DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
The claims filed 1/13/2026 are under consideration.
The amendments and arguments presented in the papers filed 1/13/2026 ("Remarks”) have been thoroughly considered. The issues raised in the Office action dated 12/17/2025 listed below have been reconsidered as indicated.
a) The objection to the drawings is withdrawn in view of the replacement sheets.
b) The amendments to the specification addressing nucleotide sequence disclosure requirements are acknowledged.
c) The amendments to the specification addressing trade name or mark usage are acknowledged.
d) The rejections of claims 3, 8 and 9 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, are withdrawn in view of the amendments.
e) The rejections of claims 8 and 9 under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, are withdrawn in view of the amendments to the claims.
f) The rejections of claim(s) 1, 2, 8 and 9 under 35 U.S.C. 102(a)(1) as being anticipated by Yeo (Nat Biomed Eng. 2018. 2(4):227-238 and Supporting Information) as evidenced by SmartFlare™ Technical Guide are withdrawn in view of the amendments incorporating the elements of claim 3.
g) The rejection of claim(s) 2 under 35 U.S.C. 103 as being unpatentable over Yeo (Nat Biomed Eng. 2018. 2(4):227-238 and Supporting Information) in view of Liao (Cell Transplantation. 2014. 23(3):303-317) and as evidenced by SmartFlare™ Technical Guide are withdrawn in view of the amendments incorporating the elements of claim 3.
h) The rejections of claim(s) 3, 5, and 6 under 35 U.S.C. 103 as being unpatentable over Yeo (Nat Biomed Eng. 2018. 2(4):227-238 and Supporting Information) in view of Liao (Cell Transplantation. 2014. 23(3):303-317), NM_000442.5, and Mirkin (WO 2008/098248 A2), and as evidenced by SmartFlare™ Technical Guide, are withdrawn. The particular probe sequences are not taught or suggested in the prior art. While PECAM-1 is a target of amplification, detection and siRNA knockdown, nothing in the prior art points one to the particular SEQ ID NO: 9. See Sakurai (Journal of Controlled Release. 2014. 173:110-118); Santel (Gene Therapy. 2006. 13:1222-1234); and Asgeirsdottir (Journal of Controlled Release. 2010. 141:241-251).
The Examiner’s responses to the Remarks regarding issues not listed above are detailed below in this Office action.
New and modified grounds of rejection necessitated by amendment are detailed below and this action is made FINAL.
Election/Restrictions
Applicant’s election without traverse of Group I, claims 1-9, in the reply filed on 10/9/2025 is acknowledged.
Claims 10-20 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 10/9/2025.
Applicant’s election without traverse of PECAM1 as the target gene in the reply filed on 10/9/2025 is acknowledged.
Applicant further elected base sequences recognizing the target gene including SEQ ID NOs: 1, 9, 13 and 15. SEQ ID NOs: 1, 13 and 15 do not recognize PECAM1 and thus, are not commensurate with the elected target gene. Election of SEQ ID NO: 9 is commensurate with the election of PECAM1 as the target gene.
Applicant further elected SEQ ID NOs: 5, 11, 14 and 17 as flare sequences. SEQ ID NOs: 5, 14 and 17 are not flare sequences for PECAM1 and thus, are not flare sequences commensurate with the elected target gene. Election of SEQ ID NO: 11 is commensurate with the election of PECAM1 as the target gene.
Claims 4 and 7 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected species, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 10/9/2025.
Claims 4 and 7 require a combination of target genes, while applicant elected a single target gene, i.e., PECAM1.
Priority
The present application claims priority to US provisional application 63/303,121. Priority is recognized.
Information Disclosure Statement
The listing of references in the specification or citing of references throughout the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892 or cited on a submitted IDS, they have not been considered.
Specification
The amendments to the specification are acknowledged.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 1, 5 and 6 is/are rejected under 35 U.S.C. 103 as being unpatentable over Yeo (Nat Biomed Eng. 2018. 2(4):227-238 and Supporting Information; previously cited) in view of: A) Lee (US 10,881,642 B2), Wang (US 2020/0385685 A1), Young (WO 2020/232416 A1), Cohen (WO 2020/219926 A1), Holmes (US 2020/0297762 A1), and Ponimaskin (WO 2020/065090 A2); and B) Mirkin (WO 2008/098248 A2; previously cited), as evidenced by SmartFlare™ Technical Guide (previously cited).
