DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Status of Claims
Claims 1-5, 11-12, 17-35, 41, 49-51 are under examination on the merits.
Claims 6, 13-16, 36-40, 43-48 are withdrawn.
The objections to claims 27, 30 & 33 are withdrawn in light of Applicant’s amendments.
The rejection of claims 11-12 & 23 under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as New Matter is withdrawn in light of Applicant’s amendments.
The rejection of claim 24 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, is withdrawn in light of Applicant’s amendments.
The rejection of claims 2-3 under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, is withdrawn in light of Applicant’s amendments.
The rejection of claim 27 under 35 U.S.C. 102(a)(1) as being anticipated by GenBank locus LR999909.1 is withdrawn in light of Applicant’s amendments.
The rejection of claim 27 under 35 U.S.C. 102(a)(1) as being anticipated by NCBI reference sequence XM_009326713.1 is withdrawn in light of Applicant’s amendments.
The rejection of claims 29 & 31 under 35 U.S.C. 102(a)(1) as being anticipated by Mascher et al (2014) PLOS One. 9(5): e96782 taken with the evidence of GenBank accession AY664415.1 (nucleotides 97115-97124) is with drawn in light of Applicant’s amendments.
The rejection of claims 29 & 32 under 35 U.S.C. 102(a)(1) as being anticipated by Venkatesh et al (2015) J. Agric. Food Chem. 63, 5282−5295 taken with the evidence of GenBank accession AY664415.1 (nucleotides 97115-97124) is withdrawn in light of Applicant’s amendments.
Claim Objections
Claims 4, 28 & 32 are objected to because of the following informalities:
Claims 4 and 28 are not in proper Markush format. Claim 4 recites a DNA molecule chosen from SEQ ID NO: 22 and 25 (line 2). Claim 28 recites a nucleic acid sequence chosen from SEQ ID NOs; 19-21 and full length complements thereof (lines 1-2). Claim 32 recites a sample chosen from corn flour, corn meal, corn syrup, corn oil, corn start, and cereals manufactured in whole or in part to contain corn by-products (lines 2-3).
Because a Markush grouping is a closed group of alternatives, the claims should be in the format “chosen from the group consisting of A, B, C and D.” See MPEP § 2173.05(h). Alternatively, because treatment of claims reciting alternatives is not governed by the particular format used (e.g., alternatives may be set forth as "a material selected from the group consisting of A, B, and C" or "wherein the material is A, B, or C") (see MPEP § 2117), claims could be amended so that the last option in the list is preceded by “or” instead of “and”.
Appropriate correction is required.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claim 27 is rejected under 35 U.S.C. 101 because the claimed invention is directed to a natural phenomenon without significantly more.
Due to Applicant' s amendment of the claims, the rejection is modified from the rejection as set forth in the Office action mailed 11/25/2025, as applied to claim 27. Applicant' s arguments filed 2/25/2026 have been fully considered but they are not persuasive.
The claim(s) recite(s) an isolated nucleic acid molecule comprising a nucleotide sequence of SEQ ID NOs: 19, 24, 27, full length complements thereof, or SEQ ID NOs: 23. SEQ ID NO: 23 is found in the double stranded genomes of naturally occurring organisms, which reads on nucleic acid molecules. See alignment below.
SEQ ID NO: 23 (top) vs NCBI reference sequence XM_040826762.1 (available 4/20/2021).
Metarhizium album ARSEF 1941 RhoGAP domain containing protein (MAM_07964), partial mRNA
Sequence ID: XM_040826762.1Length: 3336
Range 1: 1768 to 1787
Alignment statistics for match #1
Score
Expect
Identities
Gaps
Strand
40.1 bits(20)
1.6
20/20(100%)
0/20(0%)
Plus/Minus
Query 1 TTGAGGATAACAGCATCATC 20
||||||||||||||||||||
Sbjct 1787 TTGAGGATAACAGCATCATC 1768
This judicial exception is not integrated into a practical application because the claim is drawn just to a nucleic acid molecule. The claim(s) does/do not include additional elements that are sufficient to amount to significantly more than the judicial exception because an isolated nucleic acid molecule would not inherently comprise markedly different characteristics from a nucleic acid molecule found within its natural genomic context. See MPEP 2106.04(b)(I) or Ass’n for Molecular Pathology v. Myriad Genetics, Inc., 569 U.S. 576, 589-91, 106 USPQ2d 1972, 1978-79 (2013).
Applicant urges that amended claim 27 removes the recitations of SEQ ID NO: 26 SEQ ID NO: 23, and full length complements thereof (Remarks, page 11, paragraph 5-page 12 paragraph 1).
This argument is unpersuasive, because amended claim 27 still recites SEQ ID NO: 23.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Written Description
Claims 11, 12, 23, 50 & 51 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Due to Applicant' s amendment of the claims, the rejection is modified from the rejection as set forth in the Office action mailed 11/25/2025, as applied to claims 11, 12, 23, 50 & 51. Applicant' s arguments filed 2/25/2026 have been fully considered but they are not persuasive.
