DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claims 1-3, 45, 68, 78, 83, and 192-205 are pending.
Status of the Application
Applicant’s response and amendment filed 03 November 2025 are acknowledged and entered.
Applicant has amended Claims 1-3, 45, and 68. Applicant has added Claims 192-205. Applicant has cancelled Claims 71, 72, 85, 87-89, 134, 157-158, 176, 179-181, 186, and 190.
Election/Restrictions
Applicant’s election without traverse of the invention of Group I, drawn to dsRNAs for targeting an MLH3 nucleic acid and comprising SEQ ID NOs 1-16, in the reply filed on 03 November 2025 is acknowledged.
Applicant’s election of the species SEQ ID NO 2 in the reply filed on 03 November 2025 is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)). Examiner has determined that SEQ ID NOs 9-10 and 12 each have a region substantially complementary to elected SEQ ID NO 2 so the claims will be examined to the extent they read on SEQ ID NOs 2, 9-10, and 12.
Applicant has cancelled claims to the nonelected inventions and species. Election was made without traverse in the reply filed on 03 November 2025.
Claims 1-3, 45, 68, 78, 83, and 192-205 are examined.
Information Disclosure Statement
The IDS has been considered.
The Spec. cites references.
The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered.
Drawings
The drawings are objected to because Figs. 1-6 are in color.
Color photographs and color drawings are not accepted in utility applications unless a petition filed under 37 CFR 1.84(a)(2) is granted. Any such petition must be accompanied by the appropriate fee set forth in 37 CFR 1.17(h), one set of color drawings or color photographs, as appropriate, if submitted via the USPTO patent electronic filing system or three sets of color drawings or color photographs, as appropriate, if not submitted via the via USPTO patent electronic filing system, and, unless already present, an amendment to include the following language as the first paragraph of the brief description of the drawings section of the specification:
The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
Color photographs will be accepted if the conditions for accepting color drawings and black and white photographs have been satisfied. See 37 CFR 1.84(b)(2).
If a petition for color drawings is not approved, the color drawings should be replaced with black and white drawings and the following applies:
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Claim Interpretation
Claims 1-2, 45, and 192 recite:
…wherein the AS strand …comprises a sequence substantially complementary to a MLH3 nucleic acid sequence of SEQ ID NO [#s] (Claims 1-2) or
… wherein the AS strand …comprises a sequence substantially complementary to the MLH3 nucleic acid sequence of SEQ ID NO [#s] (Claims 45) or
The dsRNA molecule … a MLH3 nucleic acid sequence of any one of SEQ ID NO [#s] (Claim 192).
In each of those cases, the claim recites the AS strand …comprises a sequence… (Claims 1-2 and 45) or …a MLH3 nucleic acid sequence… (Claim 192). Those recitations are interpreted as requiring only that the AS strand (Claims 1-2 and 45) or the dsRNA molecule (Claim 192) comprises a sequence complementary to a MLH3 nucleic acid sequence (which in the case of all the claims is the MLH3 nucleic acid sequence called SEQ ID NO 2 and, for Claim 2, SEQ ID NOs 9-10 or 12). But those claims don’t require any minimum length for the sequence that is comprised by the AS or dsRNA and which is substantially complementary to the SEQ ID NO. Therefore as long as a sequence comprises any 2-mer that has substantial complementarity (interpreted to be at least 50% complementarity; see §112[b]), it will read on the claims.
Claim 45 recites a portion. A portion is interpreted to encompass as few as 1 nt of complementarity between the sense and antisense (AS) strands.
Claim 45 recites 2’-methoxy-ribonucleotides and 2’-O-methyl modifications. Those are interpreted as being the same modification. That interpretation is based on Chernolovskaya (and Zenkova. 2010. Chemical modification of siRNA. Curr. Opin. Molec. Therap. 12[2]:158-167, “Chernolovskaya”) and Wikipedia (version 03 October 2021. “2’-O-methylation”. Available online at Wikipedia.org. Accessed on 19 November 2025, “Wikipedia”). Those references teach that, as shown in the following modified excerpt of Chernolovskaya (Fig. 1B, left side of left fig) and excerpt of Wikipedia (right fig.):
PNG
media_image1.png
287
376
media_image1.png
Greyscale
PNG
media_image2.png
259
232
media_image2.png
Greyscale
Those figures show the same modification. Note that that modification can also be abbreviated 2’-OMe.
Claim 68 recites a pharmaceutical composition for inhibiting expression of a MLH3 gene in an organism. Because the claims are directed to a composition, the recitation in an organism is interpreted as an intended use that does not affect the structure of the claimed composition. This interpretation also applies to Claim 205 since it depends from Claim 68. Therefore Claim 205 requires only that the pharmaceutical composition inhibits expression of an MLH3 gene by at least 50% in vitro.
Claim Objections
Claim 45 is objected to because of the following informalities:
Claim 45 recites 2’-methoxy-ribonucleotides and 2’-O-methyl modifications. The claim will be better if it uses one consistent terminology to refer to the same modification (see §Claim interpretation). Applicant should amend the claim to consistently use either 2’-methoxy-ribonucleotide or 2’-O-methyl modification. Alternatively, Applicant should specify what modification they mean.
