DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Priority
Applicant’s claim to priority from US Provisional Application No. 63/298,019 filed 01/10/2022 is hereby acknowledged.
Election/Restrictions
Applicant’s election without traverse of Invention Group I (Claims 1-3, 45, 68, 78-79, 83, 85, 87-88, 157-158 and 166 , drawn to double-stranded RNA (dsRNA) molecule comprising a sense and antisense strand, a branched RNA comprising the same dsRNA, a vector comprising the dsRNA molecule, a pharmaceutical composition comprising the dsRNA, a recombinant adeno-associated virus or a cell or a compound comprising the dsRNA, in the reply filed on 12/16/2025 is acknowledged;
Applicant’s election of Species in the reply filed on 12/16/2025 is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)).
Election of Species was made as follows:
Species Group A: A double stranded RNA in a compound/composition that can be a branched RNA, a vector, a AAV, a cell, or a pharmaceutical composition, comprising a sense strand with the base sequence set forth in (claims 1-3, 45, 79, 88, 157) :
2) SEQ ID NO: 2, with 15 nucleotides in length.
Species Group B: A double stranded RNA in a compound/composition that can be a branched RNA, a vector, a AAV, a cell, or a pharmaceutical composition, comprising an antisense strand with the base sequence set forth in (claims 1-3, 45, 79, 88, 157) :
SEQ ID NO: 5, with 20 nucleotides in length.
Species Group C: A double stranded RNA in a compound/composition that can be a branched RNA, a vector, a AAV, a cell, or a pharmaceutical composition, comprising a specific modification pattern (claims 3, 45, 88, 157-158):
internucleotide linkage formula (I) wherein W is 0, Y is O- or S- and Z is 0.
A modification pattern comprising 2'-0-methyl modified nucleotides and a 5' vinyl phosphonate as set forth as "P5" in Example 1: Antisense strand, from 5' to 3' (20-nucleotides in length): P(mX)#(fX)#(mX)(mX)(mX)(fX)(mX)(mX)(mX)(mX)(mX)(mX)(m X)#(fX)#(mX)#(fX)#(mX)#(mX)#(mX)#(fX) and
Sense strand, from 5' to 3' (15-nucleotides in length):
(mX)#(mX)#(mX)(mX)(fX)(fX)(fX)(mX)(fX)(mX)(mX)(mX)(mX)#( mX)#(mX);
Hydrophobic moiety that are lipids;
A Zc4 linker;
for branched compounds, a compound of formula I, (I-1) having a terminal group R', where L is L2.
Application Status
Amendments to claims filed 12/16/2025 are hereby acknowledged. Claims 1-3, 45, 68, 85, 87-88,157-158 and 166 are currently amended. Claims 4-44, 46-67, 69-84, 86, 89-156, 159-165, 167-184 are cancelled. Claims 185-194 are newly added.
Claims 1-3, 45, 68, 85, 87-88, 157-158, 166 and 185-194 are currently pending and under consideration in this office action.
Information Disclosure Statement
The information disclosure statements (IDSs) submitted on 06/06/2024 and 12/16/2025 are hereby acknowledged. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
Drawings
Drawing sheets submitted on 01/09/2023 are hereby acknowledged and are acceptable.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or non-obviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1-3, 68, 185-190 are rejected under 35 U.S.C. §103 as being unpatentable over Freier (Freier, S.M. et al. US 11,129,844 B2, published September 28, 2021) in view of Bertrand (Bertrand, J-R. et al. "Comparison of antisense oligonucleotides and siRNAs in cell culture and in vivo". Biochemical and Biophysical Research Communications, Vol. 296 (2002), pp: 1000-1004).
Regarding claims 1 and 3, Freier teaches antisense oligonucleotides that target a MECP2 nucleic acid sequences that are set forth in GENBANK Accession No. NM_004992.3, and taught as SEQ ID NO: 2 (see column 10, lines 13-17).