Claim 11 is drawn to a corn plant comprising the genotype of corn event DAS-01131-3 wherein the genotype comprises a nucleotide sequence of SEQ ID NO: 24 or 27 or a sequence having 1 nucleotide change in SEQ ID NO: 24 or 27. Claim 12 is drawn to a corn plant comprising the genotype of corn event DAS-01131-3 wherein the genotype comprises a nucleotide sequence having at least 98% sequence identity to SEQ ID NO: 3. Claim 23 is drawn to a corn plant comprising the genotype of corn event DAS-01131-3 wherein the genotype comprises a sequence having at least 98% sequence identity to SEQ ID NO: 19. Claim 50 is drawn to a method comprising exposing insects to corn plants of corn event DAS-01131-3 wherein the corn plant comprises a nucleotide sequence having at least 99% sequence identity to SEQ ID NO: 3. Claim 51 is drawn to a corn plant comprising the genotype of corn event DAS-01131-3 wherein the genotype comprises a nucleotide sequence having at least 99% sequence identity to SEQ ID NO: 3.
Broadly, the amended claims are drawn to plants comprising the genotype of corn event DAS-01131-3 but also comprising nucleotide sequences not found in the genotype of corn event DAS-01131-3.
Nucleic acids with 98% identity to the 14969 nucleotide-long SEQ ID NO: 3 would have 299 nucleotide substitutions relative to SEQ ID NO: 3. Nucleic acids with 99% identity to the 14969 nucleotide-long SEQ ID NO: 3 would have 149 nucleotide substitutions relative to SEQ ID NO: 3. Nucleic acids with 98% identity to the 98 bp long SEQ ID NO: 19 would have 1 nucleotide change. Nucleic acids with 1 nucleotide change relative to SEQ ID NOs: 24 or 27 would have 98% sequence identity to the 50bp long SEQ ID NOs: 24 and 27.
The specification describes a single genotype of a corn plant comprising the DAS-01131-3 event. The genotype described by the instant specification comprises a sequence with 100% identity to instant SEQ ID NO: 3 (page 9, lines 5-17). The specification describes no plants, including no plants comprising the genotype of the DAS-01131-3 event, further comprising a nucleotide sequence with 98% sequence identity to SEQ ID NO: 3, 24, 27 or 19 that is not 100% sequence identity to 3, 19, 24 or 27. No plants are described that comprise the genotype of the DAS-01131-3 event that also have 299 nucleotide substitutions relative to SEQ ID NO: 3 or 1 or 2 nucleotide changes relative to SEQ ID NO: 24 or 27. The specification discloses SEQ ID NOs: 10-18 & 20-21, which are identical matches to a sequence found in SEQ ID NO: 3 and/or 19. Thus, the specification does not describe species over the full scope of claimed corn plants comprising both the genotype of event DAS-01131-3 and nucleic acids with 299 substitutions in SEQ ID NO: 3 or one or two nucleotide changes in SEQ ID NO: 24 or 27, or plants comprising a sequence having only 98% identity to SEQ ID NO: 19, and there is no evidence that Applicant was in possession of such plants.
Amended claims 11-12, 23 & 50-51 require a nucleotide sequence encoding the amino acids of SEQ ID NO: 5 and SEQ ID NO: 7, which are structural features which could potentially provide the required traits of insect- and herbicide resistance in a nucleotide sequence having 98% identity to the 14969 nucleotide-long SEQ ID NO: 3. However, a corn plant comprising the genotype of event DAS-01131-3 would have 100% nucleotide sequence identity to SEQ ID NO: 3, not 98% sequence identity, and so Applicant has still not described plants encompassed by the amended claims.
Hence, Applicant has not, in fact, described plants comprising nucleic acids with 98% or 99% sequence identity to SEQ ID NO: 3 or 1 nucleotide change relative to SEQ ID NOs: 24 or 27 or any plant comprising a sequence with 98% sequence identity to SEQ ID NO: 19 over the full scope of the claims, and the specification fails to provide an adequate written description of the claimed invention. Therefore, given the lack of written description in the specification with regard to the structural and functional characteristics of the claimed compositions, Applicant does not appear to have been in possession of the claimed genus at the time this application was filed.
Applicant urges that because the instant specification teaches potential embodiments wherein a plant comprising the genotype of the corn event DAS-01131-3 comprises nucleotide changes in the recited nucleotide sequences, describes progeny plants that may contain sequence changes arising as a result of conventional breeding techniques, and describes methods of modifying DNA sequences of SEQ ID NOs: 3, 19, 24, and 27, written description requirement is met and does not require examples or an actual reduction to practice (Ariad 598 F.3d at 1352) (Remarks, page 12, paragraph 4-page 14, paragraph 3).
This argument is unpersuasive, because this is not an enablement rejection. The rejection states that Applicant does not have possession of a corn plant comprising the genotype of corn event DAS-01131-3 and also comprising any sort of variation in the DAS-01131-3 event.
