DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claim Status
Claims 1-16 are pending.
Claims 1-6 are withdrawn.
Claim 7 is amended.
Election/Restrictions
Applicant’s election without traverse of Group II, claims 7-16, in the reply filed on 01/08/2026 is acknowledged.
Applicant’s election without traverse of the following Species:
Species Group I: Cas12a nuclease
Species Group II: RPA reaction
Species Group III: Cas protein, colloidal gold test paper and a colloidal gold probe
Species Group IV: forward RT-RPA primer (SEQ ID. NO. 3) and reverse RT-RPA primer (SEQ ID NO. 4)
Species Group V: the cRNA sequences: crRNA-N501 and crRNA0Y501 for S gene 501
in the reply filed on 01/08/2026 is acknowledged.
Claims 1-6 (Invention I) and claims 11, 12, and 15-16 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected subject matter, there being no allowable generic or linking claim.
Applicant is reminded that upon the cancelation of claims to a non-elected invention, the inventorship must be corrected in compliance with 37 CFR 1.48(a) if one or more of the currently named inventors is no longer an inventor of at least one claim remaining in the application. A request to correct inventorship under 37 CFR 1.48(a) must be accompanied by an application data sheet in accordance with 37 CFR 1.76 that identifies each inventor by his or her legal name and by the processing fee required under 37 CFR 1.17(i).
Specification
The disclosure is objected to because of the following informalities:
Paragraph 0021 (pg. 5) recites “SEQ ID NO. 10”. There is no disclosure of the sequence of SEQ ID NO. 10 in the specification nor is the sequence listed in the XML sequence listing file.
Appropriate correction is required.
Nucleotide and/or Amino Acid Sequence Disclosures
Summary of Requirements for Patent Applications Filed On Or After July 1, 2022, That Have Sequence Disclosures
37 CFR 1.831(a) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.831(b) must contain a “Sequence Listing XML”, as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.831-1.835. This “Sequence Listing XML” part of the disclosure may be submitted:
1. In accordance with 37 CFR 1.831(a) using the symbols and format requirements of 37 CFR 1.832 through 1.834 via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter “Legal Framework”) in XML format, together with an incorporation by reference statement of the material in the XML file in a separate paragraph of the specification (an incorporation by reference paragraph) as required by 37 CFR 1.835(a)(2) or 1.835(b)(2) identifying:
a. the name of the XML file
b. the date of creation; and
c. the size of the XML file in bytes; or
2. In accordance with 37 CFR 1.831(a) using the symbols and format requirements of 37 CFR 1.832 through 1.834 on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation by reference statement of the material in the XML format according to 37 CFR 1.52(e)(8) and 37 CFR 1.835(a)(2) or 1.835(b)(2) in a separate paragraph of the specification identifying:
a. the name of the XML file;
b. the date of creation; and
c. the size of the XML file in bytes.
SPECIFIC DEFICIENCIES AND THE REQUIRED RESPONSE TO THIS NOTICE ARE AS FOLLOWS:
This application contains sequence disclosures in accordance with the definitions for nucleotide and/or amino acid sequences set forth in 37 CFR 1.831(a) and 1.831(b). However, this application fails to comply with the requirements of 37 CFR 1.831-1.834. The examiner has noted that the sequence for SEQ ID NO: 10 listed in claim 9 is not disclosed in the XML sequence listing file of the current instant application. Applicant must provide:
• A replacement “Sequence Listing XML” part of the disclosure, as described above in item 1. or 2., as well as
• A statement that identifies the location of all additions, deletions, or replacements of sequence information in the “Sequence Listing XML” as required by 1.835(b)(3);
• A statement that indicates support for the amendment in the application, as filed, as required by 37 CFR 1.835(b)(4);
• A statement that the “Sequence Listing XML” includes no new matter in accordance with 1.835(b)(5); and
• A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3), and 1.125 inserting the required incorporation by reference paragraph as required by 37 CFR 1.835(b)(2), consisting of:
o A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
o A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter.
Claim Objections
Claim 7 is objected to because of the following informalities: the claim recites “the colloidal gold test paper methods to detecting the sample”. Applicant should correct the grammatical form of “to detecting”.
Claim 7 is objected to because of the following informalities: the claim recites “the pathogenic mutants of claim 6”. Claim 6 has been withdrawn by the Applicant and thus claim 7 is dependent on a claim that is withdrawn. Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 7-10 and 13-14 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
With regards to claim 7 (and claims 8-10 and 13-14), the claim recites “the colloidal gold test paper method“”. There is no antecedent basis for “the colloidal gold test paper method” thus the claim is rendered indefinite.
With regards to claim 7 (and claims 8-10 and 13-14), the claim recites “combining the CRISPR process”. There is no antecedent basis for “the CRISPR process” thus the claim is rendered indefinite.
