STAT6 expression by at least 50% at 2 nM using the design principles taught by Shanahan Jr. et al. and Bleicher et al. because it would have amounted to applying known design principles to yield predictable results. One of ordinary skill in the art would have been motivated to do so because Shanahan Jr. et al. taught that there are no known therapeutic agents that effectively inhibit the synthesis of STAT 6 and thus there remains a long felt need for additional agents capable of effectively inhibiting STAT 6 function [column 2, last full paragraph]. Shanahan Jr. et al. taught gapmers with 2’-MOE wings, phosphorothioate linkages, and 5-methylcytidines, Bleicher et al. taught that antisense gapmers are used to inhibit a target nucleic acid via RNase H mediated degradation [page 44, first full paragraph], and Bermingham et al. taught that 50% inhibition can be achieved at a concentration of 2 nM. Further, although Shanahan Jr. et al. does not explicitly teach wherein all of the cytosine nucleobases are 5’-methylcytosines, it would have been obvious to try because Shanahan Jr. et al. taught that there are no known therapeutic agents that effectively inhibit the synthesis of STAT 6 and thus there remains a long felt need for additional agents capable of effectively inhibiting STAT 6 function [column 2, last full paragraph]. Further, the antisense oligonucleotide consists of a finite number of nucleobases and thus one of ordinary skill in the art would have been motivated to test the effect of modifying the antisense oligonucleotide wherein all of the cytosine nucleobases are 5’-methylcytosines because Shanahan Jr. et al. taught that 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability and are presently preferred base substitutions.
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to further engineer the extracellular vesicle of ‘778 to comprise an exogenous peptide targeting moiety because ‘778, Shanahan Jr. et al., Bleicher et al., and Bermingham et al. taught an exosome comprising an antisense oligonucleotide according to the instant claims wherein the ASO reduces STAT6 expression by at least 50% at 2 nM and Bleicher et al. taught that conjugation of an oligonucleotide to one or more non-nucleotide moieties may improve the pharmacology of the oligonucleotide, modify or enhance the pharmacokinetic properties of the oligonucleotide, or the conjugate may target the oligonucleotide to a specific organ, tissue or cell type wherein the non-nucleotide moiety (conjugate moiety) includes peptides. One of ordinary skill in the art would have made such a modification because it would have amounted to combining known prior art elements to yield predictable results.
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to use the method of Villiger et al. to produce the extracellular vesicle of ‘778, Shanahan Jr. et al., Bleicher et al., and Bermingham et al. with a reasonable expectation of success because Villiger et al. taught that cells producing extracellular vesicles are engineered to overexpress one or more exosome-specific proteins, thereby generating extracellular vesicles overexpressing said one or more exosome-specific proteins wherein the one or more exosome-specific protein is a surface protein such as PTGFRN and ‘778, Shanahan Jr. et al., Bleicher et al., and Bermingham et al. taught an extracellular vesicle comprising an antisense oligonucleotide according to the instant claims wherein the ASO reduces STAT6 expression by at least 50% at 2 nM. One of ordinary skill in the art would have made such a modification because it would have amounted to applying a known technique to yield predictable results.
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the extracellular vesicle of ‘778, Shanahan Jr. et al., Bleicher et al., and Bermingham et al. by conjugating the siRNA to hydrophobic cholesterol via a TEG and HEG linker because ‘778, Shanahan Jr. et al., Bleicher et al., and Bermingham et al. taught an extracellular vesicle comprising an antisense oligonucleotide according to the instant claims wherein the ASO reduces STAT6 expression by at least 50% at 2 nM, both Haraszti et al. and Musumeci et al. taught that it is within the skill of the art to use linkers for cholesterol conjugation, Haraszti et al. taught the use of hydrophobic modification as a strategy for productive loading of RNA cargo onto extracellular vesicles and taught that a similar optimization strategy is likely needed when taking advantage of extracellular vesicles for in vivo delivery of other oligonucleotide species such as antisense oligonucleotides, and Musumeci et al. taught that the HEG spacer has a higher flexibility compared to mono-ethylene glycol wherein the latter spacer may not be long enough to prevent cholesterol from partially hampering due to steric hindrance. One of ordinary skill in the art would have made such a modification because it would have amounted to combining known prior art elements to yield predictable results.