Nucleic acids with 98% identity to the 14969 nucleotide-long SEQ ID NO: 3 would have 299 nucleotide substitutions relative to SEQ ID NO: 3. Nucleic acids with 99% identity to the 14969 nucleotide-long SEQ ID NO: 3 would have 149 nucleotide substitutions relative to SEQ ID NO: 3. Nucleic acids with 98% identity to the 98 bp long SEQ ID NO: 19 would have 1 nucleotide change. Nucleic acids with 1 nucleotide change relative to SEQ ID NOs: 24 or 27 would have 98% sequence identity to the 50bp long SEQ ID NOs: 24 and 27. The specification does not describe corn plants with this claimed variation.
Further, the claims are not drawn to a maize plant transformed with a nucleic acid comprising a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 3, or 98% identity to SEQ ID NO: 19 or 1 nucleotide change relative to SEQ ID NOs: 24 or 27, where the nucleic acid has landed at a random spot in the maize genome. The specification describes maize plants comprising the DAS-01131-3 event. The DAS-01131-3 event is a particular insert of a particular sequence at a specific chromosomal location in the maize genome, as recognized by the claims’ requirements for junction sequences from SEQ ID NOs: 22-27.
Applicant does not have possession of any maize plants with modifications in SEQ ID NO:3, 19, 24 or 27. Applicant only has possession of a maize plants with the DAS-01131-3 event, i.e., a nucleic acid with 100% identity to SEQ ID NOs: 3, 19, 24 & 27 and present at a specific chromosomal location. A description of the various genetic elements contained within SEQ ID NOs: 3, 19, 24 & 27 does not give Applicant possession of any maize plants with modifications in SEQ ID NOs: 3, 19, 24 & 27.
Applicant urges that amended claims require structural features of SEQ ID NO: 5 and SEQ ID NO: 7 as well as at least one of the junction/flanking regions that serve to identify the claimed plants to provide the required structural features for the traits conferring the functional characteristics (Remarks page 14, paragraph 4-page 15, paragraph 1). Applicant urges that the specification delineates the structural features common to members of the genus, enabling one skilled in the art to visualize or recognize the genus, and that the law does not require both representative examples and common structure so examples or an actual reduction to practice is not necessary (Remarks page 15, paragraph 2-page 16, paragraph 1).
This argument is unpersuasive, because the amended claims are not drawn to a maize plant transformed with a nucleic acid comprising a nucleotide sequence with at least 98% sequence identity to SEQ ID NO: 3, or 98% identity to SEQ ID NO: 19, or 1 nucleotide change relative to SEQ ID NOs: 24 or 27, where the nucleic acid has landed at a random spot in the maize genome. The claims require the genotype of the corn event DAS-01131-3, which consists of a particular insert in a specific location in the maize genome. The genotype of the corn event DAS-01131-3 does not comprise nucleotide variations relative to SEQ ID NOs: 3, 19, 24, and 27. Applicant was not in possession of any corn plant that comprises any sort of variation in the DAS-01131-3 event, much less 299 nucleotide substitutions in the DAS-01131-3 event. The fact pattern in the instant case is not the same as those in Ariad, Amgen, and AbbVie.
Scope of Enablement
Claims 11, 23 & 33 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre- AIA ), first paragraph, because the specification, while being enabling for corn plants comprising the DAS-01131-3 event and SEQ ID NO: 24 or 27; or the event and SEQ ID NOs: 19-21, 23-24, and 26-27; or the event and SEQ ID NO: 19, does not reasonably provide enablement for corn plants that do not comprise the DAS-01131-3 event with a sequence with at least 98% identity to SEQ ID NO: 19, or 1 nucleotide changes in SEQ ID NO: 24 or 27, or SEQ ID NOs: 19-21, 23-24, and 26-27. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to use the invention commensurate in scope with these claims.
Due to Applicant' s amendment of the claims, the rejection is modified from the rejection as set forth in the Office action mailed 11/25/2025, as applied to claims 11, 23, & 33. Applicant' s arguments filed 2/25/2026 have been fully considered but they are not persuasive.
Claim 11 is drawn to a corn plant comprising the genotype of corn event DAS-01131-3 and the nucleotide sequence set forth in SEQ ID NO: 24 or 27 or having 1 nucleotide change in said sequences. Claim 23 is drawn to a plant comprising the genotype of corn event DAS-01131-3 and a sequence having at least 98% sequence identity to SEQ ID NO: 19. Claim 33 is drawn to a method of producing hybrid corn seeds comprising crossing an inbred corn line comprising a nucleotide sequence chosen from SEQ ID NOs: 19-21, 23-24 and 26-27.
Nucleic acids with 98% identity to the 98 bp long SEQ ID NO: 19 would have 1 nucleotide change. Nucleic acids with 1 nucleotide change relative to SEQ ID NOs: 24 or 27 would have 98% sequence identity to the 50bp long SEQ ID NOs: 24 and 27. Although claim 33 requires plants comprising a nucleotide sequence chosen from SEQ ID NOs: 19-21, 23-24 or 26-27, it does not require the event of DAS-01131-3 or the insecticidal or herbicide resistance genes comprised by the event.
