DETAILED ACTION
This action is in reply to papers filed 02/08/2026.
Claims 1-10 are pending and examined herein.
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Withdrawn Objection(s) and Rejection(s)
The objection to claim 5 is withdrawn in light of amendments to the claim, which obviates the passive language.
The rejection of claims 4-6 and 10 under 35 U.S.C. 112(b) is withdrawn in light of the amendments to claims 4 and 10, which obviates the lack of antecedent basis, and to claim 6, which obviates the latent language regarding the transfected acinar cell. The rejection of claim 5 is withdrawn because it depends from claim 4.
The rejection of claim 9 under 35 U.S.C. 102(a)(1) as being anticipated by Song (Biochemical and Biophysical Research Communications, 2004, 316(4): 1094-1100) is withdrawn in light of the amendment to claim 9, which requires the limitation “wherein the insulin-secreting cell is the transfected acinar cell with overexpression of N-acetylglucosaminyltransferase V (GnT-V).”
The rejection of claim(s) 1-3, 6, and 9 under 35 U.S.C. 102(a)(1) as being anticipated by Lemper (Cell Death and Differentiation, 2015, 22(7): 1117-1130) is withdrawn in light of the amendments to claim 1, which requires the limitation “wherein the transfected acinar cell overexpresses N-acetylglucosaminyltransferase V (GnT-V),” and to claim 9, which requires the limitation “wherein the insulin-secreting cell is the transfected acinar cell with overexpression of N-acetylglucosaminyltransferase V (GnT-V).”
The rejection of claim(s) 1-2 and 7-8 under 35 U.S.C. 102(a)(1) as being anticipated by Yan (American Journal of Translational Research, 2016, 8(2): 419-432) is withdrawn in light of the amendment to claim 1, which requires the limitation “wherein the transfected acinar cell overexpresses N-acetylglucosaminyltransferase V (GnT-V).”
Specification
The substitute specification filed 02/08/2026 has not been entered because it does not conform to 37 CFR 1.125(b) and (c) because: a clean copy of the substitute specification has not been supplied.
Claim Objections
Claim 6 is objected to because of the following informalities: Amended claim 6 recites the phrase “wherein the transdifferentiation of acinar cells is to transdifferentiate into insulin secreting cells.” For the sake of clarity, it is recommended that the phrase be amended to recite “wherein the transdifferentiation of acinar cells is transdifferentiation of acinar cells into insulin-secreting cells.”
Claim Interpretation
The amendment to claim 1 requires the transfected acinar cell to overexpress GnT-V, which provides a structural limitation to the transfected acinar cell. This structural limitation was not present in previous claim 1, which recited the limitation “wherein the plasmid contains a genetic material for overexpression of N-acetylglucosaminyltransferase V (GnT-V)” (lines 6-7 of claims filed 05/03/2025). This limitation was a recitation of intended use, which did not impart a structural limitation to the plasmid or genetic material, and therefore was not given patentable weight in the previous Office Action. See MPEP 2111.02(II). Therefore, new grounds of rejection, as necessitated by the amendment to claim 1, are presented below.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 5 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 5 recites the limitation “further comprising the following step to obtain the MGAT5 cDNA” (lines 1-2). It is unclear how this step relates back to claim 1. For example, this step could refer to obtaining the MGAT5 cDNA to synthesize the plasmid recited in claim 1. Alternatively, the phrase “further comprising the following step” of claim 5 suggests that the step recited therein is a separate step, such as obtaining the MGAT5 cDNA from the transfected acinar cells. Therefore, the metes and bounds of claim 5 are unclear.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claim(s) 1-9 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Cheng (Journal of Cellular Physiology, 2022, 237(3): 1780-1789; first published 21 November 2021).
Regarding claim 1: Cheng teaches a method for promoting the stemness of human parotid gland acinar cells by transfection with a GnT-V-overexpression plasmid containing MGAT5 cDNA (Abstract; Sections 2.1-2.2). The transfected acinar cells exhibited increased expression of GnT-V relative to mock-transfected cells (Section 3.1; Fig 1a), as well as increased expression of stem cell markers OCT3/4, c-Myc, and NANOG, indicating stemness (Section 3.1; Figure 1c).
Regarding claims 2-3: Cheng teaches that the GnT-V-overexpression plasmid was transfected into acinar cells using a lentiviral vector (Sections 2.1-2.3).