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the extracellular vesicle of ‘778, Shanahan Jr. et al., Bleicher et al., and Bermingham et al. by linking the antisense oligonucleotide to the anchoring moiety by a cleavable linker because ‘778, Shanahan Jr. et al., Bleicher et al., and Bermingham et al. taught an extracellular vesicle comprising an antisense oligonucleotide according to the instant claims wherein the ASO reduces STAT6 expression by at least 50% at 2 nM and Haraszti et al. taught that introducing cleavable linkers enhances silencing activity of conjugated siRNAs. One of ordinary skill in the art would have made such a modification because it would have amounted to combining known prior art elements to yield predictable results.
This is a provisional nonstatutory double patenting rejection.
Claims 1, 18, 26, 31-35, 46, 75, 76, 78, 80, 83, 84, 85, 88, and 143-145 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 3, 4, 6, 12, 13, 22, 26, 32, 36, 45, and 56 of copending Application No. 18/248,036 in view of Shanahan Jr. et al. (US 8,518,904; reference previously cited by the Examiner), Bleicher et al. (WO 2019/122282; reference cited by Applicant), Bermingham et al. (WO 2020/117703), and Villiger et al. (US 2019/0085284; reference previously cited by the Examiner).
PNG
media_image13.png
198
640
media_image13.png
Greyscale
PNG
media_image14.png
220
640
media_image14.png
Greyscale
PNG
media_image15.png
252
628
media_image15.png
Greyscale
PNG
media_image16.png
138
584
media_image16.png
Greyscale
PNG
media_image17.png
366
614
media_image17.png
Greyscale
PNG
media_image18.png
340
626
media_image18.png
Greyscale
PNG
media_image19.png
340
636
media_image19.png
Greyscale
PNG
media_image20.png
150
626
media_image20.png
Greyscale
PNG
media_image21.png
340
636
media_image21.png
Greyscale
PNG
media_image22.png
660
638
media_image22.png
Greyscale
PNG
media_image23.png
144
618
media_image23.png
Greyscale
PNG
media_image24.png
366
630
media_image24.png
Greyscale
PNG
media_image25.png
68
634
media_image25.png
Greyscale
Instant SEQ ID NO: 185 (designated as Qy) is complementary to positions 2084 through 2065 of ‘036 SEQ ID NO: 3 (designated as Db) as shown in the alignment below.
Query Match 100.0%; Score 20; DB 1; Length 3963;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GCAAGATCCCGGATTCGGTC 20
||||||||||||||||||||
Db 2084 GCAAGATCCCGGATTCGGTC 2065
Instant SEQ ID NO: 185 (designated as Qy) has a 100% match to ‘036 SEQ ID NO: 185 (designated as Db) as shown in the alignment below.
Query Match 100.0%; Score 20; DB 1; Length 20;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GCAAGATCCCGGATTCGGTC 20
||||||||||||||||||||
Db 1 GCAAGATCCCGGATTCGGTC 20
However, ‘036 does not teach the antisense oligonucleotide design as recited in the instant claims wherein the ASO reduces STAT6 expression by at least 50% at 2 nM, wherein all of the cytosine nucleobases in the ASO are 5’-methylcytosine nucleobases, and wherein the EV is produced from a cell which overexpresses a PTGFRN protein.
Shanahan Jr. et al. teaches chimeric oligonucleotides “gapmers” that are 20 nucleotides in length composed of a central “gap” region consisting of ten 2’-deoxynucleotides which is flanked on both sides by five-nucleotide “wings”. The wings are composed of 2’-methoxyethyl (2’-MOE) nucleotides. The internucleoside linkages are phosphorothioate throughout the oligonucleotide and all cytidine residues are 5-methylcytidines [column 34, Example 15]. Shanahan Jr. et al. also teaches that preferred compounds are oligonucleotides about 15 to 30 nucleobases [column 6, lines 43-45] and that antisense oligonucleotides may contain modified backbones (e.g., phosphorothioates), one or more substituted sugar moieties (e.g., 2’-MOE, LNA), and nucleobase modifications or substitutions (e.g., 5-methylcytosine) [Section F, columns 12-15]. Further, Shanahan Jr. et al. teaches that 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability and are presently preferred base substitutions [column 15, lines 44-46]. Shanahan Jr. et al. teaches that chemically linking the oligonucleotide to one or more moieties or conjugates enhances the activity, cellular distribution, or cellular uptake of the oligonucleotide. Further, conjugate moieties include, but are not limited to, lipid moieties such as cholesterol [column 15, last paragraph bridging to column 16].