The specification does not teach any plants comprising such nucleic acids that do not comprise the DAS-01131-3 event and does not teach how to use such plants if they do not encode proteins that confer the resistances conferred by the DAS-01131-3 event. The specification does not teach any plants comprising both the genotype of the DAS-01131-3 event and also a nucleotide sequence having 1 nucleotide change in SEQ ID NO: 24 or 27 or a nucleotide sequence with 98% sequence identity to SEQ ID NO: 19.
As the specification does not teach any plant comprising a nucleotide sequence chosen from SEQ ID NOs: 19-21, 23-24 and 26-27 without event DAS-01131-3, undue trial and error experimentation would be required to screen through the myriad plants encompassed by the claims to identify a function for such plants, if such a function exists. Likewise, as the specification does not teach any plant comprising both the genotype of event DAS-01131-3 and a nucleotide sequence having 1 nucleotide change in SEQ ID NO: 24 or 27 or a nucleotide sequence with 98% sequence identity to SEQ ID NO: 19, undue trial and error experimentation would be required to generate plants over the full scope of the claims, if it is even possible to create a plant having both the genotype of event DAS-01131-3 and sequences not found in the genotype of event DAS-01131-3.
Given the claim breath, unpredictability in the art, and lack of guidance in the specification as discussed above, the instant invention is not enabled throughout the full scope of the claims.
Applicant urges that the specification envisions embodiments including plants comprising sequences having only 95% sequence identity to SEQ ID NO: 19 and nucleic acid primers and probes so that one of skill in the art could perform PCR analysis in order to determine whether a plant contains a sequence with at least 98% sequence identity to SEQ ID NO: 19 (Remarks, page 18, paragraph 3). Applicant urges that because the specification lists an embodiment of producing hybrid corn seeds comprising crossing a corn line comprising SEQ ID NO: 19-27 and has provided the sequences of SEQ ID NOs: 19-27 and has amended claim 33 to remove SEQ ID NO: 22 which is found in corn plants other than corn plants comprising the genotype of the DAS-01131-3 event, therefore one of skill in the art is enabled to determine whether the first inbred corn line contains one of the recited sequences and sexually cross that inbred corn line with a second inbred corn line (Remarks, page 18, paragraph 4-page 19, paragraph 5).
This argument is unpersuasive because there is an unknowable number of corn lines that potentially comprise the nucleotide sequences of SEQ ID NOs: 19-21, 23-24 or 26-27, with or without the genotype of corn event DAS-01131-3. Even with knowledge of PCR primers and probes, one of skill in the art would still be required to conduct undue experimentation to screen plants over the full scope of the encompassed genus of corn plants identify and find a use for corn plants that do not comprise the genotype of corn event DAS-01131-3 yet are encompassed by the method of claim 33.
Applicant urges that the amended claims now recite that the plant comprises the genotype of corn event DAS-01131-3 and the specification teaches methods to modify polynucleotide sequences, so the invention is enabled for one of skill in the art (Remarks, page 19, paragraph 2 -page 20, paragraph 1).
This argument is unpersuasive, because claim 33 does not require the genotype of corn event DAS-01131-3 and methods of modifying polynucleotide sequences are irrelevant to the limitations of claim 33. One of skill in the art would still be required to conduct undue experimentation to find a use for all corn plants, including corn plants that do not comprise the genotype of corn event DAS-01131-3, encompassed by the method of claim 33.
Additionally, although amended claims 11 and 23 recite a plant comprising the genotype of corn event DAS-01131-3, the genotype of corn event DAS-01131-3 does not comprise 1 nucleotide change in SEQ ID NOs: 24 or 27 or only 98% sequence identity to SEQ ID NO: 19. The instant specification has not taught how one of skill in the art can create a corn plant both comprising the genotype of corn event DAS-01131-3 as well as comprising sequences that are not found in the genotype of corn event DAS-01131-3.
Applicant urges that undue trial and error experimentation is not required to identify a function for all plants encompassed by the claims, because the quantity of experimentation is only one factor involved in determining whether undue experimentation is required and extended experimentation may not be undue if the skilled artisan is given sufficient direction or guidance. Applicant cites an example that time and expense of $50,000 and 6-12 months of experimentation is not undue experimentation (Remarks, page 20, paragraph 2-page 21, paragraph 1). Applicant urges that Applicant has provided ample guidance to one of skill in the art regarding how polynucleotides may be edited and modified and how to evaluate plants for efficacy against specific insects (Remarks, page 21, paragraph 2-page 22, paragraph 2).
This argument is unpersuasive, because claim 33 does not require the genotype of corn event DAS-01131-3 and methods of modifying polynucleotide sequences are irrelevant to the limitations of claim 33. There is an unknowable number of corn lines that potentially comprise the nucleotide sequences of SEQ ID NOs: 19-21, 23-24 or 26-27, with or without the genotype of corn event DAS-01131-3. One of skill in the art would still be required to conduct undue experimentation to identify and find a use for corn plants, including corn plants that do not comprise the genotype of corn event DAS-01131-3, encompassed by the method of claim 33.
