Prosecution Insights
Last updated: April 19, 2026
Application No. 18/102,588

AGENTS USEFUL IN TREATING FACIOSCAPULOHUMERAL MUSCULAR DYSTROPHY

Final Rejection §DP§Other
Filed
Jan 27, 2023
Examiner
DRISCOLL, LORA E BARNHART
Art Unit
3991
Tech Center
3900
Assignee
Universite de Mons
OA Round
2 (Final)
31%
Grant Probability
At Risk
3-4
OA Rounds
4y 12m
To Grant
50%
With Interview

Examiner Intelligence

Grants only 31% of cases
31%
Career Allow Rate
120 granted / 388 resolved
-29.1% vs TC avg
Strong +20% interview lift
Without
With
+19.6%
Interview Lift
resolved cases with interview
Typical timeline
4y 12m
Avg Prosecution
23 currently pending
Career history
411
Total Applications
across all art units

Statute-Specific Performance

§101
3.7%
-36.3% vs TC avg
§103
23.8%
-16.2% vs TC avg
§102
18.6%
-21.4% vs TC avg
§112
31.9%
-8.1% vs TC avg
Black line = Tech Center average estimate • Based on career data from 388 resolved cases

Office Action

§DP §Other
Notice of Pre-AIA or AIA Status The present application is being examined under the pre-AIA first to invent provisions. Nucleotide and/or Amino Acid Sequence Disclosures Applicant’s 12/31/25 sequence-listing submission is compliant. Objection—Specification Amendments On 12/31/25, applicant submitted a substitute specification indicating the presence of a sequence listing. The amendment to page 1 of the specification fails to comply with 37 CFR 1.173(d)(2), however, because it indicates material to be deleted with strikethrough rather than with single brackets. See MPEP 1453(I). Withdrawn Objection—Drawings The objection to the drawings is withdrawn in view of the sequence listing and the amendments to the specification clarifying the contents of Figure 27. Withdrawn Rejections—Double Patenting The electronic terminal disclaimer submitted 12/30/25 over USP 9,988,628, in conjunction with the 12/31/25 written reply, has overcome the rejections for nonstatutory double patenting. Reissue Declaration The reissue oath/declaration filed with this application is defective because it fails to identify at least one specific error which is relied upon to support the reissue application. See 37 CFR 1.175 and MPEP § 1414. The reissue declaration filed 1/27/23 attempts to identify at least one error in the original claims. The declaration reads: This application is a broadening reissue application. Applicant found the claims of the patent included recitations that Applicant believes to be unnecessarily narrow for patentability. For example, claim 1 recites “an oligonucleotide of 20 to 30 nucleotides in length that comprises at least 20 consecutive nucleotides that are complementary to the nucleotide sequence set forth as SEQ ID NO:69 (AGTTCAGAGATATATTAAAATGCCC).” As one example of broadening, new claims 31, 72 [sic 71], and 75 [sic 74] and certain claims dependent therefrom recite “an oligonucleotide that targets a double homeobox 4 (DUX4) RNA to bring about RNAi-mediated downregulation of the DUX4 RNA” and do not recite the nucleotide sequence set forth at SEQ ID NO:69. Additionally, new claims 78 and 79 [sic 77 and 78] recites a method [of] “producing a sense strand; producing a separate antisense strand; wherein the antisense strand comprises at least 10 consecutive nucleotides complementary to a DUX4 RNA; and combining the sense and antisense strand under conditions in which the sense and antisense strand anneal to form an oligonucleotide comprising a double stranded portion” and do not recite the nucleotide sequence set forth as SEQ ID NO:69. New claim 80 [sic 79] recites an “oligonucleotide that targets a double homeobox 4 (DUX4) RNA to bring about downregulation of the DUX4 RNA, wherein the oligonucleotide comprises a strand comprising at least 10 consecutive nucleotides complementary to the DUX4 RNA” and does not recite the nucleotide sequence set forth as SEQ ID NO:69. As detailed below in the rejection under 35 U.S.C. 251, these errors are not correctable by reissue because they are an attempt to reclaim nonelected subject matter from application 13/225,384. The reissue declaration does not explain why failing to include these claims in underlying application 16/562,030 (now US Patent 10,907,157) was an error correctable by reissue. Finally, as identified above, the