DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claim(s) 1, 3, 5-7, 9, 11-13, 16-20 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Beigelman et al (WO 2021/207637, 14 October 2021).
Concerning claims 1, 7, 13 Beigelman disclose methods of treatment or prevention of coronavirus infection (see Abstract) by administering two or more virus targeting siRNAs (see paragraphs [0041-0042]). One of such siRNAs has a SEQ ID NO: 3635 (see Table 1 on page 226), which is 100% identical to instant SEQ ID NO: 6:
SEQ ID NO: 6 1 TTCAACAGAACTTCCTTCCTT 21
|||||||||||||||||||||
SEQ ID NO: 3536 1 TTCAACAGAACTTCCTTCCTT 21
Another siRNA disclosed is of SEQ ID NO: 2279 (see Table 1 on page 208), 19 nucleotides long and fully identical to first 19 nucleotides of instant SEQ ID NO: 7:
SEQ ID NO: 7 1 TTTTAGGCTCTGTTGGTGGTT 21
|||||||||||||||||||
SEQ ID NO: 2279 1 TTTTAGGCTCTGTTGGTGG 19
Further Beigelman disclose that siRNAs antisense strand can have TT overhang (see paragraph [0162]). Adding such overhang to antisense strand of SEQ ID NO: 2279 makes it identical to instant SEQ ID NO: 7.
Concerning claims 3 and 9 Beigelman disclose prevention of coronavirus infection (see paragraph [0009]), therefore it is inherent that siRNAs are administered prior to such infection and before subject exhibited any symptoms.
Concerning claims 5-6, 11-12 and 16-17 Beigelman disclose intravenous administration or by inhalation (intratracheally) (see paragraph [0052]).
Concerning claims 18-20 Beigelman disclose that the subject to administer treatment to can be mammal such as human (see paragraph [0051]).
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claim(s) 1, 3, 5-7, 9, 11-13, 16-20 is/are rejected under 35 U.S.C. 102(a)(1) and 102(a)(2) as being anticipated by Tang et al (US 2021/0246448, August 2021, cited from IDS).
The applied reference has a common inventor with the instant application. Based upon the earlier effectively filed date of the reference, it constitutes prior art under 35 U.S.C. 102(a)(2). This rejection under 35 U.S.C. 102(a)(2) might be overcome by: (1) a showing under 37 CFR 1.130(a) that the subject matter disclosed in the reference was obtained directly or indirectly from the inventor or a joint inventor of this application and is thus not prior art in accordance with 35 U.S.C. 102(b)(2)(A); (2) a showing under 37 CFR 1.130(b) of a prior public disclosure under 35 U.S.C. 102(b)(2)(B) if the same invention is not being claimed; or (3) a statement pursuant to 35 U.S.C. 102(b)(2)(C) establishing that, not later than the effective filing date of the claimed invention, the subject matter disclosed in the reference and the claimed invention were either owned by the same person or subject to an obligation of assignment to the same person or subject to a joint research agreement.
Concerning claims 1, 7, 13 Tang disclose methods for treatment and prevention of coronavirus infection (see Abstract) by administering at least two virus targeting siRNAs (see paragraph [0009]). One of such siRNAs can be of SEQ ID NO: 408 (see sequence listing), identical to instant SEQ ID NO: 1:
SEQ ID NO: 408 1 GGAAGGAAGTTCTGTTGAATT 21
|||||||||||||||||||||
SEQ ID NO: 1 1 GGAAGGAAGTTCTGTTGAATT 21
Another siRNA can be of SEQ ID NO: 405 (see sequence listing), first 19 nucleotides of which are identical to instant SEQ ID NO: 2:
SEQ ID NO: 405 1 CCACCAACAGAGCCTAAAA 19
|||||||||||||||||||
SEQ ID NO: 2 1 CCACCAACAGAGCCTAAAATT 21
Further Tang disclose that siRNAs can have overhang at 3’ end (see paragraph [0056]) such as TT (see Figure 20). Adding such overhang to SEQ ID NO: 405 makes it identical to instant SEQ ID NO: 2.
Concerning claims 3 and 9 Tang disclose prevention of coronavirus infection (see Abstract), therefore it is inherent that siRNAs are administered prior to such infection and before subject exhibited any symptoms.
Concerning claims 5-6, 11-12 and 16-17 Tang disclose intravenous administration (see paragraph [0110]) or intratracheally (see paragraph [0120]).
Concerning claims 18-20 Tang disclose that the subject to administer treatment to can be mammal such as human (see paragraph [0017]).
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 1, 3-7, 9-13, 15-20 is/are rejected under 35 U.S.C. 103 as being unpatentable over Beigelman et al, above.
Teachings of Beigelman are discussed above.
Beigelman do not teach specific timing of siRNA administration as in claims 4, 10 and 15.
It would have been obvious to one of the ordinary skill in the art before the effective filing date of the claimed invention to identify specific times to administer siRNAs as in claims 4, 10 and 15 based on teachings of Beigelman. It would be the matter of ordinary optimization to identify times of drug administration for the optimal effect.
Claim(s) 1-20 is/are rejected under 35 U.S.C. 103 as being unpatentable over Tang et al, above, and in further view of Beigelman et al, above.
Teachings of Tang are discussed above.
Tang do not teach treatments using siRNAs of SEQ ID NOs: 1-2 and 6-7, or specific timing of siRNA administration as in claims 4, 10 and 15.
Teachings of Beigelman are discussed above.
It would have been obvious to one of the ordinary skill in the art before the effective filing date of the claimed invention to treat coronavirus infection using siRNAs of SEQ ID NOs: 1-2 and 6-7 and identify specific times to administer siRNAs as in claims 4, 10 and 15 based on teachings of Tang and Beigelman. One of the ordinary skill in the art would be motivated to do so because both references teach treatment of coronavirus infection with siRNAs identical to instant SEQ ID NOs: 1-2 and 6-7. Therefore it would be reasonable to use them in the same composition, arriving at instant invention. It is obvious to combine things known separately to have the same effect (In re Kerkhoven, MPEP 2144.06). It would be the matter of ordinary optimization to identify times of drug administration for the optimal effect.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1, 3-7, 9-13, 15-20 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-16 of U.S. Patent No. 12006500. Although the claims at issue are not identical, they are not patentably distinct from each other because claims from ‘500 recite pharmaceutical compositions for treatment of coronavirus infection comprising siRNAs of SEQ ID NO: 402, which comprises instant SEQ ID NO: 1 and SEQ ID NO: 405, which is identical to first 19 nucleotides of instant SEQ ID NO: 2, simply excluding TT overhang. Such pharmaceutical compositions can be used for treatment of coronavirus infection, same as in instant claims.
Claims 1-20 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-16 of U.S. Patent No. 12006500 in view of Beigelman et al, above. Claims from ‘500 recite pharmaceutical compositions for treatment of coronavirus infection comprising siRNAs of SEQ ID NO: 402, which comprises instant SEQ ID NO: 1 and SEQ ID NO: 405, which is identical to first 19 nucleotides of instant SEQ ID NO: 2, simply excluding TT overhang. Teachings of Beigelman are discussed above. It would have been obvious to use siRNAs from ‘500 in combination with siRNAs taught by Beigelman for prevention or treatment of coronavirus infection, arriving at instant invention.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to EKATERINA POLIAKOVA whose telephone number is (571)270-5257. The examiner can normally be reached Mon-Fri 8-5.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571)272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/EKATERINA POLIAKOVA-GEORGANTAS/Primary Examiner, Art Unit 1637