Claim 45 limitation G3 is missing a space between “2” and “and”. The claim should add a space so it properly reads: …the nt at positions 2 and ….
Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-3, 45, 68, 78, 83, and 192-205 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a written description rejection.
Note: because the claims recite a dsRNA comprising an antisense strand substantially complementary to a certain target (i.e., MLH3), the claims are interpreted as the dsRNA inhibits some amount of MLH3 gene expression.
Claim 1 recites: a double stranded RNA (dsRNA) molecule comprising a sense strand and an antisense strand, each independently comprising a 5' end and a 3' end, wherein the antisense strand comprises a sequence substantially complementary to a MutL Homolog 3 (MLH3) nucleic acid sequence of SEQ ID NO: 2. Claim 45 recites that …the antisense strand comprises a sequence substantially complementary to the MLH3 nucleic acid sequence of SEQ ID NO 2…. The broad claims encompass the large genus of antisense strands that comprise any sequence substantially complementary to any MLH3 nucleic acid sequence of SEQ ID NO: 2. Any kind of sequence, even as short as 2-mer, that is complementary to SEQ ID NO 2 would be encompassed by Claims 1 and 45 (and claims depending therefrom) as instantly presented. There is a written description problem because Applicant has not demonstrated possession of a representative number of dsRNAs comprising the full breadth of sequences recited in the claims (i.e., substantially complementary to SEQ ID NO 2) and because Applicant has not adequately described what portion of an MLH3 sequence must be present for inhibition of MLH3 gene expression to occur.
In addition to the problem discussed above, Claim 45 has a written description problem because it recites a portion of the antisense strand is complementary to a portion of the sense strand. That broad claim encompasses the large subgenera of sense and AS strands that comprise portions that are complementary to one another by at least a single nt. There is a written description problem because Applicant has not demonstrated possession of a representative number of dsRNAs comprising the full breadth of sequences recited in the claims and wherein as few as a single nt within each strand are complementary to each other.
Claim 2 recites …the antisense strand comprises a sequence substantially complementary to a MLH3 nucleic acid sequence of SEQ ID NO 10, SEQ ID NO 9, or SEQ ID NO 12 and Claim 3 recites the dsRNA comprises complementarity to at least 10-13 contiguous nt of the MLH3 nucleic acid of SEQ ID NO 2. Those broad claims encompass the large genus of antisense strands that comprise any sequence substantially complementary to any MLH3 nucleic acid sequence of SEQ ID NOs 9-10, or 12 or any sequence comprising complementarity to at least 10 contiguous nt of SEQ ID NO 2. Any kind of sequence, even as short as 2-mer, that is complementary to SEQ ID NO 2 would be encompassed by the Claim 2 as instantly presented. There is a written description problem because Applicant has not demonstrated possession of a representative number of dsRNAs comprising the full breadth of sequences recited in the claims (i.e., substantially complementary to SEQ ID NOs 9-10 or 12) and because Applicant has not adequately described what portion must be present for inhibition of MLH3 gene expression to occur. There is a written description problem with Claim 3 because Applicant has not adequately described what portion must be present for inhibition of MLH3 gene expression to occur.
Similarly, Claim 192 recites the dsRNA molecule comprises no more than 3 mismatches with a MLH3 nucleic acid sequence of SEQ ID NO 2. That broad claim encompasses the large subgenera of sense and AS strands that comprise no more than 3 mismatches with any MLH3 nucleic acid sequence of SEQ ID NO 2. There is a written description problem because Applicant has not demonstrated possession of a representative number of dsRNAs comprising the full breadth of sequences recited in the claims and which comprise no more than 3 mismatches with any nucleic acid sequence (i.e., a 2-mer or longer) of SEQ ID NO 2. In addition, Applicant has not adequately described any sequence structure that must be present for inhibition of MLH3 gene expression to occur but which can contain up to 3 mismatches.
Claims 193-194 recite strands that each comprise about 15-25 or about 16-21 nt long. As discussed in the112(b) rejection below, about is interpreted to encompass ±20% so the claims encompass strands that are each 12-30 or 13-25 nt long. The broad claims encompass the large subgenera of sense and AS strands that 12-30 or 13-25 nt long wherein the strand comprises a sequence (including any 2-mer) at least 50% complementary to any MLH3 nucleic acid sequence of SEQ ID NO 2. There is a written description problem because Applicant has not demonstrated possession of a representative number of dsRNAs comprising strands that are 12-30 or 13-25 nt long. In addition, Applicant has not adequately described any sequence structure that must be present for inhibition of MLH3 gene expression to occur.
Claims 68 and 205 recite a pharmaceutical composition for inhibiting expression of a MLH3 gene in an organism, comprising the dsRNA molecule of Claim 1 and a pharmaceutically acceptable carrier (Claim 68) and the pharmaceutical composition… wherein the dsRNA inhibits the expression of the MLH3 gene by at least 50% or at least 80%. (Claim 205). Those broad claims encompass the large genus of dsRNAs that target MLH3 and inhibit MLH3 expression, including by at least 50%. There is a written description problem because Applicant’s claims encompass numerous sequences that comprise a region at least 50% complementary to SEQ ID NO 2 but Applicant has not adequately described what sequence is required to inhibit MLH3 expression by any amount, let alone by at least 50%.
