DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claim Status
Claims 1-20 are pending. Claims 14 and 19-20 are withdrawn. Claims 1-13 and 15-18 are presently considered.
Election/Restrictions
Applicant’s election without traverse of Group I and the species of SEQ ID NO: 3 (5’END-2) in the reply filed on 11/14/2025 is acknowledged.
The originally elected species is understood as follows: The identification of SEQ ID NO: 3 is understood to correspond to species (ii) Example 1 and the PPMO corresponding to SEQ ID NO: 3 (5’END-2) (see, e.g., Requirement mailed 9/15/2025 at 6). This is reasonable because Applicant indicates that the species reads upon claims 1-18, but SEQ ID NO: 3 alone would not read upon claims 2 or 9-19 in the absence of a peptide or non-natural backbone. If this is incorrect, Applicant should so specify in a subsequent action. For examination, the originally elected species is understood to be consistent with species (ii) of the Requirement mailed 9/15/2026, and is understood to be a phosphorodiamidate morpholino (PMO) having the sequence of SEQ ID NO: 3 (tgttacctgggaaggtataaacctt), wherein the PMO is conjugated to the delivery peptide of SEQ ID NO: 21 (RAhxRRAhxRRAhxRRAhxRAhxB1, wherein R is Arginine, Ahx is 6-aminohexanoic acid, B is beta-alanine). Applicant failed to identify how the peptide was conjugated to the PMO (i.e., at the 5’ or 3’ end of the PMO) as claimed at instant claims 14-15. However, in view of instant claims 16-18, Formulas 1-2, it is reasonably inferred that the originally elected species satisfies Formula 2 and is therefore conjugated at the 3’ end (see, e.g., instant claims 14 and 16-18). Accordingly, the originally elected species does not reasonably read upon instant claim 14. Accordingly, the originally elected species is understood to be a PPMO comprising SEQ ID NOs: 3 and 21, having the structure shown at dependent claim 17, and therefore understood to read upon claims 1-13 and 15-18.
Following extensive search and examination, the originally elected species has been deemed anticipated and/or obvious in view of the prior art as applied below. Per MPEP § 803.02(III)(A),
Following election, the Markush claim will be examined fully with respect to the elected species and further to the extent necessary to determine patentability. Note that where a claim reads on multiple species, only one species needs to be taught or suggested by the prior art in order for the claim to be anticipated or rendered obvious...
If the Markush claim is not allowable, the provisional election will be given effect and examination will be limited to the Markush claim and claims to the elected species, with claims drawn to species patentably distinct from the elected species held withdrawn from further consideration.
Accordingly, claims 1-13 and 15-18 are rejected in view of the originally elected species and claims that do not read upon the originally elected species are withdrawn.
Claim 14 is withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected species, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 11/14/2025.
Claims 19-20 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 11/14/2025.
During the search and examination of the originally elected species, art pertinent to other non-elected species was incidentally discovered. These non-elected species are explicitly identified in the prior art rejections set forth below, and examination has not been further extended at this time.
Claims 1-13 and 15-18 are presently considered.
Priority
The priority claim to US Provisional Application 63/021859 (filed 5/08/2020) is acknowledged. The instant Application is identified as a CIP of PCT/US21/31335 (filed 5/07/2021), and the instant Application was filed 11/07/2022.
Information Disclosure Statement
The IDS filed 2/08/2023 and 10/07/2024 are acknowledged and presently considered.
Claim Interpretation
For purposes of examination, the claim scope has been interpreted as set forth below per the guidance set forth at MPEP § 2111. If Applicant disputes any interpretation, Applicant is invited to unambiguously identify any alleged misinterpretations or specialized definitions in the subsequent response to the instant action. Applicant is advised that a specialized definition should be properly supported and specifically identified (see, e.g., MPEP § 2111.01(IV), describing how Applicant may act as their own lexicographer).
Claim 1 is representative of the pending claim scope, and applicable claim interpretations are set forth below.
“Comprising” is an open-ended transitional term (see, e.g., MPEP § 2111.03(I)), wherein additional steps or components are not excluded. However, “‘[c]omprising’ is a term of art used in claim language which means that the named elements are essential” (see, e.g., id.; see also Genentech, Inc. v. Chiron Corp., 112 F.3d 495, 501, 42 USPQ2d 1608, 1613 (Fed. Cir. 1997)).