Moreover, although amended claims 11 and 23 recite a plant comprising the genotype of corn event DAS-01131-3, the genotype of corn event DAS-01131-3 does not comprise 1 nucleotide change in SEQ ID NOs: 24 or 27 or only 98% sequence identity to SEQ ID NO: 19. The instant specification has not taught how one of skill in the art can create a corn plant both comprising the genotype of corn event DAS-01131-3 as well as comprising sequences that are not found in the genotype of corn event DAS-01131-3.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claim 27 is rejected under 35 U.S.C. 102(a)(1) as being anticipated by NCBI reference sequence XM_040826762.1 (available 4/20/2021).
Claim 27 is drawn to an isolated nucleic acid molecule comprising a nucleotide sequence chosen from a list that includes instant SEQ ID NO: 23.
Due to Applicant' s amendment of the claims, the rejection is modified from the rejection as set forth in the Office action mailed 11/25/2025, as applied to claim 27. Applicant' s arguments filed 2/25/2026 have been fully considered but they are not persuasive.
NCBI reference sequence XM_040826762.1 discloses a partial mRNA from a fungal pathogen Metarhizium album with 100% sequence identity to the reverse of SEQ ID NO: 23. This nucleic acid molecule thus comprises SEQ ID NO: 23 as well as the full length reverse complement of SEQ ID NO: 23. See alignment below. SEQ ID NO: 23 (top) vs NCBI reference sequence XM_040826762.1. The sequenced mRNA reads on an isolated nucleic acid molecule, because it is extracted from the organism for sequencing. Thus, claim 27 is anticipated by NCBI reference sequence XM_040826762.1.
Metarhizium album ARSEF 1941 RhoGAP domain containing protein (MAM_07964), partial mRNA
Sequence ID: XM_040826762.1Length: 3336
Range 1: 1768 to 1787
Alignment statistics for match #1
Score
Expect
Identities
Gaps
Strand
40.1 bits(20)
1.6
20/20(100%)
0/20(0%)
Plus/Minus
Query 1 TTGAGGATAACAGCATCATC 20
||||||||||||||||||||
Sbjct 1787 TTGAGGATAACAGCATCATC 1768
Applicant urges that amended claim removes recitation of a full length complement of SEQ ID NO: 23, rendering the rejection moot (Remarks, page 24, paragraph 6).
This argument is unpersuasive, because a nucleic acid molecule comprising a full length complement of SEQ ID NO: 23 would also comprise SEQ ID NO: 23, so amended claim 27 is still anticipated by NCBI reference sequence XM_040826762.1.
Claims 29 and 31 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Mascher et al (2014) PLOS One. 9(5): e96782 (published 5/7/2014, hereafter Mascher) taken with the evidence of GenBank accession KF241981.1 (nucleotides 23117-23126 available 11/10/2015) and Nock et al (2011) Plant Biotechnology Journal. 9: 328–333 (published 8/27/2010, hereafter Nock).
This is a new rejection necessitated by Applicant’s amendment. Applicant' s arguments filed 2/25/2026 have been fully considered but they are not persuasive.
Claims 29 and 31 are drawn to a biological sample derived from corn event DAS-01131-3 wherein said sample comprises a nucleotide sequence which is or is complementary to SEQ ID NO: 25 and a DNA sample extracted from the transgenic corn plant comprising a nucleotide sequence chosen from SEQ ID NOs: 19-27.
Mascher discloses genomic DNA extracted from B73 maize lines (page 9, right column, paragraph 2-3). GenBank accession KF241981.1 provides evidence that the maize cultivar B73 comprises a nucleic acid molecule with 100% sequence identity to instant SEQ ID NO: 25. See alignment below. Nock provides evidence that total DNA extractions of plants include chloroplast DNA (page 329, left column paragraph 1).
Score
Expect
Identities
Gaps
Strand
20.3 bits(10)
506
10/10(100%)
0/10(0%)
Plus/Plus
Query 1 TCTAATATGC 10
||||||||||
Sbjct 23117 TCTAATATGC 23126
Although Mascher does not specifically disclose DNA extracted from transgenic corn event DAS-01131-3, claims 29 & 31 are product by process claims that are drawn to a sample comprising a nucleotide sequence of SEQ ID NO: 25. The extraction of the DNA sample from the corn event would not necessarily impart markedly different characteristics from DNA extracted from another sample. Since the nucleotide sequence of SEQ ID NO: 25 is the only structural characteristic required by claims 29 & 31, and since SEQ ID NO: 25 is found in DNA extracted from B73 maize, the sample of DNA extracted from B73 line of corn reads on a DNA sample of instant claims 29 & 31.
Applicant urges that amended claim 29 removes the recitation of SEQ ID NO: 22 rendering the rejection moot (Remarks, page 25, paragraph 4).
This argument is unpersuasive, because a nucleotide sequence of SEQ ID NO: 25 is found in B73 maize.
Claims 29 and 32 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Venkatesh et al (2015) J. Agric. Food Chem. 63, 5282−5295 (published 5/12/2015, hereafter Venkatesh) taken with the evidence of GenBank accession KF241981.1 (nucleotides 23117-23126 available 11/10/2015).