Note that there is a 112(b) rejection of Claims 1-2 and 45 over the term substantially complementary and over Claims 193-194 over the term about.
Claim 78 recites a vector comprising a regulatory sequence… That broad claim encompasses the large genus of any kind of regulatory sequence in existence. There is a written description problem because Applicant has not demonstrated possession of a representative number of vectors comprising any regulatory sequence operably linked to any of the dsRNAs encompassed by Claim 1.
An original claim may lack written description support when a broad genus claim is presented but the disclosure only describes a narrow species with no evidence that the genus is contemplated. See Ariad Pharms., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1349-50 (Fed. Cir. 2010) (en banc). The written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406. See MPEP 2163.
The Spec. defines a sequence sufficiently complementary to a target mRNA sequence to direct target-specific RNA interference (RNAi) at (¶197) as meaning that the strand has a sequence sufficient to trigger the destruction of the target mRNA by the RNAi machinery or process. However, that definition does not render the claims sufficient to meet the written description requirement because (1) that is not the language used in the claims and (2) even if that language were used verbatim in the claim, the Spec. describes no structure that is required to perform that destruction function when it comes to targeting MLH3 mRNA. The Spec. describes (p. 123-139) many sequences that target MLH3 but none of them is as short as 12-mer. Furthermore, the figures show only a selection of all the sequences encompassed by the claims that actually inhibit MLH3 expression, let alone inhibit MLH3 expression by at least 50% or at least 80%. The Spec. does not disclose any sequence strands shorter than 16-mer or longer than 21-mer were tested for their ability to inhibit MLH3 expression. An artisan would not be able to study the Spec. to determine what structure or sequence is necessary to make it substantially complementary to a target MLH3 nucleic acid sequence, and the Spec. does not provide guidance.
Regarding what sequence structure is responsible for inhibiting MLH3 or what minimal sequence structure can act as an AS that affects the expression of MLH3, inhibits the expression of MLH3, or inhibits the expression of MLH3 by at least 50%, the Spec. does not provide information describing the features of such a sequence structure. The Spec. does not disclose what physical structure is responsible for the claimed antisense/inhibition function.
Applicant’s examples show some sequences that inhibit MLH3 expression by at least 50%. However, those examples are not sufficient to provide written description support for any dsRNA comprising sense and AS strands, wherein the AS strand comprises a sequence substantially complementary to any nucleic acid sequence of SEQ ID NOs 2, 9-10, or 12 (including a sequence with as few as 2-mer complementarity to the SEQ ID NOs); wherein the AS strand can have as many as 3 mismatches to a sequence of SEQ ID NO 2; wherein each strand can be any length besides 16- or 21-mer; wherein any portion of the strands—even a very short 1-mer portion—are complementary to one another; or any of those dsRNA wherein the dsRNA inhibits MLH3 expression by at least 50%. Although the claims claim the functional characteristics (i.e., inhibiting MLH3 or inhibiting MLH3 expression by at least 50%), the functional characteristic is not coupled with any known structure.
Although the Specification teaches the examples discussed above, it does not identify a core structure necessary for performing the claimed function(s) of inhibiting MLH3 expression. The Spec. does not disclose any core structure, partial structure, physical or chemical property, or functional characteristic coupled with a known or disclosed structure/function relationship responsible for inhibiting MLH3 expression in such a way to demonstrate possession of the full invention as claimed at time of filing. The vast number of sequences encompassed by the broad claims do not share any core structure. As stated above, a person of ordinary skill would not be able to study the Spec. to determine what structure or sequence is necessary to be substantially complementary to a target MLH3 nucleic acid sequence, and the Spec. does not provide guidance.
The specification teaches only some species within the claimed genus/genera (e.g. those shown in Table 5 or Fig. 1) but those are only a paltry number compared with the breadth of what is claimed and not all of them inhibit MLH3 expression by at least 50%. Altogether, the number of species disclosed by complete structure is not sufficient to provide the written description support for the huge genera and subgenera that are encompassed by the claims: any dsRNA comprising sense and AS strands, wherein the AS strand comprises a sequence substantially complementary to any nucleic acid sequence of SEQ ID NOs 2, 9-12, or 12; wherein the AS strand can have as many as 3 mismatches to a sequence of SEQ ID NO 2; wherein each strand can be any length besides 16- or 21-mer; wherein any portion of the strands—even a very short 1-mer portion—are complementary to one another; or any of those dsRNA wherein the dsRNA inhibits MLH3 expression by at least 50%. All of that indicates that Applicant was not in possession of the full invention as claimed at time of filing.
