Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Applicant’s amendments and remarks filed on November 30, 2025 are acknowledged. Claims 6-8, 12, 15, 17, 19, 22-23, 28, 30, and 32 have been canceled. Claims 1, 18, 20, and 21 were amended. Claims 1-5, 9-11, 13-14, 16, 18, 20-21, 24-27, 29, and 31 are pending. Claims 24-27, 29, and 31 are withdrawn. Claims 1-5, 9-11, 13-14, 16, 18, and 20-21 are examined on the merits herein.
Election/Restrictions
Applicant’s election of Group I (claims 1-5, 9-11, 13-14, 16, 18, and 20-21) and SEQ ID NO: 107 in the reply filed on January 29, 2024 is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)).
The elected species, SEQ ID NO: 107, was found to be free of the art. Therefore, the search was extended to the following species: SEQ ID NOS: 1, 2, and 4-14. Prior art applicable to SEQ ID NO: 2 was found and used to reject the claims.
Withdrawn Rejections
In view of Applicant’s amendments and response, the 35 U.S.C 112(d), 35 U.S.C 102, and 35 U.S.C 103 rejections are withdrawn.
New Grounds of Rejections Necessitated by Amendment
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 1-5, 9-11, 14, 16, 18, and 20 are rejected under 35 U.S.C. 103 as being unpatentable over Jain et al. (WO 2020/263985; reference cited by Applicant) in view of Stewart-Jones et al. (US 2023/0108894).
Regarding claims 1, 10, 11, and 18, Jain et al. teaches messenger RNAs (mRNAs) having chemical and/or structural modifications, including RNA elements and/or modified nucleotides, which provide desirable regulation of mRNA localization, stability, and/or translation to yield increased mRNA expression and activity of an encoded polypeptide [abstract]. Jain et al. teaches an mRNA comprising a 5’ cap, a 5’ UTR comprising a structural RNA element comprising a stem-loop, an ORF encoding a polypeptide (polypeptides of interest such as therapeutic polypeptides [page 225, last paragraph]), and a 3’ UTR [page 6, last paragraph bridging to page 7]. Jain et al. also teaches that the mRNA may include a poly A sequence and/or polyadenylation signal [page 114, first full paragraph]. Further, Jain et al. teaches that the structural RNA element comprising a stem-loop increases an expression level of a polypeptide translated from the mRNA relative to an mRNA that does not comprise the structural RNA element comprising a stem-loop [page 38, last paragraph]. Jain et al. also teaches an mRNA comprising one or more C-rich RNA elements and one or more structural RNA elements comprising a stem loop (e.g., 2, 3, 4) [page 58, first full paragraph]. Jain et al. also teaches that the miRNA binding site can be incorporated into the 5’ or 3’ stem of the stem loop [page 178, third full paragraph].
Regarding claim 2, Jain et al. teaches an mRNA comprising an RNA element that comprises a sequence and/or an RNA secondary structure that provides a desired translational regulatory activity [page 32, last paragraph]. The RNA element can be identified and/or characterized by RNA secondary structure formed by the element (e.g., stem-loop), by the location of the element within the RNA molecule (e.g., located within the 5’ UTR of an mRNA), and by the biological function and/or activity of the element (e.g., translational enhancer element) [page 33, first paragraph].
Regarding claims 3 and 4, Jain et al. teaches that a miRNA binding site refers to a sequence within a nucleic acid molecule (e.g., within a DNA or within an RNA transcript including in the 5’ UTR and/or 3’ UTR) that has sufficient complementarity to all or a region of a miRNA to interact with, associate with or bind to the miRNA [page 164, first full paragraph]. Jain et al. also teaches that the miRNA binding site has one, two, three, four, five, six, seven, eight, nine, ten, eleven or twelve mismatches from the corresponding miRNA [page 165, last paragraph].