This is a new rejection necessitated by Applicant’s amendment. Applicant' s arguments filed 2/25/2026 have been fully considered but they are not persuasive.
Claims 29 and 32 are drawn to a biological sample derived from corn event DAS-01131-3 wherein said sample comprises a nucleotide sequence which is or is complementary to SEQ ID NO: 25, and biological samples chosen from corn flour, meal, syrup, oil, starch or cereals.
Venkatesh teaches hybrids between B73 and landrace inbred lines, where B73 is used as the female parent (page 5283, left column, paragraph 4-right column, paragraph 3). Venkatesh teaches grain samples taken from these plants and ground to powder (page 5283, right column, paragraph 4) to measure grain qualities (page 5284, left column, paragraph 2 & table 4). This reads on a biological sample of corn flour or corn meal. GenBank accession KF241981.1 provides evidence that the maize cultivar B73 comprises a nucleic acid molecule with 100% sequence identity to instant SEQ ID NO: 25. See alignment above.
Claims 29 & 32 are product by process claims that are drawn to a sample comprising a nucleotide sequence chosen from SEQ ID NO: 25. The extraction of corn flour, meal, syrup, oil, starch, and cereals from the corn event would not necessarily impart markedly different characteristics from such samples extracted from another corn plant. Since the nucleotide sequence of SEQ ID NO: 25 is the only structural characteristic required by claims 29 & 32, and since SEQ ID NO: 25 is found in DNA extracted from B73 maize, the sample of ground powder extracted from B73 line of corn reads on a biological sample of instant claims 29 & 32.
Applicant urges that the amended to claim 29 to remove recitation of SEQ IDN O: 22 renders the rejection moot (Remarks, page 26, paragraph 2).
This argument is unpersuasive, because a nucleotide sequence of SEQ ID NO: 25 is found in B73 maize.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 21-22 are rejected under 35 U.S.C. 103 as being unpatentable over Portilho Carneiro et al (US 2021/0340558 A1, published 11/4/2021, hereafter Portilho Carneiro) in view of Lu et al US 2020/0332314 A1, published 10/22/2020, more than one year prior to the priority filing date of the instant application, hereafter Lu), Griffin (2021) et al J. of Agricultural and Food Chemistry. 69(17) (published 4/7/2021, hereafter Griffin), and Kumar et al US 9,688,996 B2 (published 6/27/2017, hereafter Kumar).
The rejection is repeated for the reasons of record as set forth in the Office action mailed 11/25/2025, as applied to claims 21-22. Applicant' s arguments filed 2/25/2026 have been fully considered but they are not persuasive.
Claims 21-22 are drawn to a DNA construct comprising two operably linked expression cassettes comprising a cry1DA2 and a dgt-28 epsps and a corn plant comprising the construct.
Portilho Carneiro teaches a Cry1Da gene capable of controlling development of Spodoptera frugiperda (paragraph [0121], Portilho Carneiro SEQ ID NO: 1). Portilho Carneiro figure 3 teaches a construct comprising both Ubi::cry1Da::NOS and 2x35S::bar::Tvsp (paragraph [0059], figure 3). Portilho Carneiro teaches the creation of the gene construct by cloning the codon optimized cry1Da gene into a vector containing a maize ubiquitin promoter and nos terminator, which was used to transform maize and generate maize events containing the cry1Da nucleic acid sequence (paragraph [0125-0133]). Transformed maize were grown in selective media (paragraph [0130]).
Portilho Carneiro teaches examples of selectable markers, including herbicide tolerance genes such as modified 5-enolpyruvyl-3-phosphoshikimate synthase (EPSPS) or the phosphinothricin acetyl transferase gene (bar), operably linked to at least one promoter and terminator sequence (paragraph [0105]). Portilho Carneiro teaches that recovery of transgenic lines without selection is generally low, so plant transformation generally includes transferring a gene of interest and a selection marker gene (paragraph [0026]).
Portilho Carneiro teaches that the maize ubiquitin gene Ubi1 promoter is the most widely used promoter to target expression of a constitutive protein in maize (paragraph [0028]).
Portilho Carneiro does not teach that the cry1Da expression cassette comprises a cry1Da2, nor an expression cassette comprising a dgt-epsps. Portilho Carneiro does not teach an ubiZM1 terminator or that the maize Ubi1 promoter is used along with a ubiZM1 5’UTR and intron.
Lu teaches a Cry1D polypeptide may be a Cry1Da or Cry1Da2 polypeptide and teaches a polynucleotide that encodes the polypeptide of Cry1Da2 (accession 176415) (paragraph [0042-0043, 0077]). Lu envisions a DNA construct comprising a polynucleotide encoding a Cry1D polypeptide operably linked to heterologous regulatory elements (Lu claim 2).
Griffin teaches a dgt-28 epsps gene from Streptomyces sviceus (page 5097 left column paragraph 1). Griffin teaches that transformation of corn plants with this dgt-28 epsps gene confers high levels of glyphosate resistance in plants (page 5098, right column, paragraphs 2-3 & 6-7, table 3, figure 5).