Regarding the regulatory sequence recited in Claim 78, the Spec. describes (¶200) examples of regulatory sequences: promoter or enhancer elements. The Spec. mentions (¶248-251) specific promoters: a polymerase III promoters, general inducible promoters, T7, and other promoters known in the art. Applicant’s Spec. doesn’t show any examples of regulatory elements or promoters. Artisans know that each and every gene has at least a promoter, as well as other regulatory sequences, and the structures of regulatory sequences for different genes can be different. Claim 78 broadly encompasses a vector comprising any of those promoters or other regulatory elements. However, nothing in the Spec. is sufficient to provide written description support for vectors comprising any regulatory sequences. Although the claims claim the functional characteristics (i.e., a regulatory sequence), the functional characteristic is not coupled with any known structure.
The Spec. does not identify a core structure necessary for performing the claimed function(s) of being a regulatory sequence. The Spec. does not disclose any core structure, partial structure, physical or chemical property, or functional characteristic coupled with a known or disclosed structure/function relationship responsible for being a regulatory sequence in such a way to demonstrate possession of the full invention as claimed at time of filing. Applicant has not described any the core physical structure of any regulatory sequence that could be used in their vector.
The specification mentions only a few species of promoter within the claimed genus of regulatory sequence/subgenus of promoter but those are only a paltry number compared with the breadth of what is claimed, and the structure of regulatory sequences is never disclosed. Altogether, the number of species disclosed by complete structure is not sufficient to provide the written description support for the huge genera and subgenera that are encompassed by the claims.
While none of these elements is specifically required to demonstrate possession, in combination their absence means that one skilled in the art at the time of filing would conclude that the inventors lacked possession of the full breadth of the invention claimed. Claims 1-3, 45, 78, 192-194, and 205 are rejected for failing to demonstrate possession of the claimed invention. Claims 2-3, 45, 68, 78, 83, and 192-205 are rejected because they depend from Claim(s) 1 and/or 78 and do not remedy the issues.
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1-3, 45, 68, 78, 83, and 192-205 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
The term “substantially” (and, therefore, “substantially complementary”) in Claims 1-2 and 45 is a relative term which renders the claim indefinite. The term “substantially” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. Since the term “substantially” has unclear metes and bounds, how much sequence complementarity is required by the claims is indefinite.
Claims 1-2 and 45 are rejected for those reasons. Claims 1-3, 45, 68, 78, 83, and 192-205 are rejected because they depend from Claims 1-2, and/or 45 and don’t remedy the issues. In the interest of compact prosecution substantially complementary will be interpreted as requiring that the antisense strand comprises a nucleic acid sequence that is at least 50% complementary to SEQ ID NO 2.
The term “about” in Claims 193-194 is a relative term which renders the claim indefinite. The term “about” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. Since the term “about” has unclear metes and bounds, how many nt each strand is required to have is indefinite.
Claims 193-194 are rejected for those reasons. In the interest of compact prosecution about will be interpreted as ±20% rounded to the nearest whole number, so 12-30 nt long for Claim 193 and 13-25 nt long for Claim 194.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Section 33(a) of the America Invents Act reads as follows:
Notwithstanding any other provision of law, no patent may issue on a claim directed to or encompassing a human organism.
Claim 83 is rejected under 35 U.S.C. 101 and section 33(a) of the America Invents Act as being directed to or encompassing a human organism. See also Animals - Patentability, 1077 Off. Gaz. Pat. Office 24 (April 21, 1987) (indicating that human organisms are excluded from the scope of patentable subject matter under 35 U.S.C. 101).
Claim 83 recites a cell or rAAV comprising the vector of Claim 78 and the cell could be interpreted to read on a human organism. Amending the claim to recite an isolated cell, if appropriate, would obviate this rejection.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1-3, 45A, 68, 78, 192-197, and 201-205 are rejected under 35 U.S.C. 103 as being unpatentable over International Publication Number WO 2020/117706 (published 11 June 2020, “WO706”, of record on IDS) in view of Sledz (and Williams. 2005. RNA interference in biology and disease. Blood 106:787-794, “Sledz”) and International Publication Number WO 2018/031933 (published 15 February 2018, “WO933”, of record on IDS).
Notes: references to p. # in WO documents are to PDF p. #.
WO706 is the International Publication of the US Application 17/299277 (US Patent Application Publication NO. US20230042436, filed on 02 June 2021); some sequences are shown using an alignment tool that references the US application.
WO706 is directed to (Title, §Abstract) compositions and methods for treating trinucleotide repeat expansion disorders associated with MLH3 activity. WO706 teaches (p. 3 L1-30) trinucleotide repeat disorders, including Huntington’s disease, cause progressive degeneration but that inhibiting MLH3 activity can help treat them.
Regarding Claims 1 and 3: WO706 teaches (p. 3 L31-35) single-stranded antisense oligos (ASO) that comprise a region of at least 10 contiguous nt having at least 80% complementarity to an MLH3 gene. 80% complementarity to an MLH3 gene can reasonably be interpreted as the instant claim’s recitation substantia[l] complementar[ity].
