Examiner of Record
The Examiner of record has changed.
DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Amendments
This action is in response to papers filed 26th Feb 2026 in which claim 1, 12, 17-20 were amended, claims 3-4 were canceled, and no claims added. All of the amendments have been thoroughly reviewed and entered.
Any rejection or objection not reiterated herein has been overcome by amendment.
New §112a rejections not necessitated by amendment have been made in this office action.
Status of the Claims
Accordingly, claims 1-2 and 5-20 are being examined.
Drawings
The drawings are objected to as failing to comply with 37 CFR 1.84(u)(1) because:
i) the labels for Figures 1 - 10 are preceded by the word "Figure" instead of the abbreviation "FIG.". MPEP §608.02.V states that according to 37 C.F.R. 1.84(u)(1) “View numbers must be preceded by the abbreviation "FIG.".
AND
ii) Figure 5C has images of two Western blots, both of which have the same labels. The legend to this figure in the specification says: (Fig. 5C) Western blot analyses were performed to determine if TuD-181 influences the expression of human aSyn transgene in SN or striatal tissues.
However, the Figure does not indicate which row represents SN and which row represents striatal tissue.
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Specification
Title
The title of the invention is not descriptive. A new title is required that is clearly indicative of the invention to which the claims are directed.
The following title is suggested: MICRORNA-181 INHIBITOR SYSTEM AND METHODS OF USE THEREOF
The disclosure is objected to because of the following informalities: Figure 6 appears to be critical for understanding the invention. The description of Figure 6 refers to color differences between groups. See below:
PNG
media_image1.png
200
400
media_image1.png
Greyscale
The Figures presented are not in color so as to make sense of this description.
On top of pg. 25, Line 4 of the specification, the following is seen: for miR-18 1a/b 12-14.
It is not clear what the numbers 12-14 refer to.
Appropriate correction is required.
New Claim Rejections Follow
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 1-2, 5-6 and 8 are rejected under 35 U.S.C. § 101 because the claimed invention is directed to judicial exception (i.e., a law of nature, natural phenomenon, or an abstract idea) without significantly more. The claims are drawn to an antisense oligonucleotide (ASO) comprising a nucleotide sequence of 10 to 30 nucleotides in length that is complementary to a nucleic acid sequence within an angiopoietin like 2 (LHX-2-7) transcript. As outlined below, this judicial exception is not integrated into a practical application, and does not include additional elements that are sufficient to amount to significantly more than the judicial exception.
Subject Matter Eligibility Test for Products and Processes – Claims 1 and 7
Step 1 – Is the Claim to a Process, Machine, Manufacture, or Composition of Matter? YES
Claim 1 is directed to an inhibitory molecule that is RNA, which is a composition of matter. Claim 7 is directed to a nucleic acid that encodes the inhibitory molecule that is RNA. Therefore claim 7 is directed to DNA, which is a composition of matter. Thus, the claims are directed to a statutory category.
Step 2A, Prong One – Does the Claim Recite an Abstract Idea, Law of Nature, or Natural Phenomenon? YES
Laws of nature and natural phenomena, as identified by the courts, include naturally occurring principles/relations and nature-based products that are naturally occurring or that do not have markedly different characteristics compared to what occurs in nature. MPEP 2106.04(c) outlines the markedly different characteristics analysis.
Claim 1 is directed to an inhibitory molecule which is RNA, that inhibits miR-181 and has at least 95% identity to SEQ ID NO: 4. Claim 7 is directed to a DNA sequence that encodes the inhibitory RNA. No limiting definition of the inhibitory molecule is provided. The closest naturally-occurring counterpart to the claimed inhibitory molecule and the DNA that encodes it is a portion of Homo sapiens piRNA piR-37304.
RESULT 23
DQ599238
LOCUS DQ599238 30 bp RNA linear PRI 02-DEC-2008
DEFINITION Homo sapiens piRNA piR-37304, complete sequence.
ACCESSION DQ599238
VERSION DQ599238.1
KEYWORDS .
SOURCE Homo sapiens (human)
ORGANISM Homo sapiens
Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi;
Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini;
Catarrhini; Hominidae; Homo.