Regarding claims 4-5: Cheng teaches that to prepare the GnT-V-overexpression plasmid, the linear DNA fragment encoding GnT-V was amplified from a previously cloned MGAT5 complementary DNA (cDNA) with a sense primer (5′-ACGGTACCACCATGGCTCTCTTCACTCCGTGGAA-3′) and an anti-sense primer (5′-ACCTCGAGCTATAGGCAGTCTTTGCAGAGAGCC-3′) (Section 2.2).
The sense primer taught in Cheng has 100% similarity to the sequence set forth in SEQ ID NO: 2 of the instant application (claim 5):
Query Match 100.0%; Score 34; DB 1; Length 34;
Best Local Similarity 100.0%;
Matches 34; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 ACGGTACCACCATGGCTCTCTTCACTCCGTGGAA 34
||||||||||||||||||||||||||||||||||
Db 1 ACGGTACCACCATGGCTCTCTTCACTCCGTGGAA 34
The anti-sense primer taught in Cheng has 100% similarity to the sequence set forth in SEQ ID NO: 3 of the instant application (claim 5):
Query Match 100.0%; Score 33; DB 1; Length 33;
Best Local Similarity 100.0%;
Matches 33; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 ACCTCGAGCTATAGGCAGTCTTTGCAGAGAGCC 33
|||||||||||||||||||||||||||||||||
Db 1 ACCTCGAGCTATAGGCAGTCTTTGCAGAGAGCC 33
Accordingly, although Cheng is silent regarding the sequence of the MGAT5 cDNA (claim 4), because both the sense and anti-sense primers taught in Cheng to derive the MGAT5 cDNA are identical to the sequences set forth in SEQ ID NOs: 2-3 of the instant application, the MGAT5 cDNA amplified using the primers taught in Cheng would have an identical sequence to the sequence set forth in SEQ ID NO: 1 of the instant application.
Regarding claims 7-8: Cheng teaches transfecting human parotid gland acinar cells (claim 8), which are salivary gland acinar cells (claim 7) (Abstract; Section 2.1).
Regarding claims 6 and 9: Cheng is silent regarding the transdifferentiation of acinar cells into insulin-secreting cells. As set forth above, Cheng teaches a method that reads on the method of instant claim 1. Therefore, carrying out the method of Cheng, which is identical to the method of claim 1, would inherently result in the transdifferentiation of transfected acinar cells into insulin-secreting cells, as claimed in claim 6, as well as transfected acinar cells that overexpress GnT-V and secrete insulin, as claimed in claim 9.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claim(s) 1 and 10 are rejected under 35 U.S.C. 103 as being unpatentable over Cheng (Journal of Cellular Physiology, 2022, 237(3): 1780-1789), in view of Ebrahimie (PLoS ONE, 2014, 9(3): e90885) and Baeshen (Microbial Cell Factories, 2014, 13: 141).
The teachings of Cheng are set forth above. Cheng anticipates claim 1.
Regarding claim 10: As set forth above, Cheng teaches a method that reads on the method of instant claim 1. Therefore, carrying out the method of Cheng, which is identical to the method of claim 1, would result in the transdifferentiation of transfected acinar cells into insulin-secreting cells.
Cheng does not teach a method of insulin production, comprising all the steps of claim 1, and further comprising a step of harvesting insulin from the cell culture medium.
Ebrahimie teaches that insulin can be collected (reads on harvested) from conditioned medium comprising insulin-secreting cells (p 3, col 1, para 1).
Baeshen teaches that dietary and lifestyle changes are causing dramatic increase in diabetes incidence all over the world, and therefore, there is increased demand for insulin for use in therapy for both Type I and Type II diabetes (p 7, Conclusion). Baeshen teaches that over the next 20 years (from 2014), the WHO has estimated that insulin sales would grow from $12 billion to $54 billion globally (p 7, Conclusion).
It would have been prima facie obvious for a person of ordinary skill in the art before the effective filing date of the claimed invention to have modified the method of Chang by further harvesting insulin from the cell culture medium. One of ordinary skill in the art would have been motivated to make this modification because Baeshen teaches that there is both a clinical need and market incentive for insulin production and harvest. One of ordinary skill in the art would have had a reasonable expectation of successfully making this modification because Ebrahimie teaches that insulin can be harvested from conditioned medium comprising insulin-secreting cells.
Conclusion
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Risa Takenaka whose telephone number is (571)272-0149. The examiner can normally be reached M-F, 12-7 EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Peter Paras can be reached at (571) 272-4517. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/RISA TAKENAKA/Examiner, Art Unit 1632
/TITILAYO MOLOYE/Primary Examiner, Art Unit 1632
Prosecution Insights