Regarding Claims 1 and 45 (specifically Claim 45 limitations A1, B1, C1, D1, E1, F1, and G1): WO706 teaches SEQ ID NOs 788-790, 808, and 804 that comprise a sequence substantially complementary (i.e., as explained in §112[b] substantially complementary is interpreted as comprising a region of at least 50% complementarity) to claimed SEQ ID NO 2. Those levels of complementarity are shown by the following sequence alignments:
US-17-299-277A-808/c
Query Match 44.4%; Score 20; DB 1; Length 20;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 15 GAAGATAATGGTTTTAGTTT 34 claimed SEQ ID NO 2
||||||||||||||||||||
Db 20 GAAGATAATGGTTTTAGTTT 1 WO706 SEQ ID NO 808
RESULT 1
US-17-299-277A-804/c
Query Match 44.4%; Score 20; DB 1; Length 20;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 11 TAGTGAAGATAATGGTTTTA 30 claimed SEQ ID NO 2
||||||||||||||||||||
Db 20 TAGTGAAGATAATGGTTTTA 1 WO706 SEQ ID NO 804
RESULT 1
US-17-299-277A-788/c
Query Match 28.9%; Score 13; DB 1; Length 20;
Best Local Similarity 100.0%;
Matches 13; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TTAAGGAATTTAG 13 claimed SEQ ID NO 2
|||||||||||||
Db 13 TTAAGGAATTTAG 1 WO706 SEQ ID NO 788
RESULT 1
US-17-299-277A-789/c
Query Match 31.1%; Score 14; DB 1; Length 20;
Best Local Similarity 100.0%;
Matches 14; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TTAAGGAATTTAGT 14 claimed SEQ ID NO 2
||||||||||||||
Db 14 TTAAGGAATTTAGT 1 WO706 SEQ ID NO 789
RESULT 1
US-17-299-277A-790/c
Query Match 33.3%; Score 15; DB 1; Length 20;
Best Local Similarity 100.0%;
Matches 15; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TTAAGGAATTTAGTG 15 claimed SEQ ID NO 2
|||||||||||||||
Db 15 TTAAGGAATTTAGTG 1 WO706 SEQ ID NO 790
Therefore WO706 teaches some limitations of Claims 1 and 45.
Regarding Claim 2: In addition, WO706’s SEQ ID NO 788 comprises a sequence that is substantially complementary to claimed SEQ ID NO 9, at least WO706’s SEQ ID NO 808 comprises a sequence that is substantially complementary to claimed SEQ ID NO 10, and WO706’s SEQ ID NO 788 comprises a sequence that is substantially complementary to claimed SEQ ID NO 12. All WO706 sequences are 20-mer and alignments are shown below. Note that repetitive information in the alignments to claimed SEQ ID NOs 10 and 12 has been removed to save space.
RESULT 2
BHV96051/c
ID BHV96051 standard; DNA; 20 BP.
XX
AC BHV96051;
XX
DT 06-AUG-2020 (first entry)
XX
DE Human MLH3 gene targeted antisense oligonucleotide, SEQ ID 788.
XX
KW MLH3 gene; MutL homolog 3; antisense oligonucleotide; antisense therapy;
KW dystrophy; endocrine-gen.; fragile x syndrome; friedreich ataxia; gene;
KW gene silencing; genetic-disease-gen.; growth-disorder-gen.;
KW gynecological; huntingtons chorea; mental retardation;
KW myotonic dystrophy type 1; nanotechnology; neuroprotective; nootropic;
KW premature ovarian failure; prophylactic to disease; rna interference;
KW spinal and bulbar muscular atrophy; spinocerebellar ataxia; ss;
KW therapeutic; tremor; uropathic.
XX
OS Homo sapiens.
XX
CC PN WO2020117706-A1.
XX
CC PD 11-JUN-2020.
XX
CC PF 02-DEC-2019; 2019WO-US064059.
XX
PR 03-DEC-2018; 2018US-0774777P.
PR 22-JUL-2019; 2019US-0877104P.
XX
CC PA (TRIP-) TRIPLET THERAPEUTICS INC.
XX
CC PI Bermingham NA, Bettencourt BR, Bialek PE;
XX
DR WPI; 2020-51531X/052.
XX
CC PT Single-stranded oligonucleotide of ten to thirty linked nucleosides in
CC PT length comprises a region of at least ten contiguous nucleobases having
CC PT at least eighty percent complementarity to an MLH3 gene.
XX
CC PS Claim 13; SEQ ID NO 788; 255pp; English.