Kumar teaches a DNA construct comprising both an expression cassette comprising a promoter from the Maize ubiquitin gene, a Cry gene, and a 3’ UTR (column 19, lines 63-67) and an expression cassette comprising an AAD-1 herbicide tolerance gene, a ZMUbi1 promoter and a ZmLip 3'UTR (column 19, lines 51-63). Kumar teaches a “control sequence” comprising the ZmUbi 3’UTR region (Kumar SEQ ID NO: 1) and teaches that the 3’UTR, or terminator, is needed for transcription termination and polyadenylation (column 6, lines 8-10). Figure 6 depicts the construct comprising maize ubiquitin promoters, maize ubiquitin upstream promoter regions, a Cry protein gene, an herbicide tolerance gene, a maize ubiquitin 3’ UTR and another 3’UTR. Figure 4 and Figure 2B teach that the ZmUbi1 promoter v8 includes a ZmUbi1 intron. Kumar teaches that maize plants comprising constructs with the ZmUbi1 3’UTR had higher Cry protein expression that plants comprising constructs with the PinII 3’UTR (column 24, lines 43-50). The expression cassettes for the Cry gene and herbicide tolerance gene are operably linked (Kumar Figure 6).
Before the time of filing of the instant application, it would have been obvious to one of ordinary skill in the art to modify the DNA construct of Portilho Carneiro to substitute the Cry1Da2 gene of Lu for the Cry1Da gene. One of ordinary skill in the art would have been motivated to use a Cry1Da2 gene because Lu teaches that the Cry1Da2 gene is an acceptable Cry1D gene for insecticidal activity in transgenic maize plants. One would have had reasonable expectation of success, because transgenic maize expressing Cry proteins are well known in the art.
Before the time of filing of the instant application, it would have been obvious to one of ordinary skill in the art to modify the DNA construct of Portilho Carneiro to substitute the bar herbicide tolerance gene for one encoding a dgt-28 epsps as taught by Griffin. One of ordinary skill would have been motivated to use a dgt-28 epsps gene for selection, because Portilho Carneiro teaches that selectable gene improve recovery of transgenic plants, and choosing one herbicide-tolerant marker over another herbicide-tolerant marker would have been substitution of one known element (an herbicide marker) for another. One would have had reasonable expectation of success, because the dgt-28 epsps gene was known to provide tolerance in maize, and Portilho Carneiro listed epsps genes as examples of selectable markers that could be used.
Finally, before the time of filing of the instant application, it would have been obvious to one of ordinary skill in the art to modify the DNA construct of Portilho Carneiro to use an ZmUbi1 promoter region including an intron and the ZmUbi 3’UTR for both the Cry gene and the herbicide tolerance gene. Using the same ZmUbi1 promoter and upstream region, including the intron, which reads on an ubiZM1 promoter, ubiZM1 5’ UTR and ubiZM1 Intron, and the same Ubi 3’UTR region, which reads on a ubiZM1 terminator (instant claim 21, lines 7 & 13), would have been a design choice that would not have markedly affected the function of the construct. One of ordinary skill in the art would have been reasonably confident of success in using these regulatory elements, because the Cry protein under regulation by this 5’UTR and 3’UTR was effectively expressed in maize.
Thus, claims 21 & 22, to the construct and a corn plant comprising the construct, are obvious over Portilho Carneiro, Lu, Griffin, and Kumar.
Applicant urges that combining Portilho Carneiro with Lu and with Griffin does not provide an expression cassette comprising an ubiZM1 terminator, an ubiZM1 5’UTR and an ubiZM1 intron and that Kumar does not teach an expression cassette comprising an ubiZM1 5’UTR (Remarks, page 28, paragraph 3-page 29 paragraph 2). Applicant urges that Portilho Carneiro, Kumar, Lu, and Griffin do not teach an expression cassette comprising an ubiZM1 5’UTR and urges that claims 21-22 are not obvious because all claim elements must be taught or suggested by the prior art and one of skill in the art must have had a reason to modify or combine the teachings of the cited references (Remarks, page 30, paragraph 5-page 31, paragraph 2).
This argument is unpersuasive, because one cannot show non-obviousness by attacking references individually where, as here, the rejections are based on combinations of references. In re Keller, 208 USPQ 871 (CCPA 1981).
Kumar explicitly teaches “provided are compositions and methods for genetically modifying cells, tissues, or organisms using 5’ and/or 3’ UTR regions isolated or derived from a Zea mays ubiquitin gene” and that such control sequences may be engineered to flank a structural nucleic acid of interest to improve mRNA stability or increase translational efficiency in a transgenic plant (column 5, lines 52-62). Kumar unambiguously states that the sequences taught comprise a Zea mays ubiquitin 5’ UTR, and furthermore describes the 5’ UTR as belonging to a maize Ubi1 (column 6, lines 32-36). Kumar teaches that the 5’ Ubi1 UTR may be inserted into a cloning vector operably linked to a desired promoter and a structural nucleic acid sequence of interest (column 14, lines 1-6), which reads on an expression cassette comprising an ubiZM1 5’UTR. One of skill in the art would have understood the meaning of a Zea mays ubiquitin 5’ UTR used by Kumar and applied in the rejection above.