REFERENCE 1 (bases 1 to 30)
AUTHORS Girard,A., Sachidanandam,R., Hannon,G.J. and Carmell,M.A.
TITLE A germline-specific class of small RNAs binds mammalian Piwi
proteins
JOURNAL Nature 442 (7099), 199-202 (2006)
PUBMED 16751776
REFERENCE 2 (bases 1 to 30)
AUTHORS Girard,A., Sachidanandam,R., Hannon,G.J. and Carmell,M.A.
TITLE Direct Submission
JOURNAL Submitted (12-MAY-2006) Cold Spring Harbor Laboratory, 1 Bungtown
Road, Cold Spring Harbor, NY 11724, USA
FEATURES Location/Qualifiers
source 1..30
/organism="Homo sapiens"
/mol_type="transcribed RNA"
/db_xref="taxon:9606"
ncRNA 1..30
/ncRNA_class="piRNA"
/product="piR-37304"
ORIGIN
Query Match 100.0%; Score 10; Length 30;
Best Local Similarity 100.0%;
Matches 10; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GTTGAATGTT 10
||||||||||
Db 15 GTTGAATGTT 24
MPEP 2106.04(c)(II)(C)(1) provides an exemplary analysis relevant to the instant claims:
“In Ambry Genetics, the court identified claimed DNA fragments known as “primers” as products of nature, because they lacked markedly different characteristics. University of Utah Research Foundation v. Ambry Genetics Corp., 774 F.3d 755, 113 USPQ2d 1241 (Fed. Cir. 2014). The claimed primers were single-stranded pieces of DNA, each of which corresponded to a naturally occurring double-stranded DNA sequence in or near the BRCA genes. The patentee argued that these primers had markedly different structural characteristics from the natural DNA, because the primers were synthetically created and because “single-stranded DNA cannot be found in the human body”. The court disagreed, concluding that the primers’ structural characteristics were not markedly different than the corresponding strands of DNA in nature, because the primers and their counterparts had the same genetic structure and nucleotide sequence. 774 F.3d at 760, 113 USPQ2d at 1243-44. The patentee also argued that the primers had a different function than when they are part of the DNA strand because when isolated as a primer, a primer can be used as a starting material for a DNA polymerization process. The court disagreed, because this ability to serve as a starting material is innate to DNA itself, and was not created or altered by the patentee:
In fact, the naturally occurring genetic sequences at issue here do not perform a significantly new function. Rather, the naturally occurring material is used to form the first step in a chain reaction--a function that is performed because the primer maintains the exact same nucleotide sequence as the relevant portion of the naturally occurring sequence. One of the primary functions of DNA’s structure in nature is that complementary nucleotide sequences bind to each other. It is this same function that is exploited here--the primer binds to its complementary nucleotide sequence. Thus, just as in nature, primers utilize the innate ability of DNA to bind to itself.
Ambry Genetics, 774 F.3d at 760-61, 113 USPQ2d at 1244. In sum, because the characteristics of the claimed primers were innate to naturally occurring DNA, they lacked markedly different characteristics from nature and were thus product of nature exceptions. A similar result was reached in Marden, where the court held a claim to ductile vanadium ineligible, because the “ductility or malleability of vanadium is . . . one of its inherent characteristics and not a characteristic given to it by virtue of a new combination with other materials or which characteristic is brought about by some chemical reaction or agency which changes its inherent characteristics”. In re Marden, 47 F.2d 958, 959, 18 CCPA 1057, 1060, 8 USPQ 347, 349 (CCPA 1931).” (emphasis added).
The claimed inhibitory molecule (instant SEQ ID NO:4) requires a nucleotide sequence 10nts in length which is complementary to a sequence within a miR-181 transcript. The naturally-occurring Homo sapiens piRNA piR-37304 is 100% identical to instant SEQ ID NO:4. Thus, a portion of Homo sapiens piRNA piR-37304 meets the structural requirements of the claimed instant SEQ ID NO:4, and the DNA that encodes the piRNA meets the structural requirements of the DNA that encodes it; i.e., claim 7.
