Prosecution Insights
Last updated: April 19, 2026
Application No. 18/059,213

SYSTEMS AND METHODS FOR TREATING ALPHA 1-ANTITRYPSIN (A1AT) DEFICIENCY

Non-Final OA §103
Filed
Nov 28, 2022
Examiner
CHONG, KIMBERLY
Art Unit
1636
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Editas Medicine Inc.
OA Round
2 (Non-Final)
72%
Grant Probability
Favorable
2-3
OA Rounds
2y 7m
To Grant
85%
With Interview

Examiner Intelligence

Grants 72% — above average
72%
Career Allow Rate
1066 granted / 1473 resolved
+12.4% vs TC avg
Moderate +12% lift
Without
With
+12.5%
Interview Lift
resolved cases with interview
Typical timeline
2y 7m
Avg Prosecution
67 currently pending
Career history
1540
Total Applications
across all art units

Statute-Specific Performance

§101
3.9%
-36.1% vs TC avg
§103
26.8%
-13.2% vs TC avg
§102
20.6%
-19.4% vs TC avg
§112
29.5%
-10.5% vs TC avg
Black line = Tech Center average estimate • Based on career data from 1473 resolved cases

Office Action

§103
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . DETAILED ACTION Status of Application/Amendment/Claims Applicant's response filed 09/15/2025 has been considered. Rejections and/or objections not reiterated from the previous office action mailed 06/13/2025 are hereby withdrawn. The following rejections and/or objections are either newly applied or are reiterated and are the only rejections and/or objections presently applied to the instant application. The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action. With entry of the amendment filed on 09/15/2025, claims 414, 416, 426 and 434-444 are pending in the application. With the claim amendments, claims 414 and 416 are rejoined and claims 414, 416, 426 and 434-444 are examined. The 103 rejection has been withdrawn in view of a new rejection herein. The 112(a) rejection has been withdrawn in response to claim amendments. The statement that SEQ ID No. 323 is free of the art has been withdrawn and a new rejection is below. New Claim Rejections Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. Claims 414, 416, 426 and 435-444 is/are rejected under 35 U.S.C. 103 as being unpatentable over Zhang et al. (US 20160153005 of record cited on IDS filed 12/07/2022), Maslakova et al. (Moscow University Biological Sciences Bulletin, 2015, Vol. 70, No. 3, pp. 127–131 of record cited on IDS filed 12/07/2022), Human Z type alpha-1-antitrypsin gene, complete cds (exons 2-5) Nucleotide NCBI 12/16/2025 and Zhu, Lihua Julie. ("Overview of guide RNA design tools for CRISPR-Cas9 genome editing technology." Frontiers in Biology 10.4 (2015): 289-296). Regarding claims 414, 416 and 426-444, Zhang et al. teach methods of altering liver cells by contacting the cells with CRISPR-Cas system comprising a gRNA to a target gene SERPINA1 that encodes the protein called Alpha-1 Antitrypsin (A1AT) (see 1274, 1282 and claims). Zhang et al. teach using Cas9 enzymes with improved liver-targeting specificity and teach a nucleic acid encoding the gRNA (see 0010). Zhang et al. teach the use of nanoparticles to deliver the CRISPR enzyme or mRNA or guide RNA (see 0397). Zhang et al. teach delivery can be in cells or in vivo (0609). Zhang et al. does not teach Zhang et al. does not teach the gRNA sequence having SEQ ID No. 323 or teach the gRNA is configured to target Exon V of the SERPINA1 gene. Regarding claim 414, 416 and SEQ ID No. 323, Maslakova et al. teach it was known in the art that SERPINA1 gene contains four coding exons, exons 2-5, in several cell types such as liver cells Hep2 (see page 127, Fig 2). Maslakova et al. teach Alpha1-antitrypsin (A1AT) is encoded by the