Prosecution Insights
Last updated: August 17, 2026
Application No. 18/114,014

T-DNA Free Gene Editing through Transient Suppressing POLQ in Plants

Final Rejection §103
Filed
Feb 24, 2023
Priority
Feb 24, 2022 — provisional 63/313,382
Examiner
CHATTERJEE, JAYANTA
Art Unit
1662
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
University of Florida Research Foundation Inc.
OA Round
4 (Final)
47%
Grant Probability
Moderate
5-6
OA Rounds
0m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 47% of resolved cases
47%
Career Allowance Rate
9 granted / 19 resolved
-12.6% vs TC avg
Strong +77% interview lift
Without
With
+76.9%
Interview Lift
resolved cases with interview
Typical timeline
2y 6m
Avg Prosecution
53 currently pending
Career history
72
Total Applications
across all art units

Statute-Specific Performance

§101
4.2%
-35.8% vs TC avg
§103
39.7%
-0.3% vs TC avg
§102
17.6%
-22.4% vs TC avg
§112
31.3%
-8.7% vs TC avg
Black line = Tech Center average estimate • Based on career data from 19 resolved cases

Office Action

§103
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claims Status Claims 1-8, 10-17, 19, 21 and 23 are pending and being examined. All previous objections and rejections not set forth below have been withdrawn in view of applicant’s amendments to the claims. It is noted that the instant specification does not describe SEQ ID NO: 18 but the sequence listing does include SEQ ID NO:18 and describe it as a “vector” without specifying any other characteristics. The specification on p. 19 the nucleotide sequence of SEQ ID NO: 19. However, the sequence listing does not include SEQ ID NO: 19. Claim Rejections - 35 USC § 103 Claims 1-4, 6-8, 10-13, 15-17, 21 and 23 are rejected under 35 U.S.C. 103 as being unpatentable over Trauterman et al. (US 2021/0139926 A1) in view of Unkefer et al. (US 2011/0030089 A1). Claims 1 and 11 are drawn to a method for editing a genome of a tobacco plant cell by transiently silencing the DNA polymerase Q (POLQ) enzyme in the cell, introducing a second nucleic acid sequence that encodes a genome editing system for editing a gene of interest using Agrobacterium, and without integration of any T-DNA in the plant genome. The method also comprises incubating the plant cell in a first callus induction medium, a second callus induction medium, and a shoot induction medium. Trauterman et al. describes a method of editing a genome of a plant cell by introducing at least one oligonucleotide for silencing the POLQ (also known as Pol θ) gene using RNAi/shRNA (page 16, para 0223) in corn and a second nucleotide that encodes a genome editing component (guide RNA) (page 2, para 0018; page 16, para 0223) targeting an endogenous gene by introducing specific oligos in a maize (an annual plant, as recited in claim 2) protoplast (a plant organ, as recited in claim 3) via PEG mediated transformation (page 15, para 0217). Trauterman et al. describes transiently silencing non-homologous end joining (NHEJ) and/or microhomology mediated end joining (MMEJ) pathways during the editing process in a plant (abstract) by silencing a target gene (POLQ) using RNAi (page 16, para 0223). The suppression needs to be transient so that the resulting organisms and the cells in it are still able to perform essential DNA repair functions (page 2, para 0015, right column, line 1-3). Trauterman et al. also teaches knockout mutant plants lacking POLQ activity which are incapable of integrating T-DNA molecules during Agrobacterium tumefaciens mediated plant transformation (page 2, para 11), as recited in claims 4 and 13. Even though the working example for Trauterman et al. uses PEG mediated transformation in a maize explant, Trauterman et al. states that the method is applicable to tobacco plants (page 4, para 0058), as recited in claim 12. Trauterman et al. describes highly specific site-directed nucleases (SDNs) or modified variants thereof including meganucleases, Zinc-Finger Nucleases (ZFNs), Transcription Activator Like Effector Nucleases (TALENs), and Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) nuclease-based systems that introduce double-strand breaks (DSBs), or single-strand nicks or breaks, or targeted base pair exchanges (page 1, para 0005), as recited in claims 6-7 and 15-16. Trauterman et al. describes introducing genetic modifications in the endogenous HMG transcription factor (ZmHMG13) by introducing a guide RNA (crRNA) as part of the CRISPR/Cas system in the cell (page 14, para 0215; page 16, para 0223), satisfying the claim limitations of claims 8 and 17. However, Trauterman et al. does not explicitly teach two different callus induction media and a shoot induction medium. Unkefer et al. describes developing callus on MS media (without having any antibiotic) from which the transformed plantlets would emerge (page 17, para 0166, line 1-2). The MS media taught by Unkefer et al. is interpreted as “first callus induction media”, as recited in claims 1 and 11. Unkefer et al. also describes regeneration of transgenic plants by incubating the callus tissue onto a second selection medium containing kanamycin (page 17, para 0166, line 3-5), as recited in claim 10 (and claims 1 and 11). The second selection medium containing kanamycin from Unkefer et al. is interpreted as “second callus induction medium” as recited in instant claims 1 and 11. Unkefer et al. also teaches transferring the antibiotic-resistant callus to a shoot induction medium (page 31, para 0292, line 4-5; page 34, para 0331), as recited in claims 1, 11, and 23. It is known in the art that callus induction and shoot induction can be achieved simultaneously while regenerating a plant from a transformed cell, implying that callus induction medium and shoot induction medium can be the same or similar. Unkefer et al. describes use of Timentin (to repress/kill Agrobacterium) (p.32, para 9308, line 2-10). Timentin has no influence on selecting transgenic cells) at concentrations ranging from 50 mg/L (page 33, para 0318) to (100mg/L) (page 33, para 0316) and Kanamycin (used as a selection agent for transgenic cells) at concentrations ranging from 10mg/L (page 34, para 0329) to 100 mg/L (page 35, para 0331) in culture media, as recited in claim 21. Unkefer et al. also describes regeneration of transgenic plants first by inducing the callus tissue under darkness ((for different duration for different species, e.g., 1-3 weeks for wheat (page 31, para 0298, line 2); 4-6 days for switchgrass (page 32, para 308, line 8); 3 days for potato (page 34, para 0330, line 12-13)) and then transferring them to another medium under constant light at (page 30-31, para 0287) for at least 2 weeks (i.e. at least 14 days). It is known in the art that light promotes shoot and leaf induction as part of organogenesis1. Keeping any explant under specific light and/or dark cycle for specific days is an experimental design choice depending mainly on plant species and specific variety. It would have been obvious to a person with ordinary skill in the art to modify the genome editing method of Trauterman et al. by using three different media- initially using an antibiotic free medium (“first callus induction medium”) for multiplying fewer genome-edited cells that does have its target gene edited (due to trans-acting gRNA and Cas endonuclease) but does not integrate the T-DNA transgene containing antibiotic (kanamycin) resistance genes (due to silencing of the POLQ gene) followed by the second callus induction medium that contain the selection agent (antibiotic), as taught by Unkefer et al. Before the effective filing date, a person with ordinary skill in the art would have been motivated to use an antibiotic free medium (“first callus induction medium”) followed by the second callus induction medium that contain the selection agent (antibiotic) to develop genome edited tobacco plant, which is an important cash crop. Claims 5 and 14 are rejected under 35 U.S.C. 103 as being unpatentable over Trauterman et al. in view of Unkefer et al. as applied to claims 1-4, 6-8, 10-13, 15-17, 21 and 23 above, and further in view of Jongedijk et al. (WO 2019234132 A1; published in 2019). Claims 5 and 14 are dependent from claim 1 and 11, respectively, and are drawn to a method using a plasmid comprising SEQ ID NOs: 17 or a fragment thereof, or a sequence comprising at least 95% identity therewith. Trauterman et al. in view of Unkefer et al. describe a method for editing a genome of a tobacco plant using Agrobacterium mediated transformation while transiently silencing the POLQ gene, wherein the genome is transformed/edited without integration of T-DNA, as described above. However Trauterman et al. in view of Unkefer et al. does not describe SEQ ID NO: 19 (i.e., base pairs 914-1193 of SEQ ID NO 17). Jongedijk et al. describes transient silencing of DNA POLQ (polymerase theta) function to achieve efficient inhibition of transgene integration, via using RNAi (page 36, line 4-8). It also describes a tobacco PolQ sequence comprising 100% sequence identity to the PolQ antisense sequence within instant SEQ ID NO: 17 (i.e., SEQ ID NO: 19), as shown below. RESULT 5 BHB10477/c ID BHB10477 standard; DNA; 8026 BP. AC BHB10477; DT 06-FEB-2020 (first entry) DE Nicotiana tabacum polymerase theta cDNA, SEQ 63. KW CRISPR system; gene; genome editing; plant; polQ gene; polymerase theta; KW ss. OS Nicotiana tabacum. CC PN WO2019234132-A1. CC PD 12-DEC-2019. CC PF 05-JUN-2019; 2019WO-EP064734. PR 05-JUN-2018; 2018US-0680867P. PR 30-JUL-2018; 2018US-0711747P. PR 14-SEP-2018; 2018US-0731434P. CC PA (KWSS-) KWS SAAT SE & CO KGAA. CC PI Jongedijk E, Hummel A, Bartlem DG, Mei Y; DR WPI; 2019-A37844/98. XX CC PT Modifying a nucleic acid molecule of a cellular system at a predetermined CC PT location, for providing a cellular system comprises an inactivated or CC PT partially inactivated Polymerase theta enzyme. CC PS Example 1; SEQ ID NO 63; 77pp; English. SQ Sequence 8026 BP; 2310 A; 1494 C; 1908 G; 2314 T; 0 U; 0 Other; Query Match 100.0%; Score 480; Length 8026; Best Local Similarity 100.0%; Matches 480; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GCTTATCTGAGCTTCGACTGATGTATTCCCCTCCATGACCTCAAAAGAATTTAGAGCTGC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 