Regarding claim 5, the length of the 5’ UTR was varied and the effect on the rate of leaky scanning of a reporter mRNA was evaluated in HeLa cells and AML12 cells. Jain et al. demonstrated that for HeLa cells and AML12 cells, a short 5’ UTR (<50 nucleotides in length) gave high levels of leaky scanning relative to the reference 5’ UTR while a long 5’ UTR (>250 nucleotides in length) gave low levels of leaky scanning. Therefore, the length of the 5’ UTR is inversely correlated with the rate of leaky scanning [page 328, last paragraph].
Regarding claim 9, Jain et al. teaches that a nucleic acid molecule (e.g., RNA and mRNA) can be engineered to include more than one miRNA site expressed in different tissues or different cell types of a subject [page 177, second paragraph].
Regarding claims 14 and 16, Jain et al. teaches that a 5’ UTR and/or 3’ UTR of the nucleic acid molecule comprises one or more miRNA binding sites [page 164, first full paragraph]. Jain et al. also teaches that a 3’ UTR can comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 miRNA binding sites [page 177, first paragraph]. Jain et al. also teaches that regulation of expression in multiple tissues can be accomplished through introduction of one or more miRNA binding sites (e.g., one or more distinct miRNA binding sites) [page 166, last paragraph].
Regarding claim 20, Jain et al. teaches that constructs and vectors may be used to in vitro transcribe an mRNA [page 163, first paragraph].
However, Jain et al. does not teach that the 5’ UTR comprises SEQ ID NO: 2 or a nucleic acid sequence with at least 97%, 98%, or 99% nucleotide sequence identity thereto.
Stewart-Jones et al. discloses on page 79 (reproduced below) the following:
PNG
media_image1.png
344
768
media_image1.png
Greyscale
Stewart-Jones et al. SEQ ID NO: 96 (designated as Db) is 401 nucleotides in length and has a match to instant SEQ ID NO: 2 (designated as Qy) which is 60 nucleotides in length as shown in the alignment below.
PNG
media_image2.png
116
582
media_image2.png
Greyscale
Stewart-Jones et al. teaches that in some embodiments, the RNA further comprises a 5’ UTR, optionally wherein the 5′ UTR comprises the sequence of SEQ ID NO: 2 [0011]. Further, Stewart-Jones et al. teaches that a 5’ UTR is a synthetic UTR which has been mutated to improve properties which increase gene expression [0130]. Stewart-Jones et al. SEQ ID NO: 96 (designated as Db) is 401 nucleotides in length and has a 100% match to Stewart-Jones et al. SEQ ID NO: 2 (designated as Qy) as shown in the alignment below. Stewart-Jones et al. SEQ ID NO: 2 is the 5’ UTR of SEQ ID NO: 96 [page 79].
Query Match 100.0%; Score 57; DB 1; Length 401;
Best Local Similarity 100.0%;
Matches 57; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGACCCCGGCGCCGCCACC 57
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAUAAGACCCCGGCGCCGCCACC 57
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to substitute the 5’ UTR of Jain et al. with the RNA sequence of Stewart-Jones et al. because doing so would have been no more than the simple substitution of one known element for another to obtain predictable results. One would have been motivated to do so to achieve the predictable result of enhancing stability because Stewart-Jones et al. taught that regulatory features of a UTR can be incorporated into polynucleotides to enhance stability of the molecule [0128].
Claim 13 is rejected under 35 U.S.C. 103 as being unpatentable over Jain et al. (WO 2020/263985; reference cited by Applicant) in view of Stewart-Jones et al. (US 2023/0108894) as applied to claims 1-5, 9-11, 14, 16, 18, and 20 above, and further in view of Gu et al. (RNA 2014).
Regarding claim 13, the teachings of Jain et al. and Stewart-Jones et al. are discussed above.
However, Jain et al. and Stewart-Jones et al. do not teach that the synthetic 5’ UTR has less than 50%, 40%, 30%, 20%, or 10% G-C content.
Gu et al. teaches that a lower GC content of the 5’ UTR is associated with a greater increase in mRNA stability near the 5’ cap [page 1373, right column, last paragraph bridging to page 1374, left column].