XX
CC The present invention relates to a novel single-stranded (ss)
CC oligonucleotide, useful for preventing or treating a trinucleotide repeat
CC expansion disorder and disorders associated with MLH3 activity. The ss
CC oligonucleotide comprises a region of at least ten contiguous nucleobase
CC having complementarity to a mutL homolog 3 (MLH3) gene. The invention
CC further includes: (1) a single-stranded oligonucleotide for inhibiting
CC expression of a human MLH3 gene in a cell; (2) a pharmaceutical
CC composition comprising the oligonucleotides and a pharmaceutically
CC acceptable carrier or excipient; (3) a composition comprising the
CC oligonucleotide and a lipid nanoparticle, a polyplex nanoparticle, a
CC lipoplex nanoparticle, or a liposome; (4) a method for inhibiting
CC transcription of MLH3 in a cell; (5) a method for treating, preventing,
CC or delaying the progression a trinucleotide repeat expansion disorder in
CC a subject in need; and (6) a method for reducing the level and/or
CC activity of MLH3 in a cell; (7) a method for inhibiting expression of an
CC MLH3 gene in a cell; and (8) a method for decreasing trinucleotide repeat
CC expansion in a cell. The ss oligonucleotide of the invention is also
CC useful for treating, preventing, or delaying progression of trinucleotide
CC repeat expansion disorder such as dentatorubropallidoluysian atrophy,
CC Huntington's disease, spinal and bulbar muscular atrophy, spinocerebellar
CC ataxia type 1, spinocerebellar ataxia type 2, spinocerebellar ataxia type
CC 3, spinocerebellar ataxia type 6, spinocerebellar ataxia type 7,
CC spinocerebellar ataxia type 17, and Huntington's disease-like 2, and the
CC non-polyglutamine disease including fragile X syndrome, fragile X-
CC associated tremor/ataxia syndrome, fragile XE mental retardation,
CC Friedreich's ataxia, myotonic dystrophy type 1, spinocerebellar ataxia
CC type 8, spinocerebellar ataxia type 12, oculopharyngeal muscular
CC dystrophy, fragile X-associated premature ovarian failure, FRA2A
CC syndrome, FRA7A syndrome, and early infantile epileptic encephalopathy.
XX
SQ Sequence 20 BP; 6 A; 6 C; 0 G; 8 T; 0 U; 0 Other;
Query Match 100.0%; Score 20; Length 20;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GAGGATATTAAGGAATTTAG 20 claimed SEQ ID NO 9
||||||||||||||||||||
Db 20 GAGGATATTAAGGAATTTAG 1 WO706 SEQ ID NO 788
RESULT 33
BHV96071/c
ID BHV96071 standard; DNA; 20 BP.
XX
[truncated to save space]
XX
CC PN WO2020117706-A1.
XX
CC PD 11-JUN-2020.
XX
[truncated to save space]
XX
CC PS Claim 13; SEQ ID NO 808; 255pp; English.
XX
[truncated to save space]
XX
SQ Sequence 20 BP; 9 A; 5 C; 0 G; 6 T; 0 U; 0 Other;
Query Match 95.0%; Score 19; Length 20;
Best Local Similarity 100.0%;
Matches 19; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 AAGATAATGGTTTTAGTTT 19 claimed SEQ ID NO 10
|||||||||||||||||||
Db 19 AAGATAATGGTTTTAGTTT 1 WO706 SEQ ID NO 808
RESULT 2
BHV96067/c
ID BHV96067 standard; DNA; 20 BP.
XX
[truncated to save space]
XX
CC PN WO2020117706-A1.
XX
CC PD 11-JUN-2020.
XX
[truncated to save space]
XX
CC PS Claim 13; SEQ ID NO 804; 255pp; English.
XX
[truncated to save space]
XX
SQ Sequence 20 BP; 8 A; 5 C; 0 G; 7 T; 0 U; 0 Other;
Query Match 100.0%; Score 20; Length 20;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TAGTGAAGATAATGGTTTTA 20 claimed SEQ ID NO 12
||||||||||||||||||||
Db 20 TAGTGAAGATAATGGTTTTA 1 WO706 SEQ ID NO 804
Therefore WO706 teaches some limitations of Claims 1-3.
Regarding Claim 68, WO706 teaches (pp. 8-11 L37-13) pharmaceutical compositions comprising their ASOs plus a pharmaceutically acceptable carrier, wherein the pharmaceutical composition inhibits expression of MLH3 in a cell or subject.
Regarding Claim 78, WO706 teaches (p. 39 L32-37) vectors for expressing their polynt wherein the vector comprises regulatory sequences that control expression of the polynt.
Regarding Claim 192, WO706 teaches (p. 39 L15-20) oligonts that comprise no more than 3 mismatches to a target sequence. Since WO706 already established sequences that target MLH3 and comprise sequences of 100% complementarity to claimed SEQ ID NO 2, WO706 teaches limitations of Claim 192.
Regarding Claims 193-194, WO706 teaches (p. 8 L29-36) ASOs that are about 15-25 nt long or 20 nt long. Those lengths fall within the ranges about 15-25 nt and about 16-21 nt.
Regarding Claims 45 (specifically Claim 45 limitations B2, C2, D2, E2, F2, and G2) and 195-197, WO706 teaches (p. 8 L20-26) ASOs comprising at least one alternative nucleobase that can be a 2’-OMe modified nt. WO706 teaches (p. 40 L14-20) embodiments wherein all nt of the ASO are alternative nucleosides. An oligont comprising all modified nt would comprise at least 80% modified nt or at least 70%, 85%2’-OMe modifications.
Regarding Claims 201-203, WO706 teaches (p. 8 L15-25) ASOs comprising at least one alternative internucleoside linkage that can be a phosphorothioate (PS) linkage. That is also the kind of linkage that is encompassed by Claim 203.