Freier’s disclosure is drawn to optimizing therapeutic compositions for treating MECP2-associated disorder or syndrome such as MECP2 duplication syndrome, which is a neurological disorder (see column 12, lines 34-53).
When aligning sequences from SEQ ID NO: 2 of Freier (Db) to SEQ ID NO: 2 of instant Application (Qy) as shown below, it is noted that the alignment to nucleotide 1751 to 1799 of SEQ ID NO: 2 of Freier presents 100% identity to instant SEQ ID NO: 2.
Query Match 100.0%; Score 49; DB 1; Length 10241;
Best Local Similarity 100.0%;
Matches 49; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TTATGGGTAGGGCTCTGACAAAGCTTCCCGATTAACTGAAATAAAAAAT 49
|||||||||||||||||||||||||||||||||||||||||||||||||
Db 1751 TTATGGGTAGGGCTCTGACAAAGCTTCCCGATTAACTGAAATAAAAAAT 1799
Freier teaches antisense oligonucleotides that are complementary to nucleobases 44-79, 87-126, 131-273, 321-376, 478-513, 535-570, 630-716, 834-928, 930-973, 977-1004, 1081-1126, 1130-1189, 1224-1275, 1440-1509, 1514-1745, and 1750-1785 of SEQ ID NO: 2. Freier teaches that these sequences are hotspot regions (see column 36, lines 5-14). As noted in the alignment above, instant Application’s SEQ ID NO: 2 correspond to nucleotides 1751 to 1799, which overlaps with the last hotspot taught by Freier.
Freier defines a “hotspot” as a range of nucleobases on a large nucleic acid amenable to antisense compounds for reducing the amount or activity of the target nucleic acid as shown in examples (see column 5, lines 48-51). Therefore, the oligonucleotides complementary to hotspots nucleic acid sequence of MECP2 mRNA are target-specific, and have sufficient complementarity to direct silencing of MECP2 mRNA.
Regarding claims 2 and 3, Freier teaches antisense oligonucleotides that are complementary to the hotspots nucleic acid sequence of MECP2 mRNA, and specifically an oligonucleotide comprising SEQ ID NO: 5 of instant Application, i.e. SEQ ID NO: 171 of Freier, an oligonucleotide with 20 nucleobases in length (see Table 2, column 52, and column 201).
A search result and an alignment of SEQ ID NO: 5 (Qy) with SEQ ID NO: 171 of Freier (Db) is shown below:
RESULT 3
US-16-535-888-171/c
(NOTE: this sequence has 1 duplicate in the database searched.
See complete list at the end of this report)
Sequence 171, US/16535888
Patent No. 11129844
GENERAL INFORMATION
APPLICANT: Ionis Pharmaceuticals, Inc.
TITLE OF INVENTION: COMPOSITIONS FOR MODULATING MECP2 EXPRESSION
FILE REFERENCE: BIOL0264WO
CURRENT APPLICATION NUMBER: US/16/535,888
CURRENT FILING DATE: 2019-08-08
PRIOR APPLICATION NUMBER: 62/127,682
PRIOR FILING DATE: 2015-03-03
NUMBER OF SEQ ID NOS: 328
SEQ ID NO 171
LENGTH: 20
TYPE: DNA
ORGANISM: Artificial sequence
FEATURE:
OTHER INFORMATION: Synthetic oligonucleotide
Query Match 100.0%; Score 16; Length 20;
Best Local Similarity 100.0%;
Matches 16; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 ACAAAGCTTCCCGATT 16
||||||||||||||||
Db 18 ACAAAGCTTCCCGATT 3
Alignment of SEQ ID NO: 2 (Qy) of instant Application to Freier’s SEQ ID NO: 171 (column 201: TTA ATC GGG AAG CTT TGT CA) (Db) is shown below:
Query Match 40.8%; Score 20; DB 1; Length 20;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 16 TGACAAAGCTTCCCGATTAA 35
||||||||||||||||||||
Db 20 TGACAAAGCTTCCCGATTAA 1
Therefore, Freier teaches an antisense strand of 20 contiguous nucleotides comprising a sequence 100% complementary to nucleotides 16 to 35 of SEQ ID NO: 2 of instant Application. The Antisense oligonucleotide is also substantially complementary to a MECP2 nucleic acid sequence of SEQ ID NO: 5; the complementarity of the antisense strand is 100% over 16 contiguous nucleotides in this antisense oligonucleotide with SEQ ID NO: 171.