reissue declaration contains numerous typographical errors that lend confusion to what material applicant wishes to correct. The 12/31/25 reply was unaccompanied by any replacement declaration. Claim Rejections – 35 U.S.C. 251 – Defective Reissue Declaration Claims 1-76 remain rejected as being based upon a defective reissue declaration under 35 U.S.C. 251 as set forth above. See 37 CFR 1.175. The nature of the defect(s) in the declaration is set forth in the discussion above in this Office action. Claim Rejections – 35 U.S.C. 251 (Failure to timely file a continuing application) Claims 31-76 are rejected under 35 U.S.C. 251 for lack of defect in the original patent and lack of any error in obtaining the original patent. See MPEP 1412.01(II). In this reissue new claims 31-76 are not specific to the elected antisense agent in application 13/225,384 (now abandoned) (grandparent application). Pursuant to MPEP 1412.01.II, the failure to file a continuation application of the non-elected claims/inventions cannot be recovered by filing a reissue application. In application 13/225,384,1 the examiner imposed a three-way restriction requirement: Group I: an antisense agent capable of binding to DUX4 or DUX4c genes; Group II: an RNAi agent capable of reducing the production of DUX4 proteins; and Group III: a method for treating a disease. (10/11/12 restriction at 2.) The examiner further required election of a particular species of antisense agent (for Group I), including SEQ ID NOs:20 and 65, or RNAi agent (for Group II). (Restriction at 4.) On 12/7/12, applicant elected Group I (antisense agent) and SEQ ID NO:20 as the antisense agent without traverse. Applicant did not contest the examiner’s finding that SEQ ID NO:65 is an antisense agent (i.e., an agent that binds genomic DNA to effect gene knockdown). A final Office action was mailed on 6/11/13, and a notice of abandonment was mailed 1/6/14. Applicant did not file a divisional application drawn to the RNAi claims of nonelected Group II or to any of the species of RNAi identified at page 4 of the restriction requirement. None of the continuing applications leading to the underlying ’157 patent application claimed the non-elected Group II invention, which is RNAi. On 11/12/13, applicant filed divisional application 14/078,133, which was limited to the method claims of nonelected Group III. That application was abandoned on 3/14/16. On 2/18/16, applicant filed divisional application 15/047,259, which was limited to the claims of elected Group I (antisense agent) and the species SEQ ID NO:65 for the antisense construct. The ’258 application issued as US Patent 9,988,628 on 6/5/18. On 1/17/18, applicant filed application 15/873,751, which was limited to the method claims of nonelected Group III. That application was abandoned on 10/7/19. On 9/5/19, applicant filed the underlying ’157 patent application 16/562,030 with claims limited to oligonucleotides that bind SEQ ID NO:69 and/or have particular identity to SEQ ID NO:65. The ’030 application issued as underlying US Patent 10,907,157 on 2/2/21. By definition, SEQ ID NO:65 is an antisense agent. (See column 14, lines 10-14.) On 1/27/23, applicant filed this reissue application with original claims 1-30 from the ’157 patent as well as new claims 31-79. New claim 31 is limited to an RNAi oligonucleotide that targets a DUX4 RNA to bring about RNAi-mediated downregulation of that RNA. New claim 79 likewise targets DUX4 RNA. Because the oligonucleotides target DUX4 RNA, not DUX4 genomic DNA as the previously examined antisense constructs, these new claims and the claims that depend from them correspond to nonelected Group II from the restriction in the ’384 application. This finding is supported by the definitions in the specification. Applicant defines antisense agents (the subject matter of Group I) generally as being capable of annealing with a target sequence in any type of target nucleic acid. (Column 31, lines 61-63.) Original Group I was limited, however, to antisense agents capable of binding to the DUX4 or DUX4c genes—meaning the agents bind genomic DNA. Applicant did not traverse the examiner’s finding that SEQ ID NOs: 20 and 65 are both antisense agents. The prosecution in the underlying patent was therefore limited