The phrase “at least a portion of” is undefined on record. For purposes of examination, it is reasonably inferred to mean any one or more nucleotides.
The phrase “a backbone comprising moieties that sterically block DNA and/or RNA cleavage” is understood to be satisfied by naturally occurring RNA sequences, which are understood to sterically block DNA cleavage by one or more DNases; or by DNA, which are understood to naturally sterically block RNA cleavage by one or more RNAses.
Additional claim interpretations are set forth below.
Claim Rejections
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1-5 and 9-17 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Instant claims 1 and 3-4 refer to the “RNA sequence of SARS-CoV-2” (see instant claim 1), “nucleotides 1-285 of the SARS-CoV-2 genomic RNA” (see instant claim 3), or “nucleotides 1-50 of the SARS-CoV-2 genomic RNA” (see instant claim 4), which renders the claim scope indefinite because it is unclear what specific sequence is actually being referenced implicitly referencing “SARS-CoV-2” in the claim scope. The phrase “SARS-CoV-2 genomic RNA” or “RNA sequence of SARS-CoV-2” does not correspond to a single, unique sequence as admitted on record (see, e.g., Spec. filed 11/07/2022 at 11 at lines 5-11, identifying ten different sequences as “multiple examples” of what constitutes “SARS-CoV-2 genomic RNA”. Per MPEP § 2173.05(b), the specific sequence implied by reference to “SARS-CoV-2 genomic RNA” or “RNA sequence of SARS-CoV-2” is relative and may vary from artisan to artisan. As explained at MPEP § 2173.05(b)(II), references to variable objects may render a claim indefinite “where the elements of a claim have two or more plausible constructions such that the examiner cannot readily ascertain positional relationship of the elements, the claim may be rendered indefinite”. Here, the scope of the claimed structures of antisense oligomers varies depending upon the specific sequence being implied by reference to “SARS-CoV-2 genomic RNA” or “RNA sequence of SARS-CoV-2”, and therefore the claim scope is ambiguous and indefinite.
Claims 5 and 9-17 depend directly or indirectly from an ambiguous base claim and also fail to reconcile the ambiguity of the base claim. Accordingly, these claims are rejected as indefinite as depending from an indefinite claim.
Claims 1-5 and 9-17 are rejected.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
[Prior Art Rejection 01]
Claims 1-5, and 9-12 are rejected under 35 U.S.C. 102(a)(1) as being clearly anticipated by Burrer et al.2.
Claim interpretation: The applicable claim interpretation has been set forth in a preceding section above, and those interpretations are incorporated into the instant rejection. Additional claim interpretations are set forth below.
Burrer pertains to the use of antiviral antisense morpholino oligomers in coronavirus infection models (see, e.g., Burrer at title, abs). Burrer discloses that it was known circa 2007 that “antisense P-PMOs can inhibit coronavirus replication” (see, e.g., Burrer at 5637-5638 at bridging ¶, 5638 at col I at 1st full ¶). Burrer identifies that previous studies with SARS-CoV had demonstrated that PPMOs targeting conserved sequence elements of the genomic 5’-untranslated region (5’-UTR) reduced viral replication (see, e.g., Burrer at 5638 at col II at 1st full ¶). Regarding instant claims 1-5 and 9-13, Burrer discloses and reduces to practice a PPMO targeting the SARS-CoV genomic 5’ terminus (“SARS-5TERM”), having a 5’ to 3’ sequence of GGTAGGTAAAAACCTAATAT (see, e.g., Burrer at Table 1 at 5638), which is identified as conjugated to the peptide R9F2 (see, e.g., Burrer at Fig. 3(B), showing R9F2-SARS 5TERM”). Regarding instant claims 1, 3-5, and a “sequence antisense to at least a portion of nucleotides 1-50 of the SARS-CoV-2 genomic RNA” of instant SEQ ID NO: 1, the sequence of GGTAGGTAAAAACCTAATAT (see, e.g., Burrer at Table 1 at 5638) is antisense3 to at “least a portion of” the nucleotides of instant SEQ ID NO: 1 (i.e., SARS-CoV-2 genomic RNA) at positions 1-50, namely “ATTA” at positions 1-4 of instant SEQ ID NO: 1 (compare Burrer at Table 1 at 5638 at “SARS-5TERM” with instant SEQ ID NO: 1, showing the sequence is antisense to “at least a portion of” the nucleotides of SEQ ID NO: 1). Regarding instant claims 2, 11-12, and a conjugated peptide, Burrer discloses that the PPMO of “SARS-5TERM” is conjugated to the peptide R9F2 (see, e.g., Burrer at Fig. 3(B), showing R9F2-SARS 5TERM”), which is 11 amino acids in length and comprises at least arginine and phenylalanine (compare id. with instant claims 2 and 11-12). Regarding claims 9-10 and PMO chemistry, Burrer discloses that the compounds are peptide-conjugated antisense phosphorodiamidate morpholino oligomers (P-PMOs) (see, e.g., Burrer at title, abs), and therefore the compounds are understood to necessarily comprise a phosphorodiamidate morpholino (i.e., PMO) (compare Burrer at title, abs, Table 1 at 5638 with instant claims 10-11).