Freier also teaches that this specific ASO of SEQ ID NO: 171 triggers a 78% inhibition in expression of MECP2 mRNA (see Table 2, column 52).
Regarding claims 1-3, Freier does not teach a double stranded RNA (dsRNA) molecule.
However, Bertrand teaches comparison between antisense oligonucleotides (ASOs) with siRNAs in cell culture and in vivo (see title).
Bertrand teaches an ASO protected with two phosphorothioates in 3’ and two phosphorothioates in 5’ and a 22 base pair siRNA targeted both against the coding region of a green fluorescent protein (GFP). Bertrand teaches that the siRNA inhibition rises to 70% efficacy after 5 hours, while the ASO only rises to 50% after the same amount of time, then decreases to zero at 20hours. The siRNA efficiency keeps rising to 80% at 20hours (see Figure 3 on page 1002).
Bertrand also teaches that a double stranded RNA is more stable (75% remaining after 24hours in Hela cells lysate) than a single stranded RNA or a single stranded DNA (see Figure 6, page 1004). Bertrand’s teachings suggest that the prolonged effect of siRNA compared to the ASO’s effect, is likely due to a longer half-life of the siRNA, and to sequestration of ASO in cellular compartments away from interaction with the mRNA, and therefore maintaining it inactive (see page 1003, left column, lines 10-25).
Bertrand concludes that siRNA duplexes are very resistant to biodegradation in fetal calf serum or human plasma. Bertrand also teaches that siRNA are tools to specifically inhibit the gene expression in vivo as they are powerful agents in cell culture and are more resistant to degradation (see page 1004, right column, first paragraph).
Therefore, it would have been obvious to one with ordinary skills in the art before the effective filing date of the claimed invention to have substituted the ASO comprising an antisense strand complementary to SEQ ID NO:2 and to SEQ ID NO: 5, i.e., a 20 nucleobases oligonucleotide of SEQ ID NO: 171 as taught by Freier, with a double stranded RNA targeting the same region for RNA interference, as taught by Bertrand. One with ordinary skills in the art, motivated in targeting a “hotspot” for MECP2 mRNA expression inhibition using a more stable molecule, leading to a longer effect, could have performed this modification with a reasonable expectation of success and arrived at the claimed invention.
Regarding claim 68, Freier teaches a pharmaceutical composition for inhibiting expression of MECP2 gene in an organism, comprising the antisense nucleic acid and a pharmaceutically acceptable carrier ( see columns 30 (lines 66-67) and 31 (lines 6-29). Bertrand teaches replacing an ASO with a siRNA duplex to be delivered to nude mice using a formulation (vectorized) comprising 30 ng Cytofectin™ GSV (see page 1001, right column, “Animal experiments” section).
The obviousness of combining the references Freier and Bertrand is described above.
Regarding claim 185, Freier teaches SEQ ID NO: 171, which is an antisense strand that comprises zero mismatch with the MECP2 nucleic acid sequence of SEQ ID NO: 2, and which presents full complementarity to the MECP2 nucleic acid sequence of SEQ ID NO: 2.
The obviousness of combining the references Freier and Bertrand is described above.
Regarding claim 186, Freier teaches an antisense strand that is 20 nucleotides in length (see Table 2, column 52, and column 201). Bertrand teaches an ASO and a siRNA that both target the same nucleic acid sequence of a GFP gene (see page 1000, right column, first paragraph). Bertrand teaches a siRNA that is 22 nucleotides in length (see page 1000, right column, “Materials and methods” section, “Nucleic acids” paragraph).
The obviousness of combining the references Freier and Bertrand is described above.