The following are new rejections over a non-elected species.
Regarding claim 1, Yeo teaches a NanoFlare carrying Cy3 fluorophores targeting glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (paragraph spanning p. 3-4; and last paragraph on p. 8).
The NanoFlares were purchased from Merck Millipore as a “SmartFlare®” (p. 2 of Supporting Information).
PNG
media_image1.png
269
704
media_image1.png
Greyscale
According to the SmartFlare™ Technical guide, the SmartFlare™ has the following structural features (Fig. 1; including annotations added by the Examiner mapping claim elements):
The capture strand complementarily binds with a target and the reporter strand complementarily binds to the capture strand. The duplex of the capture strand and reporter strand is attached to or “formed” on the surface of the gold nanoparticle “core part”.
Yeo does not teach the specific sequence of the GAPDH NanoFlare recognition sequence.
However, the ordinary artisan would have looked to the state of the art to determine a sequence to be targeted by the “recognition sequence”.
Lee, Wang, Young, Cohen, Holmes and Ponimaskin each teach an oligonucleotide sequence targeting GAPDH:
GGCATGGACTGTGGTCATGAG;
ATGGCATGGACTGTGGTCATGAGT;
GGCATGGACTGTGGTCATGAG;
GGCATGGACTGTGGTCATGAG;
CATGGACTGTGGTCATGAGT; and
GGCATGGACTGTGGTCATGAG,
respectively. Each overlaps with SEQ ID NO: 15 of the present application.
It would have been prima facie obvious to the ordinary artisan to have designed GAPDH targeting “recognition sequences” based on this commonly targeted region. The ordinary artisan would have appreciated how to design sequences for NanoFlares based on Mirkin. Mirkin further demonstrates that NanoFlares were known. Mirkin teaches nano-flares are oligonucleotide functionalized nanoparticle conjugates designed to provide an intracellular fluorescence signal that directly or indirectly correlates with the relative amount of a specific intracellular RNA, including mRNA (para. 32). Mirkin further teaches a "Recognition sequence" that is partially or completely complementary to a target molecule of interest (para. 92) and a "reporter sequence" is a sequence that is partially or completely complementary and therefore able to hybridize to the binding moiety and its recognition sequence (para. 93). Mirkin further teaches the reporter sequence is labeled and is comprised of fewer bases than the recognition sequence, such that binding of the recognition sequence in the binding moiety to its target molecule causes release of the hybridized reporter sequence, thereby resulting in a detectable and measurable change in the label attached to the reporter sequence (para. 93).
Mirkin also teaches nanoparticles functionalized with a recognition sequence for a specific target mRNA are hybridized with a short complementary labeled reporter polynucleotide having a reporter sequence and where the fluorescence of the label is quenched when hybridized to the recognition sequence on the nanoparticle and the reporter sequence is also capable of being displaced by the target mRNA (para. 94).
Mirkin teaches those of skill in the art are able to determine relative melting temperatures and/or hybridization conditions in the case of in vitro studies without undue experimentation that will facilitate reporter binding to the recognition sequence in the absence of the target molecule while resulting in displacement of said reporter sequence in the presence of said target molecule (para. 96).
Regarding claims 5 and 6, Mirkin teaches the reporter sequence or “flare sequence” is shorter than the recognition sequence as noted above. Mirkin teaches a reporter sequence having 23 bases (para. 113). Using the above design features, the ordinary artisan would be able to arrive at a “flare sequence” having a length consisting of 14 to 18 nucleotides and having a sequence that is an obvious variant of present SEQ ID NO: 17.
Response to the traversal of the prior art rejections
The Remarks (p. 8-14) have been fully considered but are not persuasive. The arguments do not address the above rejection over an unelected species based on the combination of Yeo, Lee, Wang, Young, Cohen, Holmes, Ponimaskin and Mirkin.
Conclusion
No claims allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JOSEPH G DAUNER whose telephone number is (571)270-3574. The examiner can normally be reached 7 am EST to 4:30 EST with second Fridays Off.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Wu-Cheng Winston Shen can be reached at 5712723157. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JOSEPH G. DAUNER/Primary Examiner, Art Unit 1682