DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 12/22/2025 has been entered.
Claims Status
Claims 1-8, 10-17, 19, 21 and 23 are pending and being examined.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1-8, 10-17, 19, 21, and 23 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claims 1 and 11 recite, “… the genome is transformed without integration of T-DNA…” (line 7). The applicant defines the term ““transformation” or “transform” referring “to a process of introducing a DNA sequence or construct (e.g., a vector or expression cassette) into a cell or protoplast in which that exogenous DNA is incorporated into a chromosome or is capable of autonomous replication”” (spec, page 10, line 24-27). The aforementioned recitation contradicts the definition in the specification. Instant description does not describe or indicate any working example including introduction of a (foreign) DNA sequence or a construct (other than T-DNA) into a genome or that autonomously replicates, in which that introduction is referred to as ‘transformation’, either. Claims depending from claim 1 and claim 11 inherit the indefiniteness.
It is suggested to replace the term “transformed” (in claims 1 and 11) with “edited” in view of the instant specification defining the term “transformation” or “transform”.
Claims 5 and 14 recite, “… or a fragment thereof…” (of SEQ ID NO: 17) (line 2). Parent claims 1 and 14 require contacting a plant cell or tobacco cell, respectively, with a first nucleic acid sequence that encodes an oligonucleotide for transiently silencing POLQ in the cell. SEQ ID NO: 17 comprises not only a DNA POLQ antisense sequence but also a promoter (35S CaMV) and a terminator (Fig. 10). The sequences encoding the 35S CaMV and the terminator are not involved in conferring POLQ silencing per se. It is not clear to the Examiner what the Applicant implies by “a fragment thereof”. That is, given SEQ ID NO: 17 includes a promoter and terminator, it is unclear what sequences of SEQ ID NO: 17 must be included in the “fragment”. It is suggested to either to delete the “a fragment thereof” or specify the fragment.
Claim Rejections - 35 USC § 103
Claims 1-4, 6-8, 10-13, 15-17, 21 and 23 are rejected under 35 U.S.C. 103 as being unpatentable over Trauterman et al. (US 2021/0139926 A1) in view of Unkefer et al. (US 2011/0030089 A1).
Claims 1 and 11 are drawn to a method for editing a genome of a tobacco plant cell by transiently silencing the DNA polymerase Q (POLQ) enzyme in the cell, introducing a second nucleic acid sequence that encodes a genome editing system for editing a gene of interest using Agrobacterium, and without integration of any T-DNA in the plant genome. The method also comprises incubating the plant cell in a first callus induction medium, a second callus induction medium, and a shoot induction medium.
Trauterman et al. describes a method of editing a genome of a plant cell by introducing at least one oligonucleotide for silencing the POLQ gene using RNAi/shRNA (page 16, para 0223) in corn and a second nucleotide that encodes a genome editing component (guide RNA) (page 2, para 0018; page 16, para 0223) targeting an endogenous gene by introducing specific oligos in a maize (an annual plant, as recited in claim 2) protoplast (a plant organ, as recited in claim 3) via PEG mediated transformation (page 15, para 0217). Trauterman et al. describes transiently silencing non-homologous end joining ( NHEJ ) and/or microhomology mediated end joining ( MMEJ ) pathways during the editing process in a plant (abstract) by silencing a target gene (POLQ) using RNAi (page 16, para 0223). The suppression needs to be transient so that the resulting organisms and the cells in it are still able to perform essential DNA repair functions (page 2, para 0015, right column, line 1-3). Trauterman et al. also teaches knockout mutant plants lacking POLQ (also known as Pol θ) activity which are incapable of integrating T-DNA molecules during Agrobacterium tumefaciens mediated plant transformation (page 2, para 11), as recited in claims 4 and 13. Even though the working example for Trauterman et al. uses PEG mediated transformation in a maize explant, Trauterman et al. states that the method is applicable to tobacco plants (page 4, para 0058), as recited in claim 12.
Trauterman et al. describes highly specific site-directed nucleases (SDNs) or modified variants thereof including meganucleases, Zinc-Finger Nucleases (ZFNs), Transcription Activator Like Effector Nucleases (TALENs), and Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) nuclease-based systems that introduce double-strand breaks (DSBs), or single-strand nicks or breaks, or targeted base pair exchanges (page 1, para 0005), as recited in claims 6-7 and 15-16. Trauterman et al. describes introducing genetic modifications in the endogenous HMG transcription factor (ZmHMG13) by introducing a guide RNA (crRNA) as part of the CRISPR/Cas system in the cell (page 14, para 0215; page 16, para 0223), satisfying the claim limitations of claims 8 and 17.
However, Trauterman et al. does not explicitly teach two different callus induction media and a shoot induction medium.
Unkefer et al. describes developing callus on MS media (without having any antibiotic) from which the transformed plantlets would emerge (page 17, para 0166, line 1-2). The MS media taught by Unkefer et al. is interpreted as “first callus induction media”, as recited in claims 1 and 11. Unkefer et al. also describes regeneration of transgenic plants by incubating the callus tissue onto a second selection medium containing kanamycin (page 17, para 0166, line 3-5), as recited in claim 10 (and claims 1 and 11). The second selection medium containing kanamycin from Unkefer et al. is interpreted as “second callus induction medium” as recited in instant claims 1 and 11. Unkefer et al. also teaches transferring the antibiotic-resistant callus to a shoot induction medium (page 31, para 0292, line 4-5; page 34, para 0331), as recited in claims 1, 11, and 23. It is known in the art that callus induction and shoot induction can be achieved simultaneously while regenerating a plant from a transformed cell, implying that callus induction medium and shoot induction medium can be the same or similar.
Unkefer et al. describes use of Timentin (to repress/kill Agrobacterium. Timentin has no influence on selecting transgenic cells) at concentrations ranging from 50 mg/L (page 33, para 0318) to (100mg/L) (page 33, para 0316) and Kanamycin (used as a selection agent for transgenic cells) at concentrations ranging from 10mg/L (page 34, para 0329) to 100 mg/L (page 35, para 0331) in culture media, as recited in claim 21. Unkefer et al. also describes regeneration of transgenic plants first by inducing the callus tissue under darkness ((for different duration for different species, e.g., 1-3 weeks for wheat (page 31, para 0298, line 2); 4-6 days for switchgrass (page 32, para 308, line 8); 3 days for potato (page 34, para 0330, line 12-13)) and then transferring them to another medium under constant light at (page 30-31, para 0287) for at least 2 weeks (i.e. at least 14 days). It is known in the art that light promotes shoot and leaf induction as part of organogenesis1. Keeping any explant under specific light and/or dark cycle for specific days is an experimental design choice depending mainly on plant species and specific variety.
It would have been obvious to a person with ordinary skill in the art to modify the genome editing method of Trauterman et al. by using three different media- initially using an antibiotic free medium (“first callus induction medium”) for multiplying fewer genome-edited cells that does have its target gene edited (due to trans-acting gRNA and Cas endonuclease) but does not integrate the T-DNA transgene containing antibiotic (kanamycin) resistance genes (due to silencing of the POLQ gene) followed by the second callus induction medium that contain the selection agent (antibiotic), as taught by Unkefer et al.
Before the effective filing date, a person with ordinary skill in the art would have been motivated to use an antibiotic free medium (“first callus induction medium”) followed by the second callus induction medium that contain the selection agent (antibiotic) to develop genome edited tobacco plant, which is an important cash crop.
Claim 19 is rejected under 35 U.S.C. 103 as being unpatentable over Trauterman et al. in view of Unkefer et al. as applied to claims 1-4, 6-8, 10-13, 15-17, 21 and 23 above, and further in view of Sahoo et al. (An improved protocol for efficient transformation and regeneration of diverse indica rice cultivars, 2011, Plant Methods, 7:49).
Claim 19 depends from claim 11 and is drawn to incubating tobacco plant cells in a callus induction medium for 2 days under no light, wherein the callus induction medium comprises MS salts, 30 mg/L sucrose, 0.5-1.0 mg/L benzylaminopurine, and 0.1-0.75 mg/L NAA.
Trauterman et al. in view of Unkefer et al. describe a method for editing a genome of a tobacco plant using Agrobacterium mediated transformation while transiently silencing the POLQ gene, wherein the genome is transformed/edited without integration of T-DNA, as described above.
However, Trauterman et al. in view of Unkefer et al. do not explicitly teach incubating the tobacco plant cells in a first callus induction medium for 2 days under no light, wherein the first callus induction medium comprises MS salts, 30 mg/L sucrose, 0.5-1.0 mg/L benzylaminopurine, and 0.1-0.75 mg/L NAA.
Sahoo et al. describes a media comprising 30 g/L sucrose (page 9, right column, first para), NAA at concentrations ranging from 0.2mg/L to 0.5 mg/L (page 9, left column, para 3), and Benzylaminopurine (BAP) at concentrations ranging from 2.7mg/L (page 9, left column, last para) to 0.25 mg/L (page 9, right column, last para) to achieve efficient transformation and regeneration after agrobacterium transformation. It is known in the art that light degrades auxins, which is crucial for somatic embryogenesis (Sahoo et al., page 4, right column, para 2, line 6-9), and darkness inhibits organogenesis1 and promote undifferentiated cell growth resulting in more callus. Sahoo et al. describes proliferation of microcalli under darkness for 7 days (page 2, right column, para 1, line 13-15).
It is known that use of specific carbon source including sucrose, specific auxin source including NAA, and specific cytokinin source including BAP, and concentrations to be used to induce callus and/or subsequent organogenesis varies depending on the plant species and the variety used. Generally, differences in concentration or temperature will not support the patentability of subject matter encompassed by the prior art unless there is evidence indicating such concentration or temperature is critical (MPEP 2144.05(II)(A)). It is also known in the art that callus induction and shoot induction can be achieved simultaneously while regenerating a transformed plant from a transformed cell, implying that callus induction medium and shoot induction medium can be the same or similar without any significant variation in terms of callus induction and/or shoot regeneration. Using any specific carbon, auxin, and cytokinin source(s) and using at any specific concentration is the experimental design choice of an ordinarily skilled artisan without negatively affecting the outcome and with reasonable expectation to regenerate matured plant from a transformed plant cell.
It would have been obvious to an ordinarily skilled artisan to modify the method described by Trauterman et al. in view of Unkefer et al. by incubating the genome edited tobacco plant cells in a first callus induction medium for about 2 days under no light, wherein the first callus induction medium comprises MS salts, 30 mg/L sucrose, NAA at concentrations ranging from 0.2mg/L to 0.5 mg/L (which falls within the range of 0.1-0.75 mg/L) and Benzylaminopurine (BAP) at concentrations ranging from 0.25 mg/L to 2.7mg/L (which falls within the range of 0.5 to 1.0 mg), as described by Sahoo et al. The ordinarily skilled artisan would have been motivated to do so with a realistic goal to increase transformation and subsequent regeneration efficiency of the genome editing process and get more genome edited cells.
Claims 5 and 14 are rejected under 35 U.S.C. 103 as being unpatentable over Trauterman et al. in view of Unkefer et al. as applied to claims 1-4, 6-8, 10-13, 15-17, 21 and 23 above, and further in view of Jongedijk et al. (WO 2019234132 A1; published in 2019).
Claims 5 and 14 are dependent from claim 1 and 11, respectively, and are drawn to a method using a plasmid comprising SEQ ID NOs: 17 or a fragment thereof, or a sequence comprising at least 95% identity therewith.
Trauterman et al. in view of Unkefer et al. describe a method for editing a genome of a tobacco plant using Agrobacterium mediated transformation while transiently silencing the POLQ gene, wherein the genome is transformed/edited without integration of T-DNA, as described above.
However Trauterman et al. in view of Unkefer et al. does not describe the SEQ ID NO: 17 or a fragment thereof, or a sequence comprising at least 95% identity therewith.
Jongedijk et al. describes transient silencing of DNA POLQ (polymerase theta) function to achieve efficient inhibition of transgene integration, via using RNAi (page 36, line 4-8). It also describes a tobacco PolQ sequence comprising 100% sequence identity to the PolQ antisense sequence within instant SEQ ID NO: 17, as shown below.
RESULT 5
BHB10477/c
ID BHB10477 standard; DNA; 8026 BP.
AC BHB10477;
DT 06-FEB-2020 (first entry)
DE Nicotiana tabacum polymerase theta cDNA, SEQ 63.
KW CRISPR system; gene; genome editing; plant; polQ gene; polymerase theta;
KW ss.
OS Nicotiana tabacum.
CC PN WO2019234132-A1.
CC PD 12-DEC-2019.
CC PF 05-JUN-2019; 2019WO-EP064734.
PR 05-JUN-2018; 2018US-0680867P.
PR 30-JUL-2018; 2018US-0711747P.
PR 14-SEP-2018; 2018US-0731434P.
CC PA (KWSS-) KWS SAAT SE & CO KGAA.
CC PI Jongedijk E, Hummel A, Bartlem DG, Mei Y;
DR WPI; 2019-A37844/98.
XX
CC PT Modifying a nucleic acid molecule of a cellular system at a predetermined
CC PT location, for providing a cellular system comprises an inactivated or
CC PT partially inactivated Polymerase theta enzyme.
CC PS Example 1; SEQ ID NO 63; 77pp; English.
SQ Sequence 8026 BP; 2310 A; 1494 C; 1908 G; 2314 T; 0 U; 0 Other;
Query Match 100.0%; Score 480; Length 8026; Best Local Similarity 100.0%;
Matches 480; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GCTTATCTGAGCTTCGACTGATGTATTCCCCTCCATGACCTCAAAAGAATTTAGAGCTGC 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 852 GCTTATCTGAGCTTCGACTGATGTATTCCCCTCCATGACCTCAAAAGAATTTAGAGCTGC 793
Qy 61 ATCGTCAGAATTGGTTTTTCTGTTTATATTAGACTCGTTTTCACTCGAGATGCAGCGGAT 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 792 ATCGTCAGAATTGGTTTTTCTGTTTATATTAGACTCGTTTTCACTCGAGATGCAGCGGAT 733
Qy 121 TCTCTTTGCATGTTTATTATCCACATCAAGAATGGAAGGACTACCACTCCTTTTACTAGC 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 732 TCTCTTTGCATGTTTATTATCCACATCAAGAATGGAAGGACTACCACTCCTTTTACTAGC 673
Qy 181 ACCCTCACTCTGGGCTGAAGGTAAACTTAAACTAGCTGGCAGTTCACTGCAATATAATGA 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 672 ACCCTCACTCTGGGCTGAAGGTAAACTTAAACTAGCTGGCAGTTCACTGCAATATAATGA 613
Qy 241 CAAGAAGTTGGTAGCAAACTGCTTAAGTTCTGAGTTTCTGGTAACCTGTGCAGTAACCAA 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 612 CAAGAAGTTGGTAGCAAACTGCTTAAGTTCTGAGTTTCTGGTAACCTGTGCAGTAACCAA 553
Qy 301 GACATCTTCTCCATGACCTCTATTTTCAACAACACGTGAGTCAAGGGAAATAACAGACTT 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 552 GACATCTTCTCCATGACCTCTATTTTCAACAACACGTGAGTCAAGGGAAATAACAGACTT 493
Qy 361 CTCCTTTGAAGTTTTTGTTTCAAAAGTTGTTGAACGTGCTTTGACCAAAGAAGTACTCTC 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 492 CTCCTTTGAAGTTTTTGTTTCAAAAGTTGTTGAACGTGCTTTGACCAAAGAAGTACTCTC 433
Qy 421 TTTATTTTCATCTTTTAGATATGAACCAATTTCTAATGTCAGATTTCTCTTAACCGGTGT 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 432 TTTATTTTCATCTTTTAGATATGAACCAATTTCTAATGTCAGATTTCTCTTAACCGGTGT 373
It would have been obvious to an ordinarily skilled artisan to edit the genome of the tobacco plant by transiently silencing the POLQ gene comprising 100% sequence identity to instant SEQ ID NO: 17, as described by Jongedijk et al., wherein the genome is transformed/edited using Agrobacterium mediated transformation without integration of T-DNA, as described by Trauterman et al. in view of Unkefer et al. The artisan would have been motivated to do so with a realistic goal to develop transgene free genome edited commercially important tobacco plant.
Response to Applicant’s Arguments
The argument set forth in the Applicant’s reply on 12/22/2025 to the rejection of claims under 35 U.S.C. 103 has been fully considered but not found persuasive.
The Applicant argues, “Trauterman is essentially silent with respect to any tranfection protocols or methods that involve an Agrobacterium approach” (page 5, para 3, line 1-2) and “Trauterman is not concerned at all with avoiding T-DNA genome integration, as it is
not concerned with Agrobacterium transfection” (page 5, para 3, line 6-7). The Applicant continues to argue, “the methods of claim 1 and 11 resulted in a ~two-fold increase in T-DNA
free mutants, and even more surprising, a two-fold increase in T-DNA free homozygous gene
edited mutants. These surprising, superior results provide strong secondary evidence of
nonobviousness” (page 6, para 2).
The Examiner respectfully disagrees. Transformation methods that involve an Agrobacterium is a well-known standard process in the art and are also taught by Trauterman et al. while describing that mutant plants lacking Pol θ activity are incapable of integrating T-DNA molecules during Agrobacterium tumefaciens mediated plant transformation (page 2, para 11). Trauterman et al. describes use of RNAi to silence at least one endogenous gene and also using at least one gRNA to edit an endogenous gene which does not need introducing any T-DNA in the host genome, as discussed above. It would have been obvious to an ordinarily skilled artisan that inactivating or silencing Pol θ (Pol Q) in a host plant would minimize integration of any T-DNA mediated integration of (foreign) DNA into the host genome. Moreover, it would have been obvious to an ordinarily skilled artisan that silencing the Pol θ gene in a host plant would significantly reduce integration of any foreign DNA fragment (including the ones encoding RNAi, gRNA and Cas endonuclease) cloned in a T-DNA plasmid (binary Ti plasmid) introduced into the host cell, as described by Trauterman et al., but such reduction in T-DNA integration would not have affected expression of the RNAi, gRNA, and/or the Cas9 endonuclease encoded by the nucleotide sequences cloned within the Ti plasmid.
None of the claims recite any “surprising, (and) superior results” in view of the cited references.
The Applicant is reminded that the burden is on Applicant to establish results that are unexpected and significant. The evidence relied upon should establish "that the differences in results are in fact unexpected and unobvious and of both statistical and practical significance." Ex parte Gelles, 22 USPQ2d 1318, 1319 (Bd. Pat. App. & Inter. 1992).
Conclusion
All the claims are rejected.
Communication
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JAY CHATTERJEE whose telephone number is (703)756-1329. The examiner can normally be reached (Mon - Fri) 8.30 am to 5.30 pm..
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at (571) 270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
Jay Chatterjee
Patent Examiner
Art Unit 1662
/Jay Chatterjee/ Examiner, Art Unit 1662
/BRATISLAV STANKOVIC/ Supervisory Patent Examiner, Art Units 1661& 1662
1 Yoshida et al. (Stem cell activation by light guides plant organogenesis, 2011, Genes & Development 25:1439–1450) provides evidence that light promotes initiation of shoot apices and subsequently organogenesis (abstract), while darkness inhibits organogenesis (abstract) and promote undifferentiated cell growth resulting in more callus.