Regarding Claim 205, WO706 teaches (pp. 31-34 L10-20) their invention encompasses ASOs that comprise the sequence of any of their SEQ ID NOs including 787-790 and 804-808 and that in some embodiments their ASOs exhibit at least 50% or at least 80% target mRNA inhibition compared to a control cell. What’s more, WO706 teaches (Table 3, p. 209) that their SEQ ID NO 788 (which comprises a sequence comprising 100% complementarity to Claimed SEQ ID NOs 2 and 9; shown above) and their SEQ ID NOs 787 and 790 (which each comprise a sequence comprising 100% complementarity to Claimed SEQ ID NOs 2 and 9) reduce MLH3 mRNA expression by ≈65-85% (leaving only ≈23=31% remaining). Those details are shown in this modified excerpt of Table 3:
PNG
media_image3.png
402
917
media_image3.png
Greyscale
The following alignments show that WO706 SEQ ID NO 787 comprises a sequence substantially complementary to claimed SEQ ID NOs 2 and 9 and that WO706 SEQ ID NO 790 comprises a sequence substantially complementary to claimed SEQ ID NO 9:
RESULT 1
US-17-299-277A-787/c
Query Match 26.7%; Score 12; DB 1; Length 20;
Best Local Similarity 100.0%;
Matches 12; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TTAAGGAATTTA 12 claimed SEQ ID NO 2
||||||||||||
Db 12 TTAAGGAATTTA 1 WO706 SEQ ID NO 787
RESULT 1
US-17-299-277A-787/c
Query Match 95.0%; Score 19; DB 1; Length 20;
Best Local Similarity 100.0%;
Matches 19; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GAGGATATTAAGGAATTTA 19 claimed SEQ ID NO 9
|||||||||||||||||||
Db 19 GAGGATATTAAGGAATTTA 1 WO706 SEQ ID NO 787
RESULT 1
US-17-299-277A-790/c
Query Match 90.0%; Score 18; DB 1; Length 20;
Best Local Similarity 100.0%;
Matches 18; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 3 GGATATTAAGGAATTTAG 20 claimed SEQ ID NO 9
||||||||||||||||||
Db 20 GGATATTAAGGAATTTAG 3 WO706 SEQ ID NO 790
Those alignments and data in the Table indicate that WO706 teaches limitations of Claim 205 because the instant claims read on the WO706 sequences and because the Table shows some of those sequences produce a reduction of at least 65% MLH3 mRNA and that is clearly a reduction of at least 50%.
WO706 teaches single stranded ASOs. WO706 does not teach double-stranded RNAs (dsRNA).
However, Sledz teaches (§Introduction ¶1) dsRNA induced a more potent sequence-specific silencing response than single-stranded antisense RNA alone.
In addition, the art of WO933 demonstrates (¶4, ¶12-13) that it was common to produce dsRNAs to downregulate expression of a target gene. WO933 teaches (¶24, ¶248) dsRNAs that target Huntingtin (HTT) mRNA to treat Huntington’s disease. WO933 provides lots of information about how to design dsRNAs.
Regarding Claim 1, WO933 teaches (¶5) double-stranded nucleic acids comprising first and second oligonts wherein the first oligont has a 3’ end and a 5’end and complementarity to a target and wherein the second oligont has a 3’ end and a 5’end and homology to a target. WO933 teaches (e.g., Fig. 18) dsRNAs. That indicates that WO933 teaches the limitations of Claim 1 that WO706 does not teach. Furthermore, artisans know that 3’ and 5’ends are inherent to the structure of any oliognt sequence, and Fig. 18 shows that. Note that the language of WO933 indicates that the first oligont is the claimed AS strand and the second oligont is the claimed sense strand.
Regarding Claim 45, WO933 teaches (¶5, item 3) a portion of the first oligont is complementary to a portion of the second oligont. Therefore WO933 teaches limitations A5, B5, C5, D5, E5, F5, and G5 of Claim 45. WO933 further teaches:
(¶11-13) the first oligont (i.e., AS strand) comprises alternating 2’-methoxy-ribont and 2’-fluoro-ribont, wherein each nucleotide is a 2’-methoxyribonucleotide or a 2,-fluoro-ribonucleotide; and the nucleotides at positions 2 and 14 from the 5’ end of the first oligonucleotide are not 2’-methoxy-ribonucleotides; the second oligonucleotide comprises alternating 2’-methoxy-ribonucleotides and 2’-fluororibonucleotides, wherein each nucleotide is a 2’-methoxy-ribonucleotide or a 2’-fluororibonucleotide; and the nucleotides at positions 2 and 14 from the 5’ end of the second oligonucleotide are 2’-methoxy-ribonucleotides.