Regarding claim 187, Freier teaches an antisense strand molecule of SEQ ID NO: 171 that comprises three (3) 5-methylcytosines, 13 phosphorothioate internucleoside linkages, ten (10) 2’-methoxyethyl modified nucleosides and ten (10) 2’-deoxynucleosides (see Table 2, columns 51-52). Freier also teaches that the internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates (see column 22, lines 4-9). Freier teaches modified sugar moieties that can be C1-C12 alkyl groups as well (see column 22, line 32).
The obviousness of combining the references Freier and Bertrand is described above.
Regarding claims 188, 189 and 190, Freier teaches linking covalently the antisense compound with “lipid moieties that enhance the activity, cellular distribution or cellular uptake of the resulting antisense oligonucleotides” (see column 31, lines 35-38). Freier teaches that the conjugates can include cholesterol ( i.e. a steroid and hydrophobic moiety), phospholipids, biotin, phenazine, folate (i.e., a vitamin), phenanthridine, coumarins and dyes (see column 31, lines 38-42).
Therefore, it would have been obvious to one with ordinary skills in the art before the effective filing date of the claimed invention to have combined the teachings of Freier modified with Bertrand and obtained a dsRNA as taught by Bertrand. It would have been obvious to one with ordinary skills in the art to have modified and conjugated an hydrophobic moiety, such as cholesterol, to the 5’ end and/or 3’ end of the antisense strand of the resulting dsRNA, and/or the 5’ end and/or 3’ end of the sense strand of the dsRNA. One with ordinary skills in the art, motivated in obtaining a dsRNA compound that has enhanced activity, cellular distribution and/or cellular uptake could have performed this modification with a reasonable expectation of success and arrived at the claimed invention.
Claims 45, 85, and 166 are rejected under 35 U.S.C. §103 as being unpatentable over Freier (Freier, S.M. et al. US 11,129,844 B2, published September 28, 2021) in view of Bertrand (Bertrand, J-R. et al. "Comparison of antisense oligonucleotides and siRNAs in cell culture and in vivo". Biochemical and Biophysical Research Communications, Vol. 296 (2002), pp: 1000-1004), as applied to claim 1 above, and in further view of Khvorova (Khvorova, A. et al. WO 2017/132669 A1, published August 3, 2017; cited on IDS filed 06/062024).
The rejection of claim 1 is described above. The combination of Freier and Bertrand renders the elements of claim 1 obvious.
However, regarding claim 45, the combination of Freier and Bertrand does not render obvious a dsRNA molecule comprising an antisense and sense strand with a 5’ end and a 3’ end with the specific limitations stated in alternatives A, B, C, D, E, F, or G, regarding the percentage of 2’-O-methyl modifications, the positions of 2’-methoxy-reibonucleotides, the position of phosphorothioate internucleotide linkages on the sense and antisense strands.
However, for formula A, for example, Khvorova teaches double stranded RNA, wherein the antisense strand comprises alternating 2’-methoxy-ribonucleotides and 2’ -fluoro-ribonucleotides (see claim 10, page 57). Khvorova also teaches antisense strand wherein the positions 2 and 14 from the 5’ end are not 2’-methoxy-ribonucleotides (see claim 22, page 61 (formula III)). Khvorova also teaches nucleotides at positions 1-2 to 1-7 from 5’ end of the antisense strand are connected to each other via phosphorothioate internucleotide linkages ( see claims 11 and 14, page 57; and see formula VI page 63). Khvorova also teaches that a portion of the antisense strand is complementary to a portion of the sense strand (see formulas V and VI, pages 62-63). Khvorova also teaches that nucleotides at positions 1-2 from 5’ end of the sense strand are connected to each other via phosphorothioate internucleotide linkages (see formula V and VI, pages 62-63).
Khvorova teaches using these modification patterns to modify a HTT mRNA-targeting dsRNA with success in an animal model (see [046], page 11). Khvorova teaches that the compositions described allow efficient, stable delivery of siRNA in order to promote potent silencing of therapeutic target genes (see [081]).