852 GCTTATCTGAGCTTCGACTGATGTATTCCCCTCCATGACCTCAAAAGAATTTAGAGCTGC 793 Qy 61 ATCGTCAGAATTGGTTTTTCTGTTTATATTAGACTCGTTTTCACTCGAGATGCAGCGGAT 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 792 ATCGTCAGAATTGGTTTTTCTGTTTATATTAGACTCGTTTTCACTCGAGATGCAGCGGAT 733 Qy 121 TCTCTTTGCATGTTTATTATCCACATCAAGAATGGAAGGACTACCACTCCTTTTACTAGC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 732 TCTCTTTGCATGTTTATTATCCACATCAAGAATGGAAGGACTACCACTCCTTTTACTAGC 673 Qy 181 ACCCTCACTCTGGGCTGAAGGTAAACTTAAACTAGCTGGCAGTTCACTGCAATATAATGA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 672 ACCCTCACTCTGGGCTGAAGGTAAACTTAAACTAGCTGGCAGTTCACTGCAATATAATGA 613 Qy 241 CAAGAAGTTGGTAGCAAACTGCTTAAGTTCTGAGTTTCTGGTAACCTGTGCAGTAACCAA 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 612 CAAGAAGTTGGTAGCAAACTGCTTAAGTTCTGAGTTTCTGGTAACCTGTGCAGTAACCAA 553 Qy 301 GACATCTTCTCCATGACCTCTATTTTCAACAACACGTGAGTCAAGGGAAATAACAGACTT 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 552 GACATCTTCTCCATGACCTCTATTTTCAACAACACGTGAGTCAAGGGAAATAACAGACTT 493 Qy 361 CTCCTTTGAAGTTTTTGTTTCAAAAGTTGTTGAACGTGCTTTGACCAAAGAAGTACTCTC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 492 CTCCTTTGAAGTTTTTGTTTCAAAAGTTGTTGAACGTGCTTTGACCAAAGAAGTACTCTC 433 Qy 421 TTTATTTTCATCTTTTAGATATGAACCAATTTCTAATGTCAGATTTCTCTTAACCGGTGT 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 432 TTTATTTTCATCTTTTAGATATGAACCAATTTCTAATGTCAGATTTCTCTTAACCGGTGT 373 It would have been obvious to an ordinarily skilled artisan to edit the genome of the tobacco plant by transiently silencing the POLQ gene comprising 100% sequence identity to SEQ ID NO: 19 comprising base pairs 914-1193 of SEQ ID NO 17, as described by Jongedijk et al., wherein the genome is transformed/edited using Agrobacterium mediated transformation without integration of T-DNA, as described by Trauterman et al. in view of Unkefer et al. The artisan would have been motivated to do so with a realistic goal to develop transgene free genome edited commercially important tobacco plant. Claim 19 is rejected under 35 U.S.C. 103 as being unpatentable over Trauterman et al. in view of Unkefer et al. as applied to claims 1-4, 6-8, 10-13, 15-17, 21 and 23 above, and further in view of Sahoo et al. (An improved protocol for efficient transformation and regeneration of diverse indica rice cultivars, 2011, Plant Methods, 7:49). Claim 19 depends from claim 11 and is drawn to incubating tobacco plant cells in a callus induction medium for 2 days under no light, wherein the callus induction medium comprises MS salts, 30 mg/L sucrose, 0.5-1.0 mg/L benzylaminopurine, and 0.1-0.75 mg/L NAA. Trauterman et al. in view of Unkefer et al. describe a method for editing a genome of a tobacco plant using Agrobacterium mediated transformation while transiently silencing the POLQ gene, wherein the genome is transformed/edited without integration of T-DNA, as described above. However, Trauterman et al. in view of Unkefer et al. do not explicitly teach incubating the tobacco plant cells in a first callus induction medium for 2 days under no light, wherein the first callus induction medium comprises MS salts, 30 mg/L sucrose, 0.5-1.0 mg/L benzylaminopurine, and 0.1-0.75 mg/L NAA. Sahoo et al. describes a media comprising 30 g/L sucrose (page 9, right column, first para), NAA at concentrations ranging from 0.2mg/L to 0.5 mg/L (page 9, left column, para 3), and Benzylaminopurine (BAP) at concentrations ranging from 2.7mg/L (page 9, left column, last para) to 0.25 mg/L (page 9, right column, last para) to achieve efficient transformation and regeneration after agrobacterium transformation. It is known in the art that light degrades auxins, which is crucial for somatic embryogenesis (Sahoo et al., page 4, right column, para 2, line 6-9), and darkness inhibits organogenesis1 and promote undifferentiated cell growth resulting in more callus. Sahoo et al. describes proliferation of microcalli under darkness for 7 days (page 2, right column, para 1, line 13-15). It is known that use of specific carbon source including sucrose, specific auxin source including NAA, and specific cytokinin source including BAP, and concentrations to be used to induce callus and/or subsequent organogenesis varies depending on the plant species and the variety used. Generally, differences in concentration or temperature will not support the patentability of subject matter encompassed by the prior art unless there is evidence indicating such concentration or temperature is critical (MPEP 2144.05(II)(A)). It is also known in the art that callus induction and shoot induction can be achieved simultaneously while regenerating a transformed plant from a transformed cell, implying that callus induction medium and shoot induction medium can be the same or similar without any significant variation in terms of callus induction and/or shoot regeneration. Using any specific carbon, auxin, and cytokinin source(s) and using at any specific concentration is the experimental design choice of an ordinarily skilled artisan without negatively affecting the outcome and with reasonable expectation to regenerate matured