An alternating pattern wherein the first position from the 5’end of the AS strand is 2’-OMe would mean 2’-F modifications are at the even-numbered positions on the AS strand. The following illustrates how an alternating 2’-OMe/2’-F pattern would affect the modification at each position on each strand; 2’-F (i.e., non-2’-OMe mods) are shown in bold/underline:
5’[Wingdings font/0xE0]3’ numbering when counting from 5’end (position 1 is at 5’end)
Antisense strand
5’
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17
18
19
20
3’
Therefore WO933 teaches limitations A2-3, 6; B3; C3; F3; and G3. WO933 further teaches (same §) nt at positions 1-6 or 1-7 from the 3’end of the first oligont (i.e., AS strand) and nt at positions 1 and 2 from the 3’end of the second oligont (i.e., sense strand) are connected via PS linkages. Therefore WO933 teaches limitations A4,7; B4, 7; C4, 7; D4, 7; E4, 7; F4, 8; and G4, 8. Therefore WO933 teaches at least the full limitations of Claim 45A.
Regarding Claim 204, WO933 teaches (¶291) capping groups and teaches that a vinyl group is an alkenyl. WO933 teaches (¶146, Fig. 18) including a 5’vinylphosphonate in an AS strand. Therefore WO933 teaches the limitations of Claim 204.
Altogether, WO706 teaches ASO sequences for targeting and inhibiting expression of MLH3, Sledz teaches dsRNAs are more potent than single-stranded ASOs, and WO933 teaches that dsRNAs, including dsRNAs for treating Huntington’s disease, were known in the art and teaches strategies for designing such dsRNAs.
Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the single-stranded ASOs for targeting MLH3 of WO706 with Sledz’s teachings that dsRNA silences a target gene more effectively than a single-stranded ASO and WO933’s teachings about using dsRNAs to inhibit expression of a target gene for the benefit of producing RNAi agents that more effectively downregulate MLH3. One would have been motivated to do so with a reasonable expectation of success because Sledz teaches that a dsRNA is more potent than a single stranded ASO. Therefore, WO706, Sledz, and WO933 would have made obvious all the limitations of Claims 1-3, 45A, 68, 78, 192-197, and 201-205.
Claims 1-3, 45, 68, 78, and 192-205 are rejected under 35 U.S.C. 103 as being unpatentable over WO706, Sledz, and WO933 as applied to Claims 1-3, 45A, 68, 78, 192-197, and 201-205 above, and further in view of Foster (et al. 2018. Advanced siRNA Designs Further Improve In Vivo Performance of GalNAc-siRNA Conjugates. Molec. Ther. 26[3]:708-717, “Foster”).
The teachings of WO706, Sledz, and WO933 as applicable to Claim(s) Claims 1-3, 45A, 68, 78, 192-197, and 201-205 have been described above.
WO706, Sledz, and WO933 teach dsRNAs for inhibiting expression of MLH3 wherein the antisense strand of the dsRNA comprises a sequence substantially complementary to a MLH3 nucleic acid sequence of SEQ ID NO 2. As discussed, WO706 teaches (p. 8 L18-26) their ASOs can comprise all modified nt including 2’-O-methyl modified nt.
WO706, Sledz, and WO933 do not teach the sense strand comprises certain minimum amounts of 2’-O-methyl modifications or 2’-O-methyl modifications at specific positions (Claims 45, specifically limitations B6, C6, D6, E6, F6-7, and G6-7; Claims 198 and 200). WO706, Sledz, and WO933 do not teach the AS strand comprises certain minimum amounts of 2’-O-methyl modifications or 2’-O-methyl modifications at specific positions (i.e., Claims 45, specifically limitations D3 and E3; Claims 197 and 199).
However, Foster, drawn to siRNA designs to further improve in vivo performance of siRNAs, teaches (§Abstract):
substantial efficacy improvements can be achieved through further refinement of siRNA chemistry, optimizing the positioning of 2’-deoxy-2’-fluoro [2’-F] and 2’-O-methyl [2’-OMe] ribosugar modifications across both strands of the double-stranded siRNA duplex to enhance stability without compromising intrinsic RNAi activity.
Foster teaches (§Introduction ¶4-5) 2’-modified RNAs enhance oligont stability to nucleases and that 2’-OMe mods are more stabilizing that 2’-F, but that too many 2’-OMes can make the molecule large and therefore reduce RNAi activity. Foster teaches (same §) designing various versions of an siRNA to identify those with best potency and duration.
Foster teaches (§Results ¶3) 2’-F mods at specifically AS strand positions 2, 6, and 14 and sense strand position 11. Foster counts those position numbers from the 5’end but depending on the length of each strand, those positions encompass position 10 from the 3’end of the sense strand. The following illustrates how an alternating 2’-OMe/2’-F pattern would affect the modification at each position on each strand and how counting from one end or the other affects position numbering for a dsRNA comprising two 20-mer strands. The 2’-F (i.e., non-2’-OMe mods) are shown in bold/underline and position 11 from the 5’end of the sense strand (Foster’s numbering)/position 10 from the 3’end of the sense strand (instant claim numbering) is bolded:
5’[Wingdings font/0xE0]3’ numbering when counting from 5’end (position 1 is at 5’end)
Antisense strand
5’
1
2
3
4
5
6
7
8
9
10
11
12
13
14
15
16
17