Therefore, it would have been obvious to one with ordinary skills in the art before the effective filing date of the claimed invention to have combined the teachings of Freier modified with Bertrand, obtained a double stranded RNA and applied the modifications patterns taught by Khvorova, to the double stranded RNA. One with ordinary skills in the art, motivated in obtaining a stable dsRNA could have performed these modifications with a reasonable expectation of success since Khvorova taught applying these modifications to a dsRNA and targeting a gene involved in a brain disorder, i.e., HTT gene, with success, and would arrived at the claimed invention. Therefore, the combination of Freier’s, Bertrand’s and Khvorova’ s teachings renders elements of the claim obvious.
Regarding claims 85 and 166, Freier teaches a pharmaceutically acceptable carrier for the composition (see column 31, lines 6-29).
However, the combination of Freier and Bertrand does not render obvious a branched RNA compound nor a pharmaceutical composition comprising a branched RNA compound.
However, Khvorova teaches using branched oligonucleotides exhibiting efficient and specific tissue distribution, cellular uptake and minimum immune response and off-target effects (see title and abstract).
Khvorova teaches the use of a combined double dsRNAs to target HTT mRNA with success (see [046], page 11). Khvorova teaches that the compositions described allow efficient, stable delivery of siRNA in order to promote potent silencing of therapeutic target genes (see [081]).
Therefore, it would have been obvious to one with ordinary skills in the art before the effective filing date of the claimed invention to have modified the composition taught by Freier modified by Bertrand, with the modifications as taught by Khvorova and transformed the dsRNA into a branched dsRNA as taught by Khvorova. It would have been obvious to combine the resulting branched RNA compound with a pharmaceutically acceptable carrier as taught by Freier. One with ordinary skills in the art, motivated in reducing off-targets effects while obtaining a composition that is stable and efficient in MECP2 target gene silencing, could have performed this modification with a reasonable expectation of success and arrived at the claimed invention.
Claims 191, 192 and 193 are rejected under 35 U.S.C. §103 as being unpatentable over Freier (Freier, S.M. et al. US 11,129,844 B2, published September 28, 2021) in view of Bertrand (Bertrand, J-R. et al. "Comparison of antisense oligonucleotides and siRNAs in cell culture and in vivo". Biochemical and Biophysical Research Communications, Vol. 296 (2002), pp: 1000-1004), as applied to claims 1, 188 and 189 above, and in further view of Khvorova (Khvorova, A. et al. WO 2017/132669 A1, published August 3, 2017; cited on IDS filed 06/062024).
The rejections of claims 1, 188 and 189 are described above. The combination of Freier and Bertrand renders the elements of claims 1 and 188-189 obvious.
Regarding claims 191, 192 and 193, the combination of Freier and Bertrand does not render obvious a functional moiety linked to the 5’ end and/or 3’ end of the antisense strand, and/or the 5’ end and/or 3’ end of the sense strand by a linker.
However, Khvorova teaches “branched oligonucleotide compound comprising two or more nucleic acids, the nucleic acids connected to one another by one or more moieties selected from a linker, a spacer and a branching point” (see [006]).
Khvorova teaches that each linker can be an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphate, a phosphonate, a phosphoramidate, an ester (i.e. a phosphodiester), an amide, a triazole, and combinations thereof” (see [014]).
Khvorova also teaches a linker having a phosphate radical (i.e., formula Zc4 of instant Application , wherein X is a “O” (i.e., phosphodiester linkage), or a “S” (i.e., phosphorothioate linkage) attached to an ethylene glycol chain (see Figure 17; and see [024]-[025]).
Therefore, it would have been obvious to one with ordinary skills in the art before the effective filing date of the claimed invention to have combined the teaching of Freier modified with Bertrand with the teachings of Khvorova and attached a linker taught by Khvorova to the dsRNA taught by Freier modified with Bertrand. One with ordinary skills in the art, motivated in combining two or more antisense oligonucleotides and avoiding off-target effects and increasing specificity, could have performed this modification with a reasonable expectation of success and arrived at the claimed invention.