With regards to claim 7 (and claims 8-10 and 13-14), the claim recites “detection method of the pathogenic mutants”. There is no antecedent basis for “the pathogenic mutants’ of claim 6 thus the claim is rendered indefinite. The “pathogenic mutants” is interpreted as any pathogenic mutant.
With regards to claim 9, the claim recites “the second probe sequence is SEQ ID NO. 10”. The applicants have not included a sequence for SEQ ID NO: 10 in the sequence listing XML sequence listing file or identified the sequence in the specifications and therefore the sequence is not known. Therefore, the claim is indefinite.
With regards to claim 9, the claim recites “wherein when the pathogen is”. There is no antecedent basis for “the pathogen” thus the claim is rendered indefinite”.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
(g)(1) during the course of an interference conducted under section 135 or section 291, another inventor involved therein establishes, to the extent permitted in section 104, that before such person’s invention thereof the invention was made by such other inventor and not abandoned, suppressed, or concealed, or (2) before such person’s invention thereof, the invention was made in this country by another inventor who had not abandoned, suppressed, or concealed it. In determining priority of invention under this subsection, there shall be considered not only the respective dates of conception and reduction to practice of the invention, but also the reasonable diligence of one who was first to conceive and last to reduce to practice, from a time prior to conception by the other.
A rejection on this statutory basis (35 U.S.C. 102(g) as in force on March 15, 2013) is appropriate in an application or patent that is examined under the first to file provisions of the AIA if it also contains or contained at any time (1) a claim to an invention having an effective filing date as defined in 35 U.S.C. 100(i) that is before March 16, 2013 or (2) a specific reference under 35 U.S.C. 120, 121, or 365(c) to any patent or application that contains or contained at any time such a claim.
Claims 7-8 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Zhang et al. (Frontiers Bioengineering and Biotechnology, Vol. 10:866368. Doi: 10.3389/fbioe.2022.866368; published May 03, 2022), hereinafter referred to as Zhang et al..
With regards to claim 7, Zhang et al. disclose the need to develop a rapid detection strategy for controlling disease transmission by taking advantage of simple operation, point-of-care test (POCT) kits for COVID-19 based on the lateral flow assay (LFA) chemistry (see Abstract pg. 1). Zhang et al. disclose that numerous rapid and sensitive diagnostic kits have been developed including nucleic acid quantification methods (see left panel, pg. 2). Specifically, methods for SARS-CoV-2 nucleic acid determination based on CRISPR system combined with LFAs (lateral flow assay) CRISPR system mediated lateral flow assay have been reported (see left panel, pg. 2). Zhang et al. further disclose that the CRISPR system has been applied to SARS-CoV-2 detection with excellent performance and is recommended for LFA-incorporated POCT (kit) (see right column, pg. 6).
Zhang et al. disclose the following schematic describing the principle of the CRISPR system mediated lateral flow assay (see right column, pg. 6 and Figure 5 on pg. 7).
PNG
media_image1.png
543
705
media_image1.png
Greyscale
In the schematic, Zhang et al. disclose the following components:
Sample SARS-CoV-2 RNA (pathogenic mutant)
CRISPR system
Cas12 protein (Cas protein)
Streptavidin-AuNPs (colloidal gold probe)
Test paper with C-line and T-line (colloidal gold test paper comprising C tape and T tape)
Recognition molecules biotin (conjugate A) and FITC (fluorescein isothiocyanate) (conjugate B)
C line (tape) with an antibody binding (antibody A) to a conjugate (See Figure 5, bottom panel, 1st test strip)
T tape with an antibody (antibody B) biding to a conjugate (conjugate B)
ssDNA (marked with specific recognition molecules at the end such as biotin and FITC) (anticipates conjugate A and conjugate B that are respectively connected with two ends of the first probe sequence)
Detection of sample nucleic acid is illustrated in Figure 5, bottom panel by the test strip cartoons. Also, see Figure 5 legend pg. 7 which states that “the amplicons are directly added into the CRISPR-Cas12 system and activated the Cas12 by dsDNA with the targeting sequence (the red mark) to cleave the ssDNA (marked with specific recognition molecules at the end such as biotin and FITC)”
With respect to claim 8, Zhang et al. disclose (in Figure 5, pg. 7) reporter-biotin coupled with streptavidin-AUNPs (antibodies on surface represented by cartoon) captured at the C line and the FITC (fluorescein isothiocyanate) conjugated antibody-AuNPs@FITC@FTIC captured antibody leads to the signal at T line.
Therefore, claims 7-8 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Zhang et al. (Frontiers Bioengineering and Biotechnology, Vol. 10:866368. Doi: 10.3389/fbioe.2022.866368; published May 03, 2022).