SERPINA1 gene, AIA T is found elevated in some tumors and diseases and found to have high levels in Hep2 cells and high relative expression levels with respect to exons 5 (see Figs. 1 and 2). It would have been obvious to make a gRNA targeted to the SERPINA1 gene, particularly in the region comprising exons 2-5 and especially exon 5 given Maslakova et al. teach exon 5 had the highest expression of SERPINA1 which encodes A1AT. One of skill in the art would have wanted to try targeting this region in efforts to find a gRNA to use in the CRISPR-Cas system. SEQ ID No. 323 is defined in the instant specification at targeting Exon V of the SERPINA1 gene (see Tables 7 and 8). The sequence of the SERPINA1 gene encoding A1AT is known as shown below: Human Z type alpha-1-antitrypsin gene, complete cds (exons 2-5) GenBank: J02619.1 >J02619.1 Human Z type alpha-1-antitrypsin gene, complete cds (exons 2-5) GACAATGCCGTCTTCTGTCTCGTGGGGCATCCTCCTGCTGGCAGGCCTGTGCTGCCTGGTCCCTGTCTCCCTGGCTGAGGATCCCCAGGGAGATGCTGCCCAGAAGACAGATACATCCCACCATGATCAGGATCACCCAACCTTCAACAAGATCACCCCCAACCTGGCTGAGTTCGCCTTCAGCCTATACCGCCAGCTGGCACACCAGTCCAACAGCACCAATATCTTCTTCTCCCCAGTGAGCATCGCTACAGCCTTTGCAATGCTCTCCCTGGGGACCAAGGCTGACACTCACGATGAAATCCTGGAGGGCCTGAATTTCAACCTCACGGAGATTCCGGAGGCTCAGATCCATGAAGGCTTCCAGGAACTCCTCCGTACCCTCAACCAGCCAGACAGCCAGCTCCAGCTGACCACCGGCAATGGCCTGTTCCTCAGCGAGGGCCTGAAGCTAGTGGATAAATTTTTGGAGGATGTTAAAAAGTTGTACCACTCAGAAGCCTTCACTGTCAACTTCGGGGACACCGAAGAGGCCAAGAAACAGATCAACGATTACGTGGAGAAGGGTACTCAAGGGAAAATTGTGGATTTGGTCAAGGAGCTTGACAGAGACACAGTTTTTGCTCTGGTGAATTACATCTTCTTTAAAGGCAAATGGGAGAGACCCTTTGAAGTCAAGGACACCGAGGAAGAGGACTTCCACGTGGACCAGGCGACCACCGTGAAGGTGCCTATGATGAAGCGTTTAGGCATGTTTAACATCCAGCACTGTAAGAAGCTGTCCAGCTGGGTGCTGCTGATGAAATACCTGGGCAATGCCACCGCCATCTTCTTCCTGCCTGATGAGGGGAAACTACAGCACCTGGAAAATGAACTCACCCACGATATCATCACCAAGTTCCTGGAAAATGAAGACAGAAGGTCTGCCAGCTTACATTTACCCAAACTGTCCATTACTGGAACCTATGATCTGAAGAGCGTCCTGGGTCAACTGGGCATCACTAAGGTCTTCAGCAATGGGGCTGACCTCTCCGGGGTCACAGAGGAGGCACCCCTGAAGCTCTCCAAGGCCGTGCATAAGGCTGTGCTGACCATCGACAAGAAAGGGACTGAAGCTGCTGGGGCCATGTTTTTAGAGGCCATACCCATGTCTATCCCCCCCGAGGTCAAGTTCAACAAACCCTTTGTCTTCTTAATGATTGAACAAAATACCAAGTCTCCCCTCTTCATGGGAAAAGTGGTGAATCCCACCCAAAAATAACTGCCTCTCGCTCCTCAACCCCTCCCCTCCATCCCTGGCCCCCTCCCTGGATGACATTAAAGAAGGGTTGAGCTGGACTGCCTCTCGCTCCTCAACCCCTCCCCTCCATCCCTGGCCCCCTCCCTGGATGACATTAAAGAAGGGTTGAGCTGG Zhu teach an overview of guide RNA design tools for use in the CRISPR-Cas9 genome editing technology and teach finding target sites in generally quite easy and teach many computational tools have been developed to aid in finding an optimal gRNA (see abstract and page 90). It would have been obvious for one of ordinary skill in the art to try the known computational tools to make gRNA targeted to the SERPINA1 gene to use in the CRISPR-Cas9 genome editing technology targeting Exon V of the gene. Given the prior art of Zhang et al. teach gRNA can be used to target the SERPINA1 gene and Maslakova et al. teach Alpha1-antitrypsin (A1AT) is encoded by the SERPINA1 gene and found high levels in Hep2 cells and high relative expression levels with respect to exons 5, one of skill in the art would have wanted make a gRNA targeted to Exon V. SEQ ID No. 323 is complementary to a region in the gene as highlighted above and given Zhu et al. teach how to use tools to design and test for gRNA and given the region of Exon V is known, it would have been obvious to make SEQ ID No. 323 differing by no more that 3 nucleotides as claimed. There is a finite number of sequences within the range of Exon V that can be identified given the size of the gene above and therefore a person of ordinary skill has good reason