As noted in the example in MPEP 2106.04(c)(II)(C)(1) above, attention must also be paid to the functional characteristics of the claimed oligonucleotides. Based on the BRI, the term “inhibitory molecule” reads on a nucleic acid, which by virtue of its nucleotide sequence, performs the function of hybridizing to, and inhibiting expression of miR-181. The portions of Homo sapiens piRNA piR-37304 meets the structural requirements for the sequence of the claimed inhibitory molecule, and therefore, are presumed to inherently have the same functional characteristics as the claimed inhibitory molecule. Accordingly, the claimed inhibitory molecule is not markedly different from its naturally occurring counterpart – a portion of the Homo sapiens piRNA piR-37304. Thus, claim 1 and claim 7 recite a product of nature judicial exception.
Step 2A, Prong Two – Does the Claim Recite Additional Elements that Integrate the Judicial Exception into a Practical Application? NO
The Supreme Court has long distinguished between principles themselves, which are not patent eligible, and the integration of those principles into practical applications, which are patent eligible. The phrase "integration into a practical application" requires an additional element or a combination of additional elements in the claim to apply, rely on, or use the judicial exception in a manner that imposes a meaningful limit on the judicial exception, such that it is more than a drafting effort designed to monopolize the exception.
In the instant case, neither claim 1 nor claim 7 recite any elements in addition to the judicial exception (i.e., natural product) that would integrate the natural product into a practical application.
Step 2B – Does the Claim Recite Additional Elements that Amount to Significantly More than the Judicial Exception? NO
The Supreme Court has identified a number of considerations for determining whether a claim with additional elements amounts to "significantly more" than the judicial exception(s) itself. The claim as a whole is evaluated as to whether it amounts to significantly more than the recited exception, i.e., whether any additional element, or combination of additional elements, adds an inventive concept to the claim (MPEP 2106.05).
As stated above, neither claim 1 nor claim 7 recite any elements in addition to the judicial exception (i.e., natural product). There are no additional elements to amount to significantly more than the judicial exception.
Dependent Claims – Claims 2, 5-6 and 8
The dependent claims do not recite any additional elements that change the nature of the recited sequence and make it markedly different from the naturally-occurring counterpart, and so recite a judicial exception without additional elements which integrate the judicial exception into a practical application, or amount to significantly more than the judicial exception.
Therefore claims 1-2, 5-6 and 8 are rejected under 35 U.S.C. § 101 because they are directed to a judicial exception.
35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1-2 and 5-20 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding claim 1, the newly amended phrase " wherein the inhibitory molecule is RNA and the RNA has at least 95% identity to SEQ ID NO:1 (TuD-181), SEQ ID NO:2, SEQ ID NO:3 or SEQ ID NO:4." in claim 1 renders the claim indefinite because it is not clear if the parenthetical recitation of TuD-181, which refers to Tough Decoy (bottom of pg. 6), is limited to SEQ ID NO: 1 or all sequences recited. The specification discloses in pg. 7 that sequence of the mature expressed inhibitor, TuD-181, is SEQ ID NO: 1. Then goes on to state: In certain embodiments, the present invention provides an inhibitory molecule that inhibits miR-181. In certain embodiments, the inhibitor is one of the following anti-miR sequences: of SEQ ID NO: 2 and SEQ ID NO: 3 and SEQ ID NO: 4. Thus, one of ordinary skill in the art would think of SEQ ID NO: 2 and SEQ ID NO: 3 and SEQ ID NO: 4 as also being TuD-181. The experiments state administration of TuD-181, without reference to sequence. Thus, one of skill would not be reasonably apprised of the scope of the invention.
Clarification is required.
Regarding claims 17-19, claims 17-19 are indefinite in the recitation of “at least about”. The phrase “at least” typically indicates a minimum / maximum point; however, the phrase “at least” is controverted by the term “about,” which implies that values above and below the indicated amount are permitted. Therefore, the juxtaposition of these two terms makes it unclear what min / maximum values are encompassed by the claim.
In Amgen, Inc. v. Chugai Pharmaceutical co., 927 F.2d 1200 (CAFC 1991), the CAFC stated, “[t]he district court held claims 4 and 6 of the patent invalid because their specific activity of “at least about 160,000” was indefinite.” After review, the CAFC states “[w]e therefore affirm the district court' s determination on this issue.” Thus, the CAFC found the phrase “at least about” indefinite where the metes and bounds of the term were not defined in the specification