DETAILED ACTION
This Action is in response to the amendment filed on 10/29/2025.
Claims 68-69, 87-105 are pending.
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Terminal Disclaimer
The terminal disclaimers filed on 10/29/2025 disclaiming the terminal portion of any patent granted on this application which would extend beyond the expiration date of U.S. Patent Nos. 10,780,108, 11,590,156, and 11,517,584 has been reviewed and are accepted. The terminal disclaimer has been recorded. Accordingly the non-statutory double patenting rejections based on the indicate patents has been withdrawn.
Claim Objections
Claim 93 is objected to because of the following informalities: It appears that claim 93 has typographical errors that include strikethrough markings in the word “the” inline one and in the word “nucleoside”, the last word of the claim. This appears to be a simple typographical error and the claim is interpreted as if the strikethrough was not present in the claim.
Appropriate correction or explanation is required.
Nucleotide and/or Amino Acid Sequence Disclosures
REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
the name of the ASCII text file;
the date of creation; and
the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or
In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
Specific deficiencies and the required response to this Office Action are as follows:
Specific deficiency – Nucleotide and/or amino acid sequences appearing in claims 97 and 99 are not identified by sequence identifiers in accordance with 37 CFR 1.821(d).
Required response – Applicant must provide:
An amendment to the indicated claims adding the required sequence identifiers (i.e., SEQ ID NOs). It is noted that if the sequences of claims 97 and 99 are not part of the Sequence Listing, a new Sequence Listing with the sequences of claims 97 and 99 are required.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claim 68 is rejected under 35 U.S.C. 102(a)(1) as being anticipated by U.S. 20030206887 (hereafter “Morrissey”; of record – 07/31/2023 IDS).
Upon further search and consideration of the claims, it was discovered that the following rejections are required.
Regarding claim 68, Morrissey teaches a chemically modified RNAi agent that comprises a sense strand having a sequence according to SEQ ID NO: 302 and an antisense strand at least partially complementary to the sense strand. Specifically, Morrissey teaches an siRNA construct comprising a sense strand having SEQ ID NO: 302 and a complementary antisense strand that is at least partially complementary to SEQ ID NO: 302 (see Morrissey’s SEQ ID NO: 1297 which is 100% identical to instant SEQ ID NO: 307 and complement SEQ ID NO: 1374 which is 95.2% complementary to SEQ ID NO: 302 as indicated in Morrissey’s Table III on page 52 – see sequence alignment information below).
Therefore, Morrissey anticipates claim 68
SEQUENCE ALIGNMENT INFORMATION
Sequence 1297, US/10244647
Publication No. US20030206887A1
GENERAL INFORMATION
APPLICANT: Ribozyme Pharmaceutical, Inc.
APPLICANT: Morrissey, David
APPLICANT: McSwiggen, James
APPLICANT: Beigelman, Leonid
TITLE OF INVENTION: RNA Interference Mediated Inhibition of Hepatitis B Virus (HBV) Using
TITLE OF INVENTION: Short Interfering Nucleic Acid (siNA)
CURRENT APPLICATION NUMBER: US/10/244,647
CURRENT FILING DATE: 2003-04-14
SEQ ID NO 1297
LENGTH: 23
ORGANISM: Hepatitis B virus
Query Match 100.0%; Score 21; Length 23;
Qy 1 GTGGACTTCTCTCAATTTTCT 21 (instant SEQ ID NO: 302)
|:||||::|:|:|||::::|:
Db 2 GUGGACUUCUCUCAAUUUUCU 22 (Morrissey’s SEQ ID NO 1297)
Sequence 1374, US/10244647
Publication No. US20030206887A1
GENERAL INFORMATION
APPLICANT: Ribozyme Pharmaceutical, Inc.
APPLICANT: Morrissey, David
APPLICANT: McSwiggen, James
APPLICANT: Beigelman, Leonid
TITLE OF INVENTION: RNA Interference Mediated Inhibition of Hepatitis B Virus (HBV) Using
TITLE OF INVENTION: Short Interfering Nucleic Acid (siNA)
CURRENT APPLICATION NUMBER: US/10/244,647
CURRENT FILING DATE: 2003-04-14
SEQ ID NO 1374
LENGTH: 21
ORGANISM: Artificial Sequence
FEATURE:
OTHER INFORMATION: Description of Artificial Sequence: siNA antisense region
Query Match 95.2%; Score 20; Length 21;
Qy 1 GTGGACTTCTCTCAATTTTC 20 (SEQ ID NO: 302)
||||||||||||||||||||
Db 20 GTGGACTTCTCTCAATTTTC 1 (Morrissey’s SEQ ID NO: 1374*)
*NOTE: SEQ ID NO: 1374 is shown as reverse complement(DNA) to SEQ ID NO: 302, where the actual sequence of SEQ ID NO: 1374 (RNA) is GAAAAUUGAGAGAAGUCCACC as shown in Table III.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 69, 87-90, 92-93, 96, 100 are rejected under 35 U.S.C. 103 as being unpatentable over U.S. 20030206887 (hereafter “Morrissey”; of record – 07/31/2023 IDS).