to an examination of Group I. By contrast, RNAi (the subject matter of original Group II) refers generally to the process of sequence-specific post-transcriptional gene silencing mediated partially by short interfering nucleic acids binding RNA. (Column 34, lines 49-53.) Applicants failed to file a continuing/divisional application of non-elected Group II or the non-elected species of RNAi in response to the restriction requirement issued in the ’384 application. The failure to file a continuing application is not considered to be error causing a patent granted on the elected claims to be partially inoperative by claiming less than applicant had a right to claim. Accordingly, this is not correctable by reissue of the original patent under 35 U.S.C. 251. See MPEP 1412.01. II. In this reissue, the presentation of new claims 31-79 is precluded under 35 USC 251. (See MPEP 1412.01 citing In re Orita, 550 F.2d 1277, 1280, 193 USPQ 145, 148 (CCPA 1977)). Accordingly, new claims 31-79 remain rejected under 35 USC 251. Response to Arguments Applicant notes that the patented claims are drawn to “oligonucleotides” that allegedly encompass RNAi constructs in their scope. (Reply at 13-14.) This argument overlooks the fact, however, that the examiner in the underlying application interpreted elected Group I’s oligonucleotides to be antisense oligonucleotides based on the sequence provided in the claim—not a generic claim to oligonucleotides of any function. This is evidenced at least by the text of the original restriction requirement in application 13/225,384: PNG media_image1.png 300 590 media_image1.png Greyscale (10/11/12 restriction at 2.) At the time of the restriction, claim 37 was limited to an antisense agent, while claim 57 was limited to an RNAi agent: PNG media_image2.png 52 642 media_image2.png Greyscale PNG media_image3.png 58 640 media_image3.png Greyscale (9/2/11 claim listing at 3, 6.) The restriction requirement therefore demonstrates that the examiner considered antisense RNA and RNAi to be two distinct inventions; this point was not traversed by applicant in response to the restriction. The examiner further required election of a particular species of antisense agent (for Group I), including SEQ ID NOs:20 and 65 or a SEQ ID NO: from a nonoverlapping list of options (for Group II): PNG media_image4.png 284 640 media_image4.png Greyscale (Restriction at 4.) In the 12/7/12 reply, applicant did not contest the examiner’s finding that SEQ ID NO:65 is an antisense agent. The examiner never rejoined any nonelected claims or species. The prosecution history of the ’384 application therefore supports a finding that in that proceeding, the examiner considered antisense oligonucleotides to be a distinct invention compared to oligonucleotides that perform RNAi and that SEQ ID NO: 65 was antisense, not RNAi. In underlying application 16/562,030, applicant filed a preliminary amendment claiming oligonucleotides comprising sequences complementary to, e.g., SEQ ID NOs: 69 and 65. (4/9/20 claim listing at 2.) Consistent with her findings in the original ’384 application, the examiner again interpreted these as being limited to antisense oligonucleotides. (See, e.g., 5/18/20 nonfinal Office action at 6, referring to “[t]he antisense oligonucleotides of claims 27-40.”) There is no evidence that the examiner ever considered applicants as having filed a continuing application embracing the scope of nonelected Group II. It is also not the case that the person of ordinary skill in the art would have considered a claim to antisense oligonucleotides as being generic to oligonucleotides that perform RNAi. Before the time of the invention, skilled artisans recognized these two types of constructs as having different functions and different mechanisms of action. For example, Brantl (2002, Biochimica et Biophysica Acta 1575: 15-25; reference U) teaches that antisense systems occur naturally in both prokaryotes and eukaryotes and block transcription. (Pages 15-19; Figure 1.) By contrast, RNAi naturally occurs only in eukaryotes and post-transcriptionally silences RNA. (Pages 20-24; Figure 2.) These systems and processes are distinct from each other and are non-overlapping. Applicant contends that the reissue “does not broaden the