Accordingly, instant claims 1-5 and 9-12 are rejected.
[Prior Art Rejection 02]
Claims 1-5, and 9-12 are rejected under 35 U.S.C. 102(a)(1) as being clearly anticipated by Neuman et al.4.
Claim interpretation: The applicable claim interpretation has been set forth in a preceding section above, and those interpretations are incorporated into the instant rejection. Additional claim interpretations are set forth below.
Neuman pertains to the treatment of coronavirus using antisense morpholino oligomers conjugated to peptides (see, e.g., Neuman at title, abs). Regarding instant claims 1-5 and 9-12, Neuman teaches and discloses two peptide-conjugated antisense phosphorodiamidate morpholino oligomers (P-PMOs) referred to as “TRS1” and “TRS2” (see, e.g., Neuman at Table 1 on 9666, Fig. 1 on 9667, 9667 at col. I at 1st and 2nd full ¶¶, 9668 at col I at 1st and 2nd full ¶¶, Fig. 3(B)-(C) on 9670). Regarding instant claims 1-5 and a “sequence antisense to at least a portion of nucleotides 1-50 of the SARS-CoV-2 genomic RNA” of instant SEQ ID NO: 1, the sequences of “TRS1” and “TRS2” each comprise “GTTCG” (see, e.g., Neuman at Table 1 on 9666), which is antisense to the consensus transcription regulatory sequence (TRS) of “CGAAC” (see, e.g., Neuman at 9668 at col I at 1st and 2nd full ¶¶), and is antisense to instant SEQ ID NO: 1 at approximate positions 71-76 (compare Neuman at Table 1 on 9666 at TRS1” and “TRS2”, with instant SEQ ID NO: 1 at positions 1-80). In addition, with respect to instant SEQ ID NO: 1 at positions 1-50, this same portion is “antisense to at least a portion of nucleotides 1-50”, namely “AAC” (compare Neuman at Table 1 on 9666 at TRS1” and “TRS2”, with instant SEQ ID NO: 1 at positions 1-50). Regarding instant claims 2, 11-12, and a conjugated peptide, Neuman discloses that TRS1 and TRS2 are conjugated to R9F2 (see, e.g., Neuman at Fig. 3(B)-(C) on 9670), which is 11 amino acids in length and comprises at least arginine and phenylalanine (compare id. with instant claims 2 and 11-12). Regarding claims 9-10 and PMO chemistry, the primary reference discloses that the compounds are peptide-conjugated antisense phosphorodiamidate morpholino oligomers (P-PMOs) (see, e.g., Primary reference at title, abs, passim), and therefore the compounds are understood to necessarily comprise a phosphorodiamidate morpholino (i.e., PMO) (see, e.g., Neuman at title, abs, Table 1 on 9666, Fig. 1 on 9667, 9667 at col. I at 1st and 2nd full ¶¶, 9668 at col I at 1st and 2nd full ¶¶, Fig. 3(B)-(C) on 9670).
Accordingly, claims 1-5 and 9-12 are rejected.
[Prior Art Rejection 03]
Claims 1-8 are rejected under 35 U.S.C. 102(a)(1)/(a)(2) as being clearly anticipated by US2022/0267773A1 (US Application 17/628,913; priority to Jul. 23, 2019).