Claims 87-88, 157-158 and 194 are rejected under 35 U.S.C. §103 as being unpatentable over Khvorova (Khvorova, A. et al. WO 2017/132669 A1, published August 3, 2017; cited on IDS filed 06/062024) in view of Freier (Freier, S.M. et al. US 11,129,844 B2, published September 28, 2021) and Bertrand (Bertrand, J-R. et al. "Comparison of antisense oligonucleotides and siRNAs in cell culture and in vivo". Biochemical and Biophysical Research Communications, Vol. 296 (2002), pp: 1000-1004).
Regarding claims 87-88 and 157-158, Khvorova teaches “branched oligonucleotide compound comprising two or more nucleic acids, the nucleic acids connected to one another by one or more moieties selected from a linker, a spacer and a branching point” (see [006]).
Khvorora’s disclosure is drawn to optimizing therapeutics for the treatment of a neurological disease, i.e. Huntington’s disease, targeting the HTT mRNA (see [0241]).
Khvorova teaches using branched oligonucleotides exhibiting efficient and specific tissue distribution, cellular uptake and minimum immune response and off-target effects (see title and abstract).
Khvorova teaches the use of a branched double dsRNAs to target HTT mRNA with success (see [046], page 11). Khvorova teaches that the compositions described allow efficient, stable delivery of siRNA in order to promote potent silencing of therapeutic target genes (see [081]).
Khvorova also teaches Formula (I) : L----(N)n wherein “L is selected from an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, and combinations thereof, formula (I) optionally further comprises one or more branch point B, and one or more spacer S; B is independently for each occurrence a polyvalent organic species or derivative thereof; S is independently for each occurrence selected from an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, and combinations thereof; N is an RNA duplex comprising a sense strand and an antisense strand, the sense strand and antisense strand each independently comprise one or more chemical modifications; and n is 2, 3, 4, 5, 6, 7 or 8” (see [015], page 3).
Khvorova also teaches that L is structure L1 or L2 which are the same than the L1 and L2 structures of instant Application (see [024]-[025]).
Khvorova does not teach a target that is MECP2 mRNA.
However, Freier teaches antisense oligonucleotides that target a MECP2 nucleic acid sequences that are set forth in GENBANK Accession No. NM_004992.3, and taught as SEQ ID NO: 2 (see column 10, lines 13-17).
Freier’s disclosure is drawn to optimizing therapeutic compositions for treating MECP2-associated disorder or syndrome such as MECP2 duplication syndrome, which is also a neurological disorder (see column 12, lines 34-53).
When aligning sequences from SEQ ID NO: 2 of Freier (Db) to SEQ ID NO: 2 of instant Application (Qy) as shown below, it is noted that the alignment to nucleotide 1751 to 1799 of SEQ ID NO: 2 of Freier presents 100% identity to instant SEQ ID NO: 2.
Query Match 100.0%; Score 49; DB 1; Length 10241;
Best Local Similarity 100.0%;
Matches 49; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TTATGGGTAGGGCTCTGACAAAGCTTCCCGATTAACTGAAATAAAAAAT 49
|||||||||||||||||||||||||||||||||||||||||||||||||
Db 1751 TTATGGGTAGGGCTCTGACAAAGCTTCCCGATTAACTGAAATAAAAAAT 1799
Freier teaches antisense oligonucleotides that are complementary to nucleobases 44-79, 87-126, 131-273, 321-376, 478-513, 535-570, 630-716, 834-928, 930-973, 977-1004, 1081-1126, 1130-1189, 1224-1275, 1440-1509, 1514-1745, and 1750-1785 of SEQ ID NO: 2. Freier teaches that these sequences are hotspot regions (see column 36, lines 5-14). As noted in the alignment above, instant Application’s SEQ ID NO: 2 correspond to nucleotides 1751 to 1799, which overlaps with the last hotspot taught by Freier.