Bleicher et al. teaches that antisense oligonucleotides may be effectively delivered via exosomes [page 56, lines 3-32]. Bleicher et al. also teaches that conjugation of the oligonucleotide to one or more non-nucleotide moieties may improve the pharmacology of the oligonucleotide, modify or enhance the pharmacokinetic properties of the oligonucleotide, or the conjugate may target the oligonucleotide to a specific organ, tissue or cell type wherein the non-nucleotide moiety (conjugate moiety) includes peptides [page 57, second and fifth paragraphs]. Bleicher et al. teaches that the overall length of the gapmer design F-G-F’ may be from 14 to 22 nucleotides [page 44, last paragraph] wherein one or more sugar modified nucleosides such as LNA in the F and F’ regions enhance the affinity of the oligonucleotide for the target nucleic acid [page 44, first full paragraph] and the gap region (region G) comprises DNA nucleosides which enables the oligonucleotide to recruit RNase H [page 45, lines 10-11] and consists of 14 contiguous DNA nucleosides [page 45, line 18].
Bermingham et al. teaches compositions to treat trinucleotide repeat expansion disorders [abstract]. Bermingham et al. also teaches that in some aspects, the oligonucleotide exhibits at least 50% mRNA inhibition at a 2 nM oligonucleotide concentration when determined using a cell assay when compared with a control cell [page 5, last paragraph bridging to page 6].
Villiger et al. teaches the cells producing extracellular vesicles are engineered to overexpress one or more exosome-specific proteins, thereby generating extracellular vesicles overexpressing said one or more exosome-specific proteins wherein the one or more exosome-specific protein is a surface protein such as PTGFRN [0049].
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to design an antisense oligonucleotide and arrive at the instantly claimed antisense oligonucleotide wherein the ASO reduces STAT6 expression by at least 50% at 2 nM using the design principles taught by Shanahan Jr. et al. and Bleicher et al. because it would have amounted to applying known design principles to a known STAT6 RNA sequence to yield predictable results. One of ordinary skill in the art would have been motivated to do so because Shanahan Jr. et al. taught that there are no known therapeutic agents that effectively inhibit the synthesis of STAT 6 and thus there remains a long felt need for additional agents capable of effectively inhibiting STAT 6 function [column 2, last full paragraph]. Shanahan Jr. et al. taught gapmers with 2’-MOE wings, phosphorothioate linkages, and 5-methylcytidines, Bleicher et al. taught that antisense gapmers are used to inhibit a target nucleic acid via RNase H mediated degradation [page 44, first full paragraph], and Bermingham et al. taught that 50% inhibition can be achieved at a concentration of 2 nM. Further, although Shanahan Jr. et al. does not explicitly teach wherein all of the cytosine nucleobases are 5’-methylcytosines, it would have been obvious to try because Shanahan Jr. et al. taught that there are no known therapeutic agents that effectively inhibit the synthesis of STAT 6 and thus there remains a long felt need for additional agents capable of effectively inhibiting STAT 6 function [column 2, last full paragraph]. Further, the antisense oligonucleotide consists of a finite number of nucleobases and thus one of ordinary skill in the art would have been motivated to test the effect of modifying the antisense oligonucleotide wherein all of the cytosine nucleobases are 5’-methylcytosines because Shanahan Jr. et al. taught that 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability and are presently preferred base substitutions.
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to use the method of Villiger et al. to produce the extracellular vesicle of ‘036, Shanahan Jr. et al., Bleicher et al., and Bermingham et al. with a reasonable expectation of success because Villiger et al. taught that cells producing extracellular vesicles are engineered to overexpress one or more exosome-specific proteins, thereby generating extracellular vesicles overexpressing said one or more exosome-specific proteins wherein the one or more exosome-specific protein is a surface protein such as PTGFRN and ‘036, Shanahan Jr. et al., Bleicher et al., and Bermingham et al. taught an extracellular vesicle comprising an antisense oligonucleotide according to the instant claims wherein the ASO reduces STAT6 expression by at least 50% at 2 nM. One of ordinary skill in the art would have made such a modification because it would have amounted to applying a known technique to yield predictable results.
This is a provisional nonstatutory double patenting rejection.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to CHRISTINA TRAN whose telephone number is (571)270-0550. The examiner can normally be reached M-F 7:30 - 5:00pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/C.T./
Examiner, Art Unit 1637
/Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637
Prosecution Insights