Morrissey teaches an siRNA construct comprising a sense strand having SEQ ID NO: 302 and a complementary antisense strand that is at least partially complementary to SEQ ID NO: 302 as indicated in the rejection above, where Morrissey’s SEQ ID NO: 1297 is 100% identical to instant SEQ ID NO: 307 and complementary sequence SEQ ID NO: 1374 is 95.2% complementary to SEQ ID NO: 302.
Morrissey also teaches that 0-4 nucleotides in both strands are unmodified ribonucleotides. For instance, see [0094] which teaches that all pyrimidines and all purines in the sense and antisense strands can be chemically modified pyrimidines/purines, thus indicating all nucleotides in both strands are chemically modified and no nucleotides (i.e., 0 nucleotides) are unmodified.
Morrissey also teaches that both strands can comprise 1-6 phosphorothioate linkages (e.g., see [0072]).
Morrissey also teaches that a targeting ligand can be conjugates to 3’ or 5’ end of the sense strand or the antisense strand and that the ligand can be N-acetyl-galactosamine (e.g., see [0096], [0142], [0272]).
Morrissey also teaches that the sense strand can comprise at least on inverted abasic nucleoside (e.g., see [0094]).
Morrissey also teaches that the siRNA can be a salt, as well as formulated into a pharmaceutical composition with a pharmaceutically acceptable carrier (e.g., see [0118], [0249], [0250], etc.).
Morrissey does not teach that the antisense strand comprises SEQ ID NO: 171, as required by claims 69, 87-90, 92-93, 96, and 100.
However, one of ordinary skill in the art would be well aware that siRNA constructs can comprise a sense strand and an antisense strand that is perfectly (100%) complementary to the sense strand (official notice taken). Therefore, although Morrissey does not explicitly teach an siRNA agent comprising a sense strand having SEQ ID NO: 302 and an antisense strand comprising SEQ ID NO: 171, since Morrissey teaches an siRNA agent having a sense strand comprising SEQ ID NO: 302 (as indicated above), it would have been prima facie obvious to one of ordinary skill in the art, prior to the day the claimed invention was filed, to make a siRNA comprising a sense strand that has SEQ ID NO: 302 (as taught by Morrissey) and an antisense strand comprising a sequence 100% complementary to the sense strand, which would necessarily include the sequence of SEQ ID NO: 171, with a reasonable expectation of success. It would have been a matter of applying a known technique to a similar known product to yield predictable results, and/or a matter of “obvious to try” – choosing from a finite number of identified, predictable solutions, with a reasonable expectation of success, to substitute an antisense strand that is 100% complementary to in the siRNA having a sense strand comprising SEQ ID NO: 302 as taught by Morrissey.
The reference(s) cited above in the rejection(s) under 35 U.S.C. 103 satisfies the factual inquiries as set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966). Once this has been accomplished the holdings in KSR can be applied (KSR International Co. v. Teleflex Inc. (KSR), 550 USPQ2d 1385 (2007):
“Exemplary rationales that may support a conclusion of obviousness include: (A) Combining prior art elements according to known methods to yield predictable results; (B) Simple substitution of one known element for another to obtain predictable results; (C) Use of known technique to improve similar devices (methods, or products) in the same way; (D) Applying a known technique to a known device (method, or product) ready for improvement to yield predictable results; (E) “Obvious to try” – choosing from a finite number of identified, predictable solutions, with a reasonable expectation of success; (F) Known work in one field of endeavor may prompt variations of it for use in either the same field or a different one based on design incentives or other market forces if the variations are predictable to one of ordinary skill in the art; (G) Some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention.”
Response to Arguments
With respect to the non-statutory double patenting rejections of claims, Applicant’s arguments have been fully considered and in view of the proper Terminal Disclaimers filed (as indicated above) are persuasive. Therefore, the rejection(s) has(have) been withdrawn. However, upon further consideration, a new ground(s) of rejection is made herein for the reasons indicated above.
Claim Objections
Claims 91, 94-95, 97-99, 101-105 are objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims.
Conclusion
This action is made Non-Final because the new rejections are not necessitated by an amendment to the claims.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to J. E. Angell whose telephone number is (571)272-0756. The examiner can normally be reached Monday-Friday (8:30-5:00).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
J. E. Angell
Primary Examiner
Art Unit 1637
/J. E. ANGELL/Primary Examiner, Art Unit 1637