Prosecution Insights
Last updated: April 19, 2026
Application No. 18/092,202

SIRNA OF ANGPTL3 AND USE THEREOF

Non-Final OA §102§112§DP
Filed
Dec 30, 2022
Examiner
POLIAKOVA-GEORGAN, EKATERINA
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Nanopeptide (Qingdao) Biotechnology Ltd.
OA Round
1 (Non-Final)
65%
Grant Probability
Favorable
1-2
OA Rounds
2y 8m
To Grant
81%
With Interview

Examiner Intelligence

Grants 65% — above average
65%
Career Allow Rate
434 granted / 668 resolved
+5.0% vs TC avg
Strong +16% interview lift
Without
With
+16.2%
Interview Lift
resolved cases with interview
Typical timeline
2y 8m
Avg Prosecution
55 currently pending
Career history
723
Total Applications
across all art units

Statute-Specific Performance

§101
5.4%
-34.6% vs TC avg
§103
28.6%
-11.4% vs TC avg
§102
22.8%
-17.2% vs TC avg
§112
24.2%
-15.8% vs TC avg
Black line = Tech Center average estimate • Based on career data from 668 resolved cases

Office Action

§102 §112 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restrictions Applicant’s election without traverse of Group I, claims 1-7 and 10-12 in the reply filed on 12/22/2025 is acknowledged. Claims 8-9, 13-14 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected Group, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 12/22/2025. Election of species of SEQ ID NOs: 29, 17, 19, 43 and 183, 171, 173, 197 and Compound 1048 is acknowledged. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph: Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. Claims 2 and 11 are rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Claim 2 depends on claim 1 and adds a limitation essentially describing the same genus of siRNAs as claimed in claim 1. Therefore claim 2 does not further limit claim 1. Claim 11 depends on claim 10, which recites drugs comprising siRNA conjugates. Claim 11 adds a limitation of the use of such drug for treatment of specific diseases. Such limitation is of intended use and does not affect the structures of siRNA conjugates, therefore claim 11 does not further limit claim 10. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. Claim Rejections - 35 USC § 102 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claim(s) 1-5, 10-11 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Bettencourt et al (WO 2012/177784, December 2012). Concerning claims 1-2 and 4 Bettencourt disclose siRNA with a sense strand A-108386.1 and antisense strand A-108387.1 in Table 7 on page 154, such sense strand identical to instant SEQ ID NO: 29 and antisense strand comprising instant SEQ ID NO: 183, with complementarity region of 21 nucleotides: SEQ ID NO: 29 1 ACCAGTGAAATCAAAGAAGAA 21 |||||:||||:|||||||||| A-108386.1 1 ACCAGUGAAAUCAAAGAAGAA 21 SEQ ID NO: 183 1 TTCTTCTTTGATTTCACTGGT 21 ::|::|:::||:::|||:||: A-108386.1 1 UUCUUCUUUGAUUUCACUGGUUU 23 Such siRNA targets nucleotides 316-336 in ANGPTL3 sequence (see fourth column in Table 7). Concerning claim 3 Bettencourt disclose that siRNAs of the invention can comprise 2’-O-methyl modified nucleotides (see lines 8-10 on page 3). Concerning claim 5 Bettencourt disclose siRNA conjugates with a target ligand bound to 5’ or 3’ end of the sense strand of siRNA through thiophosphate bond (see lines 24-25 on page 3, lines 25-30 on page 31, lines 20-30 on page 53). Concerning claims 10-11 Bettencourt disclose pharmaceutical compositions comprising siRNA conjugates of the invention for inhibiting expression of ANGPTL3 gene (see lines 13-15 on page 5). Limitation of claim 11 of specific use of such composition is of intended use and is not given patentable weight. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1-7, 10-12 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-20 of copending Application No. 18/130,418 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because claims from ‘418 recite the same siRNA conjugates as in instant claims. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Improper Markush rejection Claims 1-7, 10-12 are rejected on the basis that it contains an improper Markush grouping of alternatives. See In re Harnisch, 631 F.2d 716, 721-22 (CCPA 1980) and Ex parte Hozumi, 3 USPQ2d 1059, 1060 (Bd. Pat. App. & Int. 1984). A Markush grouping is proper if the alternatives defined by the Markush group (i.e., alternatives from which a selection is to be made in the context of a combination or process, or alternative chemical compounds as a whole) share a “single structural similarity” and a common use. A Markush grouping meets these requirements in two situations. First, a Markush grouping is proper if the alternatives are all members of the same recognized physical or chemical class or the same art-recognized class, and are disclosed in the specification or known in the art to be functionally equivalent and have a common use. Second, where a Markush grouping describes alternative chemical compounds, whether by words or chemical formulas, and the alternatives do not belong to a recognized class as set forth above, the members of the Markush grouping may be considered to share a “single structural similarity” and common use where the alternatives share both a substantial structural feature and a common use that flows from the substantial structural feature. See MPEP § 2117. The Markush grouping of siRNAs with sense strands of SEQ ID NOs: 1-154 and antisense strands of SEQ ID NOs: 155-308 is improper because the alternatives defined by the Markush grouping do not share both a single structural similarity and a common use for the following reasons: each siRNA has its own sequence different from the others, so that there is no structural similarity between them (see Table 2 of instant specification). Further, lack of structural similarity leads to lack of common use, so that activities of the siRNAs vary widely (see Table 2 of instant specification). To overcome this rejection, Applicant may set forth each alternative (or grouping of patentably indistinct alternatives) within an improper Markush grouping in a series of independent or dependent claims and/or present convincing arguments that the group members recited in the alternative within a single claim in fact share a single structural similarity as well as a common use. Limiting the claims to no more than 10 siRNAs will overcome the rejection. Conclusion Any inquiry concerning this communication or earlier communications from the examiner should be directed to EKATERINA POLIAKOVA whose telephone number is (571)270-5257. The examiner can normally be reached Mon-Fri 8-5. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571)272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /EKATERINA POLIAKOVA-GEORGANTAS/Primary Examiner, Art Unit 1637
Read full office action

Prosecution Timeline

Dec 30, 2022
Application Filed
Jan 22, 2026
Non-Final Rejection — §102, §112, §DP (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12600964
Compound for treatment of heart failure
2y 5m to grant Granted Apr 14, 2026
Patent 12595477
COMPLEMENT FACTOR B-MODULATING COMPOSITIONS AND METHODS OF USE THEREOF
2y 5m to grant Granted Apr 07, 2026
Patent 12584130
ANGIOTENSINOGEN (AGT) iRNA COMPOSITIONS AND METHODS OF USE THEREOF
2y 5m to grant Granted Mar 24, 2026
Patent 12576030
COMPOSITIONS FOR DELIVERY OF CODON-OPTIMIZED MRNA
2y 5m to grant Granted Mar 17, 2026
Patent 12570977
NOVEL MRNA COMPOSITION AND PRODUCTION METHOD FOR USE IN ANTI-VIRAL AND ANTI-CANCER VACCINES
2y 5m to grant Granted Mar 10, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
65%
Grant Probability
81%
With Interview (+16.2%)
2y 8m
Median Time to Grant
Low
PTA Risk
Based on 668 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month