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the 5’ UTR of Stewart-Jones et al. to have a low G-C content because it would have amounted to combining known prior art elements to yield predictable results. One would have made such a modification in order to achieve the predictable result of increased mRNA stability because Gu et al. taught that a lower GC content of the 5’ UTR is associated with a greater increase in mRNA stability near the 5’ cap.
Claim 21 is rejected under 35 U.S.C. 103 as being unpatentable over Jain et al. (WO 2020/263985; reference cited by Applicant) in view of Stewart-Jones et al. (US 2023/0108894) as applied to claims 1-5, 9-11, 14, 16, 18, and 20 above, and further in view of Moore et al. (WO 2018/213789; reference cited by Applicant).
Regarding claim 21, the teachings of Jain et al. and Stewart-Jones et al. are discussed above.
However, Jain et al. and Stewart-Jones et al. do not explicitly teach a plasmid or viral vector.
Moore et al. teaches that DNA plasmid constructs were generated and used to produce reporter mRNAs, via in vitro transcription [page 241, first full paragraph].
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to substitute the vector of Jain et al. and Stewart-Jones et al. with a plasmid vector as taught by Moore et al. because both Jain et al. and Moore et al. teaches using vectors to in vitro transcribe an mRNA and doing so would have been no more than the simple substitution of one known element for another to obtain predictable results. One would have been motivated to use a plasmid vector to obtain the predictable result of producing reporter mRNA as taught by Moore et al.
Response to Arguments
In reference to Applicant’s arguments against the Jain et al. reference, the Examiner agrees with Applicant’s assertions that the Jain et al. reference does not meet the claim limitation of “wherein the 5’ UTR comprises one of SEQ ID NOS: 1-36, 40-45, 60-66, 80-86, 104, 105, or 107-126 or a nucleic acid sequence with at least 97%, 98%, or 99% nucleotide sequence identity thereto” based on Applicant’s amendments. Therefore, the Stewart-Jones et al. reference is used in combination with Jain et al. to render obvious the limitation of “at least 97%, 98%, or 99% nucleotide sequence identity thereto” for claims 1, 18, and 20 as discussed above in the 35 U.S.C. 103 rejection. Applicant’s remaining arguments directed against the 5’ UTR sequence of the Jain et al. reference are rendered moot because Applicant’s amendment necessitated the new grounds of rejection presented in this Office action.
Applicant asserts the following:
PNG
media_image3.png
212
744
media_image3.png
Greyscale
These arguments are not found persuasive. In view of Applicant’s amendments, the Jain et al. reference does not meet the limitations of amended claim 1, specifically the 5’ UTR. The Stewart-Jones et al. reference is used in combination with Jain et al. to render obvious the limitation of “wherein the 5’ UTR comprises one of SEQ ID NOS: 1-36, 40-45, 60-66, 80-86, 104, 105, or 107-126 or a nucleic acid sequence with at least 97%, 98%, or 99% nucleotide sequence identity thereto”. Therefore, Applicant’s assertions that Jain et al. discloses high GC 5’-UTRs is rendered moot. In reference to Applicant’s arguments against the Gu et al. reference, Gu et al. teaches that a lower GC content of the 5’ UTR is associated with a greater increase in mRNA stability near the 5’ cap [page 1373, right column, last paragraph bridging to page 1374, left column]. Therefore, it would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the 5’ UTR of Stewart-Jones et al. to have a low G-C content because it would have amounted to combining known prior art elements to yield predictable results. One would have made such a modification in order to achieve the predictable result of increased mRNA stability because Gu et al. taught that a lower GC content of the 5’ UTR is associated with a greater increase in mRNA stability near the 5’ cap.
Conclusion
No claims are allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to CHRISTINA TRAN whose telephone number is (571)270-0550. The examiner can normally be reached M-F 7:30 - 5:00pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached on (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/C.T./
Examiner, Art Unit 1637
/Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637