Freier defines a “hotspot” as a range of nucleobases on a large nucleic acid amenable to antisense compounds for reducing the amount or activity of the target nucleic acid as shown in examples (see column 5, lines 48-51). Therefore, the oligonucleotides complementary to hotspots nucleic acid sequence of MECP2 mRNA are target-specific, and have sufficient complementarity to direct silencing of MECP2 mRNA.
Alignment of SEQ ID NO: 2 (Qy) of instant Application to Freier’s SEQ ID NO: 171 (column 201: TTA ATC GGG AAG CTT TGT CA) (Db) is shown below:
Query Match 40.8%; Score 20; DB 1; Length 20;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 16 TGACAAAGCTTCCCGATTAA 35
||||||||||||||||||||
Db 20 TGACAAAGCTTCCCGATTAA 1
Therefore, Freier teaches an antisense strand of 20 contiguous nucleotides comprising a sequence 100% complementary to nucleotides 16 to 35 of SEQ ID NO: 2 of instant Application.
Bertrand teaches comparison between antisense oligonucleotides (ASOs) with siRNAs in cell culture and in vivo (see title). Bertrand teaches an ASO protected with two phosphorothioates in 3’ and two phosphorothioates in 5’ and a 22 base pair siRNA targeted both against the coding region of a green fluorescent protein (GFP). Bertrand teaches that the siRNA inhibition rises to 70% efficacy after 5 hours, while the ASO only rises to 50% after the same amount of time, then decreases to zero at 20hours. The siRNA efficiency keeps rising to 80% at 20hours (see Figure 3 on page 1002).
Bertrand also teaches that a double stranded RNA is more stable (75% remaining after 24hours in Hela cells lysate) than a single stranded RNA or a single stranded DNA (see Figure 6, page 1004).
Bertrand’s teachings suggest that the prolonged effect of siRNA compared to the ASO’s effect, is likely due to a longer half-life of the siRNA, and to sequestration of ASO in cellular compartments away from interaction with the mRNA, and therefore maintaining it inactive (see page 1003, left column, lines 10-25).
Bertrand concludes that siRNA duplexes are very resistant to biodegradation in fetal calf serum or human plasma. Bertrand also teaches that siRNA are tools to specifically inhibit the gene expression in vivo as they are powerful agents in cell culture and are more resistant to degradation (see page 1004, right column, first paragraph).
Therefore, it would have been obvious to one with ordinary skills in the art before the effective filing date of the claimed invention to have substituted the dsRNA compound targeting HTT mRNA as taught by Khvorova, for a dsRNA compound targeting MECP2 mRNA, as it would have been obvious to have modified the ASO taught by Freier and transformed it into a dsRNA as taught by Bertrand, and applied modifications as taught by Khvorova. One with ordinary skills in the art, motivated in optimizing a pharmaceutical composition using antisense strategy, to obtain a compound for treating a MECP2 associated disorder, could have performed this modification with a reasonable expectation of success, since it would be optimizing a known antisense compound taught by Freier for another neurological disorder, using chemical modifications used with success by Khvorova in a Huntington’s disease model. One with ordinary skills in the art, could have performed these modifications with a reasonable expectation of success and arrived at the claimed invention before the effective filing date.
Regarding claim 194, Khvorova teaches that the branched RNA compound can be two or more RNA molecules comprising one or both of ssRNA and dsRNA, or each RNA molecule comprises a dsRNA comprises a sense strand and an antisense strand (see claims 1, 3, and 7, page 57).
Freier teaches ASO targeting a nucleic acid of SEQ ID NO: 2 as described above.
The obviousness of the combinations of references, Khvorova, Freier and Bertrand is described above for claim 87. The elements of claim 194 are therefore rendered obvious by the combination of references as well.
Conclusion
No claim is allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ALEXANDRA G DACE DENITO whose telephone number is (703)756-4752. The examiner can normally be reached Monday-Friday, 8:30-5:00EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/A.D./Examiner, Art Unit 1636
/NANCY J LEITH/Primary Examiner, Art Unit 1636