Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Status of Application/Amendment/Claims
Applicant's response filed 06/22/2026 has been considered. Rejections and/or objections not reiterated from the previous office action mailed 12/19/2025 are hereby withdrawn. The following rejections and/or objections are either newly applied or are reiterated and are the only rejections and/or objections presently applied to the instant application. The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action.
With entry of the amendment filed on 06/22/2026, claims 414, 416, 426 and 434-444 are pending in the application.
Maintained Rejections
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 414, 416, 426 and 435-444 is/are rejected under 35 U.S.C. 103 as being unpatentable over Zhang et al. (US 20160153005 of record cited on IDS filed 12/07/2022), Maslakova et al. (Moscow University Biological Sciences Bulletin, 2015, Vol. 70, No. 3, pp. 127–131 of record cited on IDS filed 12/07/2022), Human Z type alpha-1-antitrypsin gene, complete cds (exons 2-5) Nucleotide NCBI 12/16/2025 and
Zhu, Lihua Julie. ("Overview of guide RNA design tools for CRISPR-Cas9 genome editing technology." Frontiers in Biology 10.4 (2015): 289-296).
Regarding claims 414, 416 and 426-444, Zhang et al. teach methods of altering liver cells by contacting the cells with CRISPR-Cas system comprising a gRNA to a target gene SERPINA1 that encodes the protein called Alpha-1 Antitrypsin (A1AT) (see 1274, 1282 and claims). Zhang et al. teach using Cas9 enzymes with improved liver-targeting specificity and teach a nucleic acid encoding the gRNA (see 0010). Zhang et al. teach the use of nanoparticles to deliver the CRISPR enzyme or mRNA or guide RNA (see 0397). Zhang et al. teach delivery can be in cells or in vivo (0609). Zhang et al. does not teach
Zhang et al. does not teach the gRNA sequence having SEQ ID No. 323 or teach the gRNA is configured to target Exon V of the SERPINA1 gene.
Regarding claim 414, 416 and SEQ ID No. 323, Maslakova et al. teach it was known in the art that SERPINA1 gene contains four coding exons, exons 2-5, in several cell types such as liver cells Hep2 (see page 127, Fig 2). Maslakova et al. teach Alpha1-antitrypsin (A1AT) is encoded by the SERPINA1 gene, AIA T is found elevated in some tumors and diseases and found to have high levels in Hep2 cells and high relative expression levels with respect to exons 5 (see Figs. 1 and 2).
It would have been obvious to make a gRNA targeted to the SERPINA1 gene, particularly in the region comprising exons 2-5 and especially exon 5 given Maslakova et al. teach exon 5 had the highest expression of SERPINA1 which encodes A1AT. One of skill in the art would have wanted to try targeting this region in efforts to find a gRNA to use in the CRISPR-Cas system. SEQ ID No. 323 is defined in the instant specification at targeting Exon V of the SERPINA1 gene (see Tables 7 and 8).
The sequence of the SERPINA1 gene encoding A1AT is known as shown below:
Human Z type alpha-1-antitrypsin gene, complete cds (exons 2-5)
GenBank: J02619.1
>J02619.1 Human Z type alpha-1-antitrypsin gene, complete cds (exons 2-5)
GACAATGCCGTCTTCTGTCTCGTGGGGCATCCTCCTGCTGGCAGGCCTGTGCTGCCTGGTCCCTGTCTCCCTGGCTGAGGATCCCCAGGGAGATGCTGCCCAGAAGACAGATACATCCCACCATGATCAGGATCACCCAACCTTCAACAAGATCACCCCCAACCTGGCTGAGTTCGCCTTCAGCCTATACCGCCAGCTGGCACACCAGTCCAACAGCACCAATATCTTCTTCTCCCCAGTGAGCATCGCTACAGCCTTTGCAATGCTCTCCCTGGGGACCAAGGCTGACACTCACGATGAAATCCTGGAGGGCCTGAATTTCAACCTCACGGAGATTCCGGAGGCTCAGATCCATGAAGGCTTCCAGGAACTCCTCCGTACCCTCAACCAGCCAGACAGCCAGCTCCAGCTGACCACCGGCAATGGCCTGTTCCTCAGCGAGGGCCTGAAGCTAGTGGATAAATTTTTGGAGGATGTTAAAAAGTTGTACCACTCAGAAGCCTTCACTGTCAACTTCGGGGACACCGAAGAGGCCAAGAAACAGATCAACGATTACGTGGAGAAGGGTACTCAAGGGAAAATTGTGGATTTGGTCAAGGAGCTTGACAGAGACACAGTTTTTGCTCTGGTGAATTACATCTTCTTTAAAGGCAAATGGGAGAGACCCTTTGAAGTCAAGGACACCGAGGAAGAGGACTTCCACGTGGACCAGGCGACCACCGTGAAGGTGCCTATGATGAAGCGTTTAGGCATGTTTAACATCCAGCACTGTAAGAAGCTGTCCAGCTGGGTGCTGCTGATGAAATACCTGGGCAATGCCACCGCCATCTTCTTCCTGCCTGATGAGGGGAAACTACAGCACCTGGAAAATGAACTCACCCACGATATCATCACCAAGTTCCTGGAAAATGAAGACAGAAGGTCTGCCAGCTTACATTTACCCAAACTGTCCATTACTGGAACCTATGATCTGAAGAGCGTCCTGGGTCAACTGGGCATCACTAAGGTCTTCAGCAATGGGGCTGACCTCTCCGGGGTCACAGAGGAGGCACCCCTGAAGCTCTCCAAGGCCGTGCATAAGGCTGTGCTGACCATCGACAAGAAAGGGACTGAAGCTGCTGGGGCCATGTTTTTAGAGGCCATACCCATGTCTATCCCCCCCGAGGTCAAGTTCAACAAACCCTTTGTCTTCTTAATGATTGAACAAAATACCAAGTCTCCCCTCTTCATGGGAAAAGTGGTGAATCCCACCCAAAAATAACTGCCTCTCGCTCCTCAACCCCTCCCCTCCATCCCTGGCCCCCTCCCTGGATGACATTAAAGAAGGGTTGAGCTGGACTGCCTCTCGCTCCTCAACCCCTCCCCTCCATCCCTGGCCCCCTCCCTGGATGACATTAAAGAAGGGTTGAGCTGG
Zhu teach an overview of guide RNA design tools for use in the CRISPR-Cas9 genome editing technology and teach finding target sites in generally quite easy and teach many computational tools have been developed to aid in finding an optimal gRNA (see abstract and page 90).
It would have been obvious for one of ordinary skill in the art to try the known computational tools to make gRNA targeted to the SERPINA1 gene to use in the CRISPR-Cas9 genome editing technology targeting Exon V of the gene. Given the prior art of Zhang et al. teach gRNA can be used to target the SERPINA1 gene and Maslakova et al. teach Alpha1-antitrypsin (A1AT) is encoded by the SERPINA1 gene and found high levels in Hep2 cells and high relative expression levels with respect to exons 5, one of skill in the art would have wanted make a gRNA targeted to Exon V. SEQ ID No. 323 is complementary to a region in the gene as highlighted above and given Zhu et al. teach how to use tools to design and test for gRNA and given the region of Exon V is known, it would have been obvious to make SEQ ID No. 323 differing by no more than 3 nucleotides as claimed. There is a finite number of sequences within the range of Exon V that can be identified given the size of the gene above and therefore a person of ordinary skill has good reason to make the gRNA within their technical grasp.
Moreover, because there was a known association between Exon V and high expression levels of the SERPINA1 gene and known association with high expression levels and conditions or diseases, there is a predictable outcome of success at reducing expression levels and treatment. There is an expectation of an advantage for making a gRNA targeted to Exon V of the SERPINA1 and thus a motivation to combine the prior art references for treatment of fibrosis (see MPEP 2144). Conclusive proof of efficacy is not required to show a reasonable expectation of success and obviousness does not require absolute predictability, but at least some degree of predictability is required (MPEP 2143.02).
Thus in the absence of evidence to the contrary, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art at the time the invention was filed.
Response to Applicant’s Arguments
Applicant’s arguments are acknowledged but not persuasive to overcome the rejection of record.
Applicant argues that it would not have been obvious to make the claimed SEQ ID No. 323 because Exon V of the SERPINA1 gene spans approximately 200 nucleotides in length. Given that gRNAs are typically 17 to 26 nucleotides in length (as recited in dependent claims 434 and 439), and considering both DNA strands, there are hundreds of potential gRNA target sites within Exon V alone. When the claims further permit sequences that "differ by no more than 3 nucleotides" from SEQ ID NO: 323, the universe of potential sequences expands exponentially. The selection of the specific sequence corresponding to SEQ ID NO: 323 from among this enormous design space is not rendered obvious merely because the exon itself is known.