Claim interpretation: The applicable claim interpretation has been set forth in a preceding section above, and those interpretations are incorporated into the instant rejection. Additional claim interpretations are set forth below.
Regarding instant claims 1-8, US’773 teaches and discloses an oligomer comprising instant SEQ ID NO: 3, namely US’733 teaches and discloses SEQ ID NO: 369, which shares 100% sequence identity with instant SEQ ID NO: 3:
PNG
media_image1.png
127
534
media_image1.png
Greyscale
Instant claims 1-8 are understood to necessarily and inherently be satisfied by any oligomer comprising instant SEQ ID NO: 3.
Accordingly, claims 1-8 are rejected.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
[Prior Art Rejection 04]
Claims 1-15 are rejected under 35 U.S.C. 103 as being unpatentable over US2015/0267202A1 (Sept. 24, 2015; Iversen et al.) in view of GenBank NC_045512.25
Claim interpretation: The applicable claim interpretation has been set forth in a preceding section above, and those interpretations are incorporated into the instant rejection. Additional claim interpretations are set forth below.
US’202 pertains to methods of producing anti-viral compounds usable in methods of treating coronavirus by inhibiting replication of coronaviruses, specifically by making and using peptide-conjugated morpholino antisense agents targeting the 5’-terminal 40 bases of the coronavirus (see, e.g., US’202 at title, abs, ¶¶[0031]-[0038], [0057]-[0058], [0134]-[0135], [0139], [0143], [0147], [0183], [0187], [0204]-[0206], [0236], [0252], [0273], [0315]-[0318], claims 1-9, 31-40). Regarding instant claims 1-8 and oligomer sequences targeting the coronavirus genome, generally, US’202 identifies that compounds targeting coronaviruses and usable to treat coronaviruses may be predictably made by generating oligonucleotide sequences that are complementary to at least 12 bases within the 5’-terminal 40 bases of the coronavirus genome (see, e.g., US’202 at claims 1-2, 10, 20, 31-40, ¶¶[0003], [0031], [0038], [0057]-[0058]). Regarding instant claims 2, 11-13, 15, and a conjugated peptide having the structure of (RXR)4XB, where “X” is 6-aminohexanoic acid and “B” is β-Ala, US’202 informs artisans that the oligonucleotides may be conjugated at either the 3’ or 5’ end to an arginine-rich peptide (see, e.g., US’202 at ¶¶[0054], [0064], [0183], [0252], Table 5 at col. 23, SEQ ID NO: 122, claims 8-9, 18-19, and 39-40), and explicitly teaches and discloses the arginine-rich peptide of SEQ ID NO: 122, which corresponds to (RXR)4XB, where “X” is 6-aminohexanoic acid and “B” is β-Ala (see, e.g., US’202 at ¶¶ [0183], [0252], Table 5 at col. 23, SEQ ID NO: 122, claims 8-9, 18-19, and 39-40; see esp. id. at SEQ ID NO: 122 or “P007”, which is (RXR)4Xβ-Ala where “X” is 6-aminohexanoic acid). Regarding claims 1, 9-10, nuclease-resistant backbones, and PMO chemistry, US’202 teaches and claims that the oligomers may be morpholinos (PMOS) conjugated to arginine-rich sequences (see, e.g., US’202 at ¶¶[0043]-[0044], [0054], [0167], [0169], [0235], [0252], [0308], claims 1(b)(i), 3-9, 31(i), 31-40). In sum, US’202 teaches, claims, and directs artisans to make and use peptide-conjugated PMOs (PPMOs) capable of treating coronaviruses by targeting the 5’-terminal end 40 bases of a coronavirus genome (see, e.g., US’202 at title, abs, ¶¶[0031]-[0038], [0057]-[0058], [0134]-[0135], [0139], [0143], [0147], [0183], [0187], [0204]-[0206], [0236], [0252], [0273], [0315]-[0318], claims 1-9, 31-40).
The primary reference differs from the instant claims as follows: US’202 does not explicitly teach or disclose a PPMO comprising instant SEQ ID NO: 36 conjugated to instant SEQ ID NO: 21 (RAhxRRAhxRRAhxRRAhxRAhxB7).