All claim elements were taught or suggested by the prior art, as outlined in the rejection above. One of skill in the art would have had motivation to combine the elements, as outlined above, including in order to provide insecticidal activity, a selectable marker gene, and improved expression. Therefore, the claims would have been obvious at the time of filing of the instant application.
Applicant urges that substituting a bar herbicide tolerance gene of Portilho Carneiro for a dgt-28 epsps of Griffin would not be obvious because dgt-28 epsps provides tolerance to glyphosate and glyphosate contains a mode of action by inhibiting the EPSPS enzyme whereas bar is a phosphinothricin acetyltransferase gene that confers resistance to the herbicide phosphinothricin. Applicant urges that because the bar gene and the dgt-28 epsps gene have different modes of action and confer tolerance/resistance to different herbicides, the substation would not be obvious to one of skill in the art and Portilho Carneiro nor Griffin provide a suggestion or motivation to substitute bar for dgt-28 epsps (Remarks, page 28, paragraph 4).
This argument is unpersuasive, as addressed in Non-Final rejection mailed 11/25/2025, because Portilho Carneiro teaches the herbicide tolerance gene in the DNA construct to be useful as a selective marker, not merely due to its specific mode of action or specific herbicide tolerance. Because Portilho Carneiro teaches the motivation to use a selectable marker gene to recover successful transformants, and because Portilho Carneiro teaches a modified epsps gene as one such example of an herbicide tolerance selectable marker gene, it would have been obvious to one of skill in the art to substitute the dgt-28 epsps gene for a bar gene to use for selecting transformed maize plants. One of ordinary skill in the art would have had reasonable expectation of success in using either gene as a selectable marker for transformants.
Applicant urges that substituting an ubiZM1 3’UTR or terminator for a nos or Tvsp 3’ UTR would not have been obvious because Kumar, which teaches a construct with ZmUbi1 3’UTR having higher Cry protein expression did not teach the higher expression with Cry1Da2, the protein of instant claims 21-22. Applicant urges that none of the cited references teach that substituting Cry34Ab for Cry1Da2 would result in the same protein expression levels in the construct used by Kumar (Remarks, page 29, paragraph 4).
This argument is unpersuasive, because the use of one known 3’ UTR or terminator in place of another known 3’ UTR terminator would have been obvious to one of skill in the art. Obviousness does not require absolute predictability, only a reasonable expectation of success, i.e., a reasonable expectation of obtaining similar properties. See, e.g., In re O’Farrell, 853 F.2d 894, 903, 7 USPQ2d 1673, 1681 (Fed. Cir. 1988). Thus, one of skill in the art would have been motivated to use the ubiZM1 3’UTR, which had given better expression levels in another construct encoding a Cry protein.
Applicant submits that substituting the Cry34Ab gene for one encoding a Cry1DA2 protein would not be a simple substitution of one known, equivalent element for another to obtain predictable results (Remarks, page 30, paragraph 1).
This argument is unpersuasive, because the rejection provided in the Office Action mailed 11/25/2025 presents that the rationale for using a Cry1Da2 gene would have been the motivation taught by Lu that Cry1Da2 is an acceptable Cry1D gene for insecticidal activity in transgenic maize plants, not simple substitution. One of skill in the art would have been motivated to substitute Cry1Da2 because it was known to be acceptable for insecticidal activity in transgenic maize.
Applicant urges that the examiner cannot pick and choose only one aspect of a prior art reference and exclude other aspects of the reference or ignore the central teaching of the reference, and that obviousness cannot be based on hindsight combination of components or to take a statement in the reference out of context and give it a meaning it would not have had to a person skilled in the art (Remarks, page 30, paragraph 2-paragraph 4).
This argument is unpersuasive, because “[a]ny judgement on obviousness is in a sense necessarily a reconstruction based on hindsight reasoning, but so long as it takes into account only knowledge which was within the level of ordinary skill in the art at the time the claimed invention was made and does not include knowledge gleaned only from applicant’s disclosure, such a reconstruction is proper.” In re McLaughlin 443 F.2d 1392, 1395, 170 USPQ 209, 212 (CCPA 1971).
All individual elements of the construct of instant claim 21 were known in the art prior to the filing of the instant application, and the combination of these individual elements would have been obvious to one of ordinary skill in the art. Applicant has provided no evidence that the claimed combination of these known elements would have provided unexpected results. Applicant is reminded that evidence submitted after final will not be considered unless Applicant provides a showing of good and sufficient reasons of why they were necessary and not earlier presented.
Conclusion
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Victoria L DeLeo whose telephone number is (703)756-5998. The examiner can normally be reached M-F 8:00am-12pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at (571) 270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/VICTORIA L DELEO/Examiner, Art Unit 1662
/Anne Kubelik/Primary Examiner, Art Unit 1663