In response, it would have been obvious to make any of the claimed gRNA given the guidance of Zhu et al. Zhu et al. teach finding target sites is generally quite easy by just scanning for the PAM sequence e.g., NGG for the CRISPR-Cas9 system from S. pyogenes and to facilitate gRNA design, many computational tools have been developed (as exemplified in Table 1). Zhu et al. describes models that were capable of generating and predicting gRNA efficacy to facilitate design of highly active sgRNAs for any gene of interest.
Applicant points out that in the prior Office Action dated June 13, 2025, the Examiner expressly stated that "SEQ ID NO. 323 has been searched and is free of the prior art." June 13, 2025 Office Action at 2. While the Examiner has now withdrawn this statement, no prior art reference has been identified that actually teaches or discloses SEQ ID NO: 323. The withdrawal of the "free of the prior art" statement does not establish that the sequence was known; it merely reflects the Examiner's new legal theory that the sequence would have been obvious to design using computational tools. For the reasons set forth herein, that theory is unsound. The fact that the sequence was not found in the prior does not negate the reasoning for it being obvious to make. This is not a legal theory but simply evidence that it would have been obvious to make based on what is known in the prior art. Anticipation and obviousness do not overlap. Either an invention is known in the art and therefore anticipated or if it is not known but can be made from evidence in the prior art, then it is obvious to make.
Applicant argues the “obvious to try” rationale is not satisfied because the number of potential gRNA targeting sequences within Exon V is not a "small" or easily manageable finite set. Applicant argues Exon V of SERPINA 1 spans approximately 200 nucleotides. Depending on the length of the targeting domain (17-26 nucleotides as claimed) and considering both DNS strands and the availability of PAM sequences, there are potentially hundreds of candidate gRNA sequences that could be computationally identified as targeting Exon V. This is not the type of "finite number of identified, predictable solutions" contemplated by KSR.
In response, the Court in KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 421 (2007) did not define what is considered a finite number of identified predictable solutions and thus Applicant cannot put their own limitations of what is considered finite. Given the use of computational tools as taught by Zhu et al., it would be within the technical grasp of one skilled in the art to try the computational tools described to generate gRNA as instantly claimed. Zhu et al. teach generating thousands of gRNAs that target multiple different genes and found tools that performs both efficacy and specificity predictions (page 291 and Table 1). Based on the teachings of Zhu et al., one of skill in the art would have clearly been capable of identifying a finite number of identified and predictable gRNA.
Applicant then argues even if a set of candidate sequences could be computationally identified, the outcome, i.e., whether any particular gRNA will effectively and specifically edit the target site, is not predictable. The Office Action's own reference, Zhu, underscores this point. Zhu discusses the significant challenges in predicting gRNA efficacy, the complexity of off-target effects, and the fact that different computational tools yield different results. Zhu teaches that while computational tools can identify candidate sequences, they cannot reliably predict which candidates will function effectively. The existence of computational identification tools does not transform an unpredictable art into a predictable one.
In response, Zhu et al. does not teach that the computational tools do not reliably predict which candidates will function effectively. Zhu et al. teach an overview of representative gRNA design tools with one tool, CRISPRseek, being able to design gRNA with off-target analysis, gRNA efficiency, paired configuration, using flexible types of Cas proteins, any target specie, ability to compare sets of sequences and predict secondary structures (Table 1). One of skill in the art would have been capable of using this tool to predictably make and test the claimed gRNA.
Applicant next argues obviousness requires at least some degree of predictability and [s]imply knowing that computational tools exist to scan for PAM sequences does not create a reasonable expectation that any particular computationally identified gRNA sequence will effectively cleave the intended target. The Office Action has not provided any evidence that SEQ ID NO: 323 specifically (or sequences within 3 nucleotides thereof) would have been predicted to function effectively among the many possible candidate sequences.
In response, the claims do not recite the claimed SEQ ID No. 323 will effectively cleave the intended target as argued by Applicant. The methods of identifying gRNA to a target were known as taught by Zhu and the tool were able to: design gRNA with off-target analysis, determine gRNA efficiency, paired configuration, use of flexible types of Cas proteins, use any target specie, able to compare sets of sequences and predict secondary structures. One of skill would have had some degree of predictability that the gRNA would be capable of use in methods of altering a cell, as claimed. Conclusive proof of efficacy is not required to show a reasonable expectation of success and obviousness does not require absolute predictability, but at least some degree of predictability is required (MPEP 2143.02).