Although US’202 does not teach instant SEQ ID NO: 3 directly, US’202 explicitly teaches and directs artisans to make PPMOs suitable for treating coronaviruses by designing PMOs capable of targeting the 5’-terminal end 40 bases of a coronavirus genome (see, e.g., US’202 at claims 1-9, 31-40, ¶¶[0031]), wherein US’202 teaches that PMOs may be 12-25 bases in length (see, e.g., US’202 at ¶¶[0235]-[0236]), and wherein the exemplified embodiments targeting coronaviruses target positions 1-20 and 21-40 (see, e.g., US’202 at ¶[0239] at Table 3 at col 13, disclosing SEQ ID NOs: 97-98 and 103-106). Accordingly, in view of US’202, an artisan would readily appreciate, predict, and expect that a PPMO having 12-25 bases, with a target beginning at position 1 of a coronavirus genome, would be predicted and expected to have antiviral activity, exactly as taught, disclosed, and suggested in view of US’202.
NC045512 discloses a genome for a coronavirus, publicly available January 17, 2020 (see, e.g., NC045512 at 1). Applying the guidance of US’202 to this coronavirus genome, an artisan would arrive at a 5’-terminal 40 bases of
ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAAC
(see, e.g., NC045512 at 5 at positions 1-40), and would appreciate that a PPMO of 25 bases in length, starting at position 1 as exemplified by US’202 (see, e.g., US’202 at ¶[0239] at Table 3 at col 13, disclosing SEQ ID NOs: 97-98 and 103-106), would yield the following sixteen 25-mer target sequences, listed from 5’ to 3’:
(i) ATTAAAGGTTTATACCTTCCCAGGT;
(ii) TTAAAGGTTTATACCTTCCCAGGTA;
(iii) TAAAGGTTTATACCTTCCCAGGTAA;
(iv) AAAGGTTTATACCTTCCCAGGTAAC;
(v) AAGGTTTATACCTTCCCAGGTAACA;
(vi) AGGTTTATACCTTCCCAGGTAACAA;
(vii) GGTTTATACCTTCCCAGGTAACAAA;
(viii) GTTTATACCTTCCCAGGTAACAAAC;
(ix) TTTATACCTTCCCAGGTAACAAACC;
(x) TTATACCTTCCCAGGTAACAAACCA;
(xi) TATACCTTCCCAGGTAACAAACCAA;
(xii) ATACCTTCCCAGGTAACAAACCAAC;
(xiii) TACCTTCCCAGGTAACAAACCAACC;
(xiv) ACCTTCCCAGGTAACAAACCAACCA;
(xv) CCTTCCCAGGTAACAAACCAACCAA;
(xvi) CTTCCCAGGTAACAAACCAACCAAC
This is pertinent, because sequence (v) above corresponds to a antisense morpholino sequence (5’ to 3’) of TGTTACCTGGGAAGGTATAAACCTT, which is identical to the originally elected species (compare (v) above with instant SEQ ID NO: 3, showing 100% identity). This is pertinent, because only a finite number of 12-25mer target sequences exist within the limited target sequence of positions 1-40 of the 5’-terminal sequence of the coronavirus genome of NC045512.
Therefore, it would have been obvious to one of ordinary skill in the art, either before the effective filing date of the claimed invention (AIA ) or otherwise at the time the invention was made (pre-AIA ), to arrive at the instantly claimed invention in view of the prior art for at least the following reason(s):
First, the invention is the simple substitution of one known coronavirus genome (i.e. NC045512) in place of another coronavirus genome in the methods of generating PPMOs capable of treating coronavirus infections as taught and disclosed by US’202, wherein such simple substitution merely yields predictable results, namely PPMOs capable of treating the coronavirus infection caused by the coronavirus corresponding to NC045512, exactly as taught and suggested in view of the prior art (see, e.g., MPEP § 2143(I)(B)).
Second, either additionally or in the alternative to other rationales, the invention is the application of the known technique of generating PPMOs capable of targeting and treating coronavirus infections by targeting the 5’-terminal 40 amino acids within a coronavirus genome with 12-25mer PPMOs as taught by US’202 to the coronavirus genome corresponding to NC045512, wherein such application would predictably yield PPMOs capable of treating the coronavirus infection caused by the coronavirus corresponding to NC045512, exactly as taught and suggested in view of the prior art (see, e.g., MPEP § 2143(I)(C), (D), (F)).
Accordingly, each prior art element merely performs its art-recognized function in combination as it does separately, as taught by the prior art.
