Prosecution Insights
Last updated: October 04, 2026
Application No. 18/092,202

SIRNA OF ANGPTL3 AND USE THEREOF

Final Rejection §102§DP
Filed
Dec 30, 2022
Priority
Sep 30, 2020 — CN 202011061038.1 +3 more
Examiner
POLIAKOVA-GEORGAN, EKATERINA
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Nanopeptide (Qingdao) Biotechnology Ltd.
OA Round
2 (Final)
64%
Grant Probability
Moderate
3-4
OA Rounds
0m
Est. Remaining
82%
With Interview

Examiner Intelligence

Grants 64% of resolved cases
64%
Career Allowance Rate
440 granted / 688 resolved
+4.0% vs TC avg
Strong +18% interview lift
Without
With
+18.0%
Interview Lift
resolved cases with interview
Typical timeline
2y 7m
Avg Prosecution
60 currently pending
Career history
752
Total Applications
across all art units

Statute-Specific Performance

§101
6.9%
-33.1% vs TC avg
§103
28.0%
-12.0% vs TC avg
§102
19.0%
-21.0% vs TC avg
§112
26.6%
-13.4% vs TC avg
Black line = Tech Center average estimate • Based on career data from 688 resolved cases

Office Action

§102 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claim Rejections - 35 USC § 102 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claim(s) 1, 3-5, 10 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Bettencourt et al (WO 2012/177784, December 2012, of record). Concerning claims 1 and 4 Bettencourt disclose siRNA with a sense strand A-108342.1 and antisense strand A-108343.1 in Table 7 on page 152, such sense strand comprises nucleotides 6-21 of instant SEQ ID NO: 19 and antisense strand comprises nucleotides 1-18 of instant SEQ ID NO: 173, with complementarity region of 21 nucleotides: SEQ ID NO: 19 1 TTAGACGATGTAAAAATTTTA 21 |||||||||||||||| A-108342.1 1 CGAUGUAAAAAUUUUAGCCAA 21 SEQ ID NO: 173 1 TAAAATTTTTACATCGTCTAA 21 |||||||||||||||||| A-108343.1 1 UUGGCUAAAAUUUUUACAUCGUC 23 Concerning claim 3 Bettencourt disclose that siRNAs of the invention can comprise 2'-O- methyl modified nucleotides (see lines 8-10 on page 3). Concerning claim 5 Bettencourt disclose siRNA conjugates with a target ligand bound to 5' or 3' end of the sense strand of siRNA through thiophosphate bond (see lines 24-25 on page 3, lines 25-30 on page 31, lines 20-30 on page 53). Concerning claims 10 Bettencourt disclose pharmaceutical compositions comprising siRNA conjugates of the invention for inhibiting expression of ANGPTL3 gene (see lines 13-15 on page 5). Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1, 3-7, 10, 12, 21 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-2, 17 of copending Application No. 18/130,418 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because claims from '418 recite the same targeting ligands as in instant claims. Further, using specification of ‘418 as a dictionary to understand the purpose of ligands claimed it is obvious to arrive to the same siRNAs and their conjugates as in instant claims (see Table 2 of ‘418, Embodiment 3 on pages 43-45). This is a provisional nonstatutory double patenting rejection. Response to Arguments Applicant's arguments filed 05/25/2026 have been fully considered but they are not persuasive. Previous 112, 102, double patenting and improper Markush rejections are withdrawn in view of new amendments, arguments are moot. Conclusion Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to EKATERINA POLIAKOVA whose telephone number is (571)270-5257. The examiner can normally be reached Mon-Fri 8-5. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571)272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /EKATERINA POLIAKOVA-GEORGANTAS/Primary Examiner, Art Unit 1637
Read full office action

Prosecution Timeline

Dec 30, 2022
Application Filed
Jan 28, 2026
Non-Final Rejection mailed — §102, §DP
May 25, 2026
Response Filed
Aug 10, 2026
Final Rejection mailed — §102, §DP (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12735705
COMPOUND, METHOD AND PHARMACEUTICAL COMPOSITION FOR REGULATING EXPRESSION OF ATAXIN 3
3y 10m to grant Granted Sep 15, 2026
Patent 12737877
RNA MOLECULES, METHODS OF PRODUCING CIRCULAR RNA, AND TREATMENT METHODS
3y 1m to grant Granted Sep 15, 2026
Patent 12691134
Treatment Of Cerebrovascular Disease With Neurogenic Locus Notch Homolog Protein 3 (NOTCH3) Agents
4y 1m to grant Granted Jul 28, 2026
Patent 12662676
APTAMER NUCLEIC ACID MOLECULE, AND COMPLEX AND APPLICATION THEREOF
4y 7m to grant Granted Jun 23, 2026
Patent 12630827
ANTISENSE OLIGONUCLEOTIDES TARGETING SCN2A FOR THE TREATMENT OF SCN1A ENCEPHALOPATHIES
2y 3m to grant Granted May 19, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
64%
Grant Probability
82%
With Interview (+18.0%)
2y 7m (~0m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 688 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month