claims with respect to oligonucleotide modality” because the RNAi claims “represent a narrowing of the originally claimed genus of ‘oligonucleotides’ rather than an expansion.” (Reply at 15-16.) But the underlying ’157 patent does not claim oligonucleotides broadly; it is limited to those oligonucleotides complementary to SEQ ID NO: 69. The ’157 patent identifies SEQ ID NO: 69 as the binding partner for an antisense oligonucleotide. (Column 13, lines 51-54.) The prosecution history of the underlying application, as well as the one containing the original restriction requirement, taken in view of the art supports a finding that antisense oligonucleotides are not generic to RNAi-mediating oligonucleotides and that the patented “oligonucleotide” claims have never been viewed as such. There is no disclosure in the ’157 patent to indicate that such an oligonucleotide complementary to SEQ ID NO: 69 or 65 would target DUX4 RNA to bring about RNAi-mediated DUX4 downregulation. It is therefore not the case that the ’157 patent represents a generic claim that includes both antisense oligonucleotides and RNAi, and the reissue claims constitute an improper broadening to include the latter. The rejection stands. Conclusion Claims 1-79 are rejected. THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Maintenance Fees Applicant is reminded of the requirement to pay all applicable maintenance fees on the original patent. See MPEP 1415.01. Duty to Disclose Applicant is reminded of the continuing obligation under 37 CFR 1.178(b), to timely apprise the Office of any prior or concurrent proceeding in which Patent No. 10,907,157 is or was involved. These proceedings would include any trial before the Patent Trial and Appeal Board, interferences, reissues, reexaminations, supplemental examinations, and litigation. Applicant is further reminded of the continuing obligation under 37 CFR 1.56, to timely apprise the Office of any information which is material to patentability of the claims under consideration in this reissue application. These obligations rest with each individual associated with the filing and prosecution of this application for reissue. See also MPEP §§ 1404, 1442.01 and 1442.04. Any inquiry concerning this communication or earlier communications from the examiner should be directed to LORA E BARNHART DRISCOLL, whose telephone number is (571)272-1928. The examiner can normally be reached M-F 7:00-4:00 p.m. ET. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Patricia Engle, can be reached on 571-272-6660. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /Lora E Barnhart Driscoll/Patent Reexamination Specialist, Art Unit 3991 Conferees: /KSO/ Patent Reexamination Specialist, Art Unit 3991 /Patricia L Engle/SPRS, Art Unit 3991 1 Application 13/225,384 was the first application filed in this family. Two divisional applications were filed from ’384: 14/078,133 (now abandoned) and 15/047,258 (now US Patent 9,988,628). Application 15/873,151 (now abandoned) was filed as a continuation of the ’258 application. Underlying application 16/562,030 was filed as a continuation of the ’751 application. The ’030 application issued as US Patent 10,907,157, currently under reissue.
Read full office action

Prosecution Timeline

Jan 27, 2023
Application Filed
Jun 30, 2025
Non-Final Rejection — §DP, §Other
Dec 31, 2025
Response Filed
Jan 08, 2026
Final Rejection — §DP, §Other (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12564188
Hydrogel Beads for Controlled Uptake and Release of Cryoprotective Agents
2y 5m to grant Granted Mar 03, 2026
Patent RE50754
COMPOSITIONS AND METHOD FOR MULTIPLEX BIOMARKER PROFILING
2y 5m to grant Granted Jan 20, 2026
Patent RE50753
RECOMBINANT ADENOVIRUSES AND USE THEREOF
2y 5m to grant Granted Jan 20, 2026
Patent RE50630
Use of an All-D-Pentapeptide Chemokine Antagonist to Reduce Opioid Dose in a Person with Pain
2y 5m to grant Granted Oct 14, 2025
Patent RE50566
COMPOSITIONS AND METHODS FOR MODULATING NEURONAL EXCITABILITY AND MOTOR BEHAVIOR
2y 5m to grant Granted Sep 02, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
31%
Grant Probability
50%
With Interview (+19.6%)
4y 12m
Median Time to Grant
Moderate
PTA Risk
Based on 388 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month