Furthermore, there would be a reasonable expectation of success because the prior art is presumed fully enabled (see, e.g., MPEP § 2121(I)) for all that it discloses (see, e.g., MPEP §§ 2123(I)-(II)). Furthermore, it is well-within the ordinary skill in the art to follow known guidance to generate prior art PPMO anti-viral agents capable of targeting a known coronavirus genome to achieve the exact outcome taught and disclosed by the prior art (i.e., treatment of a coronavirus infection).
Accordingly, claims 1-13 and 15 are rejected.
[Prior Art Rejection 05]
Claims 1-13 and 15-18 are rejected under 35 U.S.C. 103 as being unpatentable over US2015/0267202A1 in view of GenBank NC_045512.28 as applied to claims 1-13 and 15 above, and further in view of US2019/0284555A1 (Sep. 19, 2019; Schnell).
Claim interpretation: The applicable claim interpretation has been set forth in a preceding section above, and those interpretations are incorporated into the instant rejection. Additional claim interpretations are set forth below.
The teachings of US’202 in view of NC045512 as applied to claims 1-13 and 15 has been discussed above in a preceding rejection, and those teachings are incorporated into the instant rejection.
US’202 in view of NC045512 differ from instant claims 16-18 as follows: Although US’202 in view of NC045512 reasonably directs artisans to utilize PPMOs conjugated to (RXR)4XB at the 5’ end, these references do not teach or direct artisans to a structure of Formula I as required at claim 16, or otherwise to a structure of Formula 2 at claim 17.
Regarding instant claims 16-18 and the general arrangement of the known components disclosed by US’202, US’555 is related art and establishes the general variability in PPMO structures, and specifically teaches that circa 2019, it was well-understood that PPMOs generally had a structure corresponding to
PNG
media_image2.png
448
250
media_image2.png
Greyscale
(see, e.g., US’555 at ¶¶[0010]-[0068]), wherein “T” may be
PNG
media_image3.png
168
124
media_image3.png
Greyscale
, wherein R9 is a methyl moiety (see, e.g., US’555 at ¶¶[0063]), z is 8 to 38 (see, e.g., US’555 at ¶¶[0063]), each Nu is a nucleobase (see, e.g., US’555 at ¶¶[0012]), each R1 is -N(CH2)2 (see, e.g., US’555 at ¶¶[0064]), each Y is Oxygen (see, e.g., US’555 at ¶¶[0059]), and wherein R2 is a cell penetrating peptide and a linker (see, e.g., US’555 at ¶¶[0066]). Accordingly, an artisan would readily appreciate that the formulas of instant claims 16-18 represent and restate general structural variability already known in the prior PPMO arts.
Therefore, it would have been obvious to one of ordinary skill in the art, either before the effective filing date of the claimed invention (AIA ) or otherwise at the time the invention was made (pre-AIA ), to arrive at the instantly claimed invention in view of the prior art for at least the following reason(s): The invention is the combination of known components (i.e., targeting sequence, PMO backbone, known arginine-rich peptide, etc.) taught or otherwise rendered obvious in view of US’202 and NC045512 in known arrangements of PPMO structures as taught and disclosed by US’555, wherein such combinations yield predictable results, namely they result in PPMOs having a 5’ conjugated peptide, wherein the PPMO would be predicted and expected to be suitable for treating coronavirus (see, e.g., MPEP § 2143(I)(A)). Furthermore, each component or prior art element would merely perform its art-recognized function in combination as it does separately, as taught by the prior art.
Furthermore, there would be a reasonable expectation of success because the prior art is presumed fully enabled (see, e.g., MPEP § 2121(I)) for all that it discloses (see, e.g., MPEP §§ 2123(I)-(II)). Furthermore, it is well-within the ordinary skill in the art to follow known guidance to generate prior art PPMO anti-viral agents capable of targeting a known coronavirus genome to achieve the exact outcome taught and disclosed by the prior art (i.e., treatment of a coronavirus infection), by combining and arranging such components in known combinations as taught by US’555.
Accordingly, claims 1-13 and 15-18 are rejected.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1-4, 9-13, and 15-17 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 5-7, and 10-20 of copending Application No. 18/046,235 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other as explained below.