Claims 7, 8, 10 and 13-14 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Tang et al., (medRxiv, doi.org/10.1101/2022.05.11.22274884; published May 16, 2022), hereinafter referred to as Tang et al.. With respect to claim 7 (and claims 8, 10 and 13-14 dependent from) , Tang et al. disclose “a nucleic acid testing-based method aiming to detect and discriminate SAR-CoV-2 variants of concerns (VOCs) by combining RT-RPA and CRISPR-Cas12a detecting assays (RRCd)” which may facilitate “point-of-care testing of SARS-CoV-2 and its variants (instant nucleic acid detection kit) (see Abstract, lines 27-39).
Tang et al. disclose the following schematic (see Figure 1: Detection and discrimination of SARS-CoV-2 VOCs by RRC’d):
PNG
media_image2.png
626
1474
media_image2.png
Greyscale
According to Figure 1 of Tang et al., the document provides a schematic overview of the RRCd workflow consisting of the following components which anticipate the components of the instant nucleic acid detection kit listed in claims 7 (see line 676, Figure 1: Detection and discrimination of SARS-CoV-2 VOCs by RRCd):
Figure 1, panel IIIb, top, steps 1: discloses Cas12a (blue cartoon) (a Cas protein)
Figure 1, panel IIIb, discloses the CRISPR trans-cleavage of FB-ssDNA (first probe sequence) (represented by red F (conjugate B) linked to blue B (conjugate A) in discrimination of SARS-CoV-2 VOCs (correlates with combining CRISPR process with colloidal gold test paper method).
Figure 1, panel IIIb, top, step 1; discloses the pathogenic mutant nucleic acid (represented by red line, labeled mutation)
Figure 1, panel IIIb, top and bottom, step 2; discloses a lateral flow colloidal gold test paper and colloidal gold probe (red circle labeled as GNP) wherein the colloidal gold test paper comprises a C tape and T tape (represented by the rectangle (lateral flow strip); the components and format of lateral flow colloidal gold test paper are commonly known in the art as evidenced by Lin et al., (Food and Agricultural Immunology, Vol. 31, pg. 475-488; published 2020).
Figure 1, panel IIIb, right panel, bottom, step 2 discloses that on the C tape, a conjugate of streptavidin bound to biotin (blue circle, b) ( corresponding to conjugate A of instant claim 7) to antibody A (represented by GNPs with goat and anti-FAM) is formed.
Figure 1, panel IIIb, right panel. top, step 2; discloses that the T-plate demonstrates antibody (antibody B) binding to a conjugate (conjugate B).
With respect to claim 10, Tang et al. disclose:
RT-RPA primers for the S gene 501 site, S501RPAF1: tgtatagattgtttaggaagtctaatctcaa (identical to SEQ ID NO: 3 of the instant application) and S501RPAR1: agactcagtaagaacacctgtgcctggttaa (identical to SEQ ID NO: 4 of the instant application) (see Supplementary Table 1. Primers, cRNAs and probes used in this study).
With respect to claim 13, Tang et al, disclose:
crRNA-E; target: E gene: AAUUUCUACUGUUGUAGAUCAAGACUCACGUUAACAA (identical to SEQ ID NO: 11) (see Supplementary Table 1. Primers, cRNAs and probes used in this study).
With respect to claim 14, Tang et al. disclose:
crRNA sequences crRNA-N501; target: SARS-CoV-2 S gene: AAUUUCUACUGUUGUAGAUCAACCCACUAAUGGUGU (identical to SEQ ID NO. 12) and crRNA-Y501; target; SARS-CoV-2 S gene: AAUUUCUACUGUUGUAGAUCAACCCACUUAUGGUGU (identical to SEQ ID NO:13 in instant application) (see Supplementary Table 1. Primers, cRNAs and probes used in this study). .
Therefore, claims 7, 8, 10 and 13-14 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Tang et al., (medRxiv,
doi.org/10.1101/2022.05.11.22274884; published May 16, 2022).
The prior art made of record and not relied upon is considered pertinent to applicant's disclosure:
KR20210119256A; published October 05, 2021 (describes a kit for detecting COVID-19 virus)
CN11321516B; published August 06, 2021 (describes a CRISPR-Cas12a detection system (kit) for identifying SARS-CoV-2 variant strains)
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to GEORGE T LOUNTOS whose telephone number is (571)272-0502. The examiner can normally be reached Monday-Friday 8:00 am - 5:00 pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Robert Mondesi can be reached at 408-918-7584. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/GEORGE THEMISTOCLIS LOUNTOS/ Examiner, Art Unit 1652
/RICHARD G HUTSON/ Primary Examiner, Art Unit 1652