plant from a transformed plant cell. It would have been obvious to an ordinarily skilled artisan to modify the method described by Trauterman et al. in view of Unkefer et al. by incubating the genome edited tobacco plant cells in a first callus induction medium for about 2 days under no light, wherein the first callus induction medium comprises MS salts, 30 mg/L sucrose, NAA at concentrations ranging from 0.2mg/L to 0.5 mg/L (which falls within the range of 0.1-0.75 mg/L) and Benzylaminopurine (BAP) at concentrations ranging from 0.25 mg/L to 2.7mg/L (which falls within the range of 0.5 to 1.0 mg), as described by Sahoo et al. The ordinarily skilled artisan would have been motivated to do so with a realistic goal to increase transformation and subsequent regeneration efficiency of the genome editing process and get more genome edited cells. Response to Applicant’s Arguments The argument set forth in the Applicant’s reply on 5/22/2026 to the rejection of claims under 35 U.S.C. 103 has been fully considered but not found persuasive. The Applicant argues, “the Trauterman reference describes a single nucleic acid cassette rather than two separate nucleic acid sequences…. The present invention claims two nucleic acids, one with a POLQ-silencing sequence and the other with a genome editing system” (response, bridging paragraph between p. 6-7). The Applicant continues to argue that the single cassette described by Trauterman “contains an RNAi component, a CRISPR guide RNA, and also an RNA activating unit, and are placed together purposely in order to deliver the nucleic acids in "a concerted manner" to the cell to suppress NHEJ and MMEJ; … while the instant “invention, on the other hand, uses two cassettes: CRISPR-Cas9 and an RNAi cassette to suppress POLQ, and NHEJ and MMEJ are not suppressed” (response, p.7. para 2). The Applicant alleges, “Unkefer does not specify the media to be used for the step of contacting the nucleic acids with the Agrobacterium (response, p.7, para 3, line 4-5). Regarding rejection of claim 19 under 35 U.S.C. §103, the Applicant argues, “in Sahoo, after infection the calli are cocultivated (the contacting step) in Sahoo's MCCM and then the calli are washed with cefotaxime. See Figure 3 of Sahoo. This ends the contacting step since the Agrobacterium are washed away. Next, the calli are transferred to other media in defined steps…. The steps of the present invention recite that the contacting is performed under conditions that comprise three different media (response, p.8, para 5). The Examiner disagrees. Trauterman reference describes several nucleic acid sequences including at least one oligonucleotide for silencing the POLQ gene, at least one polynucleotide sequence encoding the gRNA(s), and a Cas endonuclease Cpf1 (also known as Cas12a) (p. 8, para 0110, line 1-3; p. 14, para 0213, line 4). All the components are cloned in one expression vector. Instant claims do not recite any limitation to restrict number of vectors/cassettes that the nucleic acid sequences encoding different components. Moreover, such components act in “trans” and, thus, can be cloned in one or more than one expression vector(s) without affecting the outcome. Suppression of NHEJ and/or MMEJ is not a limitation required by any of the instant claims. The step of contacting the plasmid vector(s) comprising specific polynucleotide sequence(s) in an Agrobacterium vector is a well-known and routine process in the art. Moreover, Unkefer et al. describes the media (viz. infection media) to be used for the step of contacting the nucleic acids being expressed in an Agrobacterium vector by keeping the explants covered by the infection media (p. 33, para 0315; p. 33, para 0312, line 15-17; p.34, para 0323, line 2-5). Regarding claims 1, 11 and 19, Claim 19 depends from claim 11 while claims 1 and 11 recites “… wherein the conditions comprise incubating the plant cell in a first callus induction medium, a second callus induction medium, and a shoot induction medium”. The claims do not require the “contacting the plant cell with an Agrobacterium” to occur in any of the three media recited. Conclusion All the claims are rejected. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Communication Any inquiry concerning this communication or earlier communications from the examiner should be directed to JAY CHATTERJEE whose telephone number is (703)756-1329. The examiner can normally be reached (Mon - Fri) 8.30 am to 5.30 pm.. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at (571) 270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. Jay Chatterjee Patent Examiner Art Unit 1662 /Jay Chatterjee/ Examiner, Art Unit 1662 /BRATISLAV STANKOVIC/Supervisory Patent Examiner, Art Units 1661 & 1662 1 Yoshida et al. (Stem cell activation by light guides plant organogenesis, 2011, Genes & Development 25:1439–1450) provides evidence that light promotes initiation of shoot apices and subsequently organogenesis (abstract), while darkness inhibits organogenesis (abstract) and promote undifferentiated cell growth resulting in more callus.
Read full office action