Claim interpretation: The applicable claim interpretation has been set forth in a preceding section above, and those interpretations are incorporated into the instant rejection. Additional claim interpretations are set forth below.
The applicable analysis for Nonstatutory Double Patenting is set forth at MPEP § 804(II), and specifically at MPEP § 804(II)(B). Here, although the same invention is not being claimed twice (see, e.g., MPEP § 804(II)(A), discussing Statutory Double Patenting), a Nonstatutory Double Patenting rejection is appropriate because although the conflicting claims are not identical, at least one examined application claim is not patentably distinct from the reference claims because the examined application claim is either anticipated by, or would have been obvious over, the reference claims for the reasons set forth in the following paragraph[1]: Per MPEP § 804(II)(B), “To decide the question above, the examiner should first construe the claim(s) in the application under examination and the claim(s) in the reference application or patent to determine what are the differences”. Accordingly, a comparison of the teachings of the reference claims and the instant pending claims are set forth below:
App’235 is directed to methods of treating SARS-CoV-2 by administering antisense oligonucleotides (see, e.g., App’235 at claims 1, 5-7, and 10-20), wherein instant claims 1-4, 9-13, and 15-17 are directed to antisense oligonucleotide compounds capable of targeting and treating SARS-CoV-2 (compare id. with instant claims 1-4, 9-13, 15-17, and instant claim 19-21). Accordingly, the method claims of copending App’235 implicitly and necessarily requires the existence of antisense oligomers sufficient to treat SARS-CoV-2 (see, e.g., App’235 at claims 1, 5-7, and 10-20), which are understood to include PPMO structures comprising a peptide and backbone structure as shown at copending claim 20 (see, e.g., App’235 at claims 1, 5-7, and 10-20), but such structures are present and claimed in the instant Application (compare id. with instant claim 17, noting that instant Formula 2 is present and identical in both copending claim sets), and taught for the exact same purpose of treating SARS-CoV-2 (compare App’235 at claims 1, 5-7, and 10-20 with instant claims 19-21, identifying that the claimed products are usable to treat SARS-CoV-2).
Therefore, the answer to the question “Is any invention claimed in the application anticipated by, or an obvious variation of, an invention claimed in the patent”[2] is clearly “yes”.
MPEP § 804(II)(B)(2)-(3) further identify that a Nonstatutory Double Patenting Rejection may be appropriate based upon either an anticipation analysis or an obviousness analysis (see, e.g., MPEP § 804(II)(B)(2)-(3)).
Under an obviousness analysis (see, e.g., MPEP § 804(II)(B)(3)), it is noted that the scope and content of the patent claim relative to the application claims at issue have been discussed above (see, e.g., MPEP § 804(II)(B)(3)(A)), and that the differences are that the copending claims are ostensibly directed to a method of treating SARS-CoV-2 utilizing antisense oligomers, and that the instant claims are directed to products usable in the copending method claims (see, e.g., MPEP § 804(II)(B)(3)(B)). However, although the copending method claims are not product claims, the copending claims recite methods utilizing products, which necessarily and implicitly disclose products substantially overlapping in scope with the instant claims. Accordingly, the claims are directed to obvious variants that are not patentably distinct relative to the copending claims (see, e.g., MPEP § 804(II)(B)(3)(C)-(D); see also MPEP §§ 2143(A), (B), (C), and (G)).
Accordingly, claims 1-4, 9-13, and 15-17 are provisionally rejected.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Pertinent Prior Art
The prior art made of record and not relied upon is considered pertinent to applicant's disclosure.
US2005/0100885 A1 (May 12, 2005; Crooke et al.) pertains to antisense agents for the treatment of SARS (see, e.g., id. at title, abs, claims) and evidences that it is routine in the antisense agent arts to create hundreds of compounds for testing (see, e.g., id. at Example 18 and Table 3, starting at col. 36).
US 2015/0126722 Al (Stein et al.; May 7, 2015) pertains to antisense agents for the treatment of coronaviruses (see, e.g., id. at title, abs, claims).
Stein9 teaches and informs artisans how to achieve inhibition of RNA virus infections with peptide-conjugated morpholino oligomers (PPMOs) targeting specific regions of viral genomes (see, e.g., Stein at title, abs, Table 1 on 2622). Stein explicitly teaches that for a coronavirus, PPMOs may be targeted to the 5’ UTR and 5’ terminus of the viral genome (see, e.g., Stein at Table 1 on 2622, Fig. 3 on 2623).
US2006/0063150 A1 (Iversen et al; Mar. 23, 2006) teaches and discloses antisense morpholinos designed to treat coronavirus infections by targeting the 5’-terminal end 40 bases of the viral RNA (see, e.g., US’150 at title, abs, claims).
Neuman et al.10 teaches and informs artisans that antisense morpholino-oligomers may be designed and directed against the 5' end of a coronavirus genome to predictably inhibit coronavirus proliferation and growth (see, e.g., Neuman2004 at title, abs, passim).
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to RANDALL L BEANE whose telephone number is (571)270-3457. The examiner can normally be reached Mon.-Fri., 7 AM to 2 PM ET.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Lianko G. Garyu can be reached at (571) 270-7367. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/RANDALL L BEANE/ Primary Examiner, Art Unit 1654
1 This sequence is also known in the art as RXRRXRRXRRXRXB, and (RXR)4XB, wherein “X” is 6-aminohexanoic acid and B is beta-alanine.
2 Burrer et al., Antiviral effects of antisense morpholino oligomers in murine coronavirus infection models. J Virol. 2007 Jun;81(11):5637-48. doi: 10.1128/JVI.02360-06. Epub 2007 Mar 7. PMID: 17344287; PMCID: PMC1900280; hereafter “Burrer”; cited in IDS filed 10/07/2024 as cite No. 1.
3 5’GGTAGGTAAAAACCTAATAT 3’ is antisense to 5’ ATATTAGGTTTTTACCTACC 3’.
4 Neuman et al., Inhibition, escape, and attenuated growth of severe acute respiratory syndrome coronavirus treated with antisense morpholino oligomers. J Virol. 2005 Aug;79(15):9665-76. doi: 10.1128/JVI.79.15.9665-9676.2005. PMID: 16014928; PMCID: PMC1181598; hereafter “Neuman”; cited in IDS filed 10/07/2024 as Cite No. 5.
5 NCBI Reference Sequence: NC_045512.2, “Wuhan seafood market pneumonia virus isolate Wuhan-Hu-1, complete genome”, 29903 bp, NCBI Genbank (Jan. 17, 2020), attached as 12-page pdf; available at Wuhan seafood market pneumonia virus isolate Wuhan-Hu-1, complete geno - Nucleotide - NCBI; hereafter “NC045512”
6 TGTTACCTGGGAAGGTATAAACCTT
7 This sequence is also known in the art as RXRRXRRXRRXRXB, and (RXR)4XB, wherein “X” is 6-aminohexanoic acid and B is beta-alanine.
8 NCBI Reference Sequence: NC_045512.2, “Wuhan seafood market pneumonia virus isolate Wuhan-Hu-1, complete genome”, 29903 bp, NCBI Genbank (Jan. 17, 2020), attached as 12-page pdf; available at Wuhan seafood market pneumonia virus isolate Wuhan-Hu-1, complete geno - Nucleotide - NCBI; hereafter “NC045512”
[1] See, e.g., MPEP § 804(II)(B), noting that “In determining whether a nonstatutory basis exists for a double patenting rejection, the first question to be asked is: Is any invention claimed in the application anticipated by, or an obvious variation of, an invention claimed in the patent? If the answer is yes, then a nonstatutory double patenting rejection may be appropriate.”
[2] See, e.g., MPEP § 804(II)(B), noting that “In determining whether a nonstatutory basis exists for a double patenting rejection, the first question to be asked is: Is any invention claimed in the application anticipated by, or an obvious variation of, an invention claimed in the patent? If the answer is yes, then a nonstatutory double patenting rejection may be appropriate.”
9 Stein DA. Inhibition of RNA virus infections with peptide-conjugated morpholino oligomers. Curr Pharm Des. 2008;14(25):2619-34. doi: 10.2174/138161208786071290. PMID: 18991679.
10 Neuman et al., Antisense morpholino-oligomers directed against the 5' end of the genome inhibit coronavirus proliferation and growth. J Virol. 2004 Jun;78(11):5891-9. doi: 10.1128/JVI.78.11.5891-5899.2004. PMID: 15140987; PMCID: PMC415795; hereafter “Neuman2004”.