to make the gRNA within their technical grasp. Moreover, because there was a known association between Exon V and high expression levels of the SERPINA1 gene and known association with high expression levels and conditions or diseases, there is a predictable outcome of success at reducing expression levels and treatment. There is an expectation of an advantage for making a gRNA targeted to Exon V of the SERPINA1 and thus a motivation to combine the prior art references for treatment of fibrosis (see MPEP 2144). Conclusive proof of efficacy is not required to show a reasonable expectation of success and obviousness does not require absolute predictability, but at least some degree of predictability is required (MPEP 2143.02). Thus in the absence of evidence to the contrary, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art at the time the invention was filed. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Kimberly Chong at (571)272-3111. The examiner can normally be reached Monday thru Friday between M-F 8:00am-4:30pm. If attempts to reach the examiner by telephone are unsuccessful please contact the SPE for 1636 Neil Hammell at 571-272-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Patent applicants with problems or questions regarding electronic images that can be viewed in the Patent Application Information Retrieval system (PAIR) can now contact the USPTO’s Patent Electronic Business Center (Patent EBC) for assistance. Representatives are available to answer your questions daily from 6 am to midnight (EST). The toll free number is (866) 217-9197. When calling please have your application serial or patent number, the type of document you are having an image problem with, the number of pages and the specific nature of the problem. The Patent Electronic Business Center will notify applicants of the resolution of the problem within 5-7 business days. Applicants can also check PAIR to confirm that the problem has been corrected. The USPTO’s Patent Electronic Business Center is a complete service center supporting all patent business on the Internet. The USPTO’s PAIR system provides Internet-based access to patent application status and history information. It also enables applicants to view the scanned images of their own application file folder(s) as well as general patent information available to the public. For more information about the PAIR system, see http://pair-direct.uspto.gov. For all other customer support, please call the USPTO Call Center (UCC) at 800-786-9199. /KIMBERLY CHONG/ Primary Examiner Art Unit 1636
Read full office action

Prosecution Timeline

Nov 28, 2022
Application Filed
Jun 11, 2025
Non-Final Rejection — §103
Sep 15, 2025
Response Filed
Dec 16, 2025
Non-Final Rejection — §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12595481
METHODS AND COMPOSITIONS FOR NEUROPROTECTION
2y 5m to grant Granted Apr 07, 2026
Patent 12590307
TRANSLATION ENHANCING NUCLEIC ACID COMPOUNDS: ASO COUPLED TRANSLATION – UPREGULATION 1 (ACT-UP1) AND USES THEREOF
2y 5m to grant Granted Mar 31, 2026
Patent 12571052
Immunomodulatory RNA
2y 5m to grant Granted Mar 10, 2026
Patent 12559750
Methods and Compositions for Treatment of Polycystic Kidney Disease
2y 5m to grant Granted Feb 24, 2026
Patent 12539309
COMPOSITIONS COMPRISING CIRCULAR POLYRIBONUCLEOTIDES AND USES THEREOF
2y 5m to grant Granted Feb 03, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

2-3
Expected OA Rounds
72%
Grant Probability
85%
With Interview (+12.5%)
2y 7m
Median Time to Grant
Moderate
PTA Risk
Based on 1473 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month