Applicant argues the motivation to combine the references is based on improper rationale. Applicant argues the goal of the claimed invention is to disrupt the Z allele of SERPINA1 using CRISPR. This limitation is not claimed. However because Zhang et al. teach methods of altering liver cells by contacting the cells with CRISPR-Cas system comprising a gRNA to a target gene SERPINA1 that encodes the protein called Alpha-1 Antitrypsin (A1AT) (see 1274, 1282 and claims) and Maslakova et al. teach Alpha1-antitrypsin (A1AT) is encoded by the SERPINA1 gene, AIA T is found elevated in some tumors and diseases and found to have high levels in Hep2 cells , one of skill in the art would have been obvious to make a gRNA targeted to the SERPINA1 gene, particularly in the region exon 5. Because CRISPR-Cas RNA guided endonuclease has emerged as the most effective and widely used genome editing technology and has become the most exciting and rapidly advancing research field, it would have been obvious to use known targets in other methods to adapt to gene editing. There exists an advantage for knowing the correlation between AIA T and Exon V as taught by Maslakova et al.
and thus a motivation to combine the prior art references for use with any type of oligonucleotide, see MPEP 2144).
MPEP 2144:
THE EXPECTATION OF SOME ADVANTAGE IS THE STRONGEST RATIONALE FOR COMBINING REFERENCES
The strongest rationale for combining references is a recognition, expressly or impliedly in the prior art or drawn from a convincing line of reasoning based on established scientific principles or legal precedent, that some advantage or expected beneficial result would have been produced by their combination. In re Sernaker, 702 F.2d 989, 994-95, 217 USPQ 1, 5-6 (Fed. Cir. 1983). See also Dystar Textilfarben GmbH & Co. Deutschland KG v. C.H. Patrick, 464 F.3d 1356, 1368, 80 USPQ2d 1641, 1651 (Fed. Cir. 2006) ("Indeed, we have repeatedly held that an implicit motivation to combine exists not only when a suggestion may be gleaned from the prior art as a whole, but when the ‘improvement’ is technology-independent and the combination of references results in a product or process that is more desirable, for example because it is stronger, cheaper, cleaner, faster, lighter, smaller, more durable, or more efficient. Because the desire to enhance commercial opportunities by improving a product or process is universal—and even common-sensical—we have held that there exists in these situations a motivation to combine prior art references even absent any hint of suggestion in the references themselves.").(emphasis added).
Lastly, Applicant argues the Office Action's rejection is the product of impermissible hindsight reasoning, using Applicant's own disclosure as a roadmap to select and combine the references.
In response to applicant's argument that the examiner's conclusion of obviousness is based upon improper hindsight reasoning, it must be recognized that any judgment on obviousness is in a sense necessarily a reconstruction based upon hindsight reasoning. But so long as it takes into account only knowledge which was within the level of ordinary skill at the time the claimed invention was made, and does not include knowledge gleaned only from the applicant's disclosure, such a reconstruction is proper. See In re McLaughlin, 443 F.2d 1392, 170 USPQ 209 (CCPA 1971).
Conclusion
No claims are allowed.
THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any extension fee pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to KIMBERLY CHONG at (571)272-3111. The examiner can normally be reached Monday thru Friday 9-5 pm.
If attempts to reach the examiner by telephone are unsuccessful please contact the SPE for 1636 Neil Hammell at 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Patent applicants with problems or questions regarding electronic images that can be viewed in the Patent Application Information Retrieval system (PAIR) can now contact the USPTO’s Patent Electronic Business Center (Patent EBC) for assistance. Representatives are available to answer your questions daily from 6 am to midnight (EST). The toll free number is (866) 217-9197. When calling please have your application serial or patent number, the type of document you are having an image problem with, the number of pages and the specific nature of the problem. The Patent Electronic Business Center will notify applicants of the resolution of the problem within 5-7 business days. Applicants can also check PAIR to confirm that the problem has been corrected. The USPTO’s Patent Electronic Business Center is a complete service center supporting all patent business on the Internet. The USPTO’s PAIR system provides Internet-based access to patent application status and history information. It also enables applicants to view the scanned images of their own application file folder(s) as well as general patent information available to the public. For more information about the PAIR system, see http://pair-direct.uspto.gov.
For all other customer support, please call the USPTO Call Center (UCC) at 800-786-9199.
/KIMBERLY CHONG/Primary Examiner, Art Unit 1636
Prosecution Insights