Prosecution Timeline

Show 2 earlier events
Jul 30, 2025
Response Filed
Sep 22, 2025
Final Rejection mailed — §103
Dec 22, 2025
Response after Non-Final Action
Jan 22, 2026
Request for Continued Examination
Jan 28, 2026
Response after Non-Final Action
Feb 23, 2026
Non-Final Rejection mailed — §103
May 22, 2026
Response Filed
Jun 22, 2026
Final Rejection mailed — §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12703870
REGULATION OF ROOT DEVELOPMENT
2y 2m to grant Granted Aug 11, 2026
Patent 12662514
METHODS TO BLOCK APHID TRANSMISSION OF POLEROVIRUSES AND TO DEVELOP VIRUS MANAGEMENT TOOLS
3y 6m to grant Granted Jun 23, 2026
Patent 12649926
USE OF MfERF026 GENE REGULATION IN GROWTH, DEVELOPMENT, AND STRESS TOLERANCE OF MEDICAGO SATIVA
2y 1m to grant Granted Jun 09, 2026
Patent 12642203
TOMATO PLANTS RESISTANT TO TOBRFV, TMV, TOMV AND TOMMV AND CORRESPONDING RESISTANCE GENES
2y 12m to grant Granted Jun 02, 2026
Patent 12635627
PLANTS RESISTANT TO INFECTION BY PEPINO MOSAIC VIRUS
2y 5m to grant Granted May 26, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

5-6
Expected OA Rounds
47%
Grant Probability
99%
With Interview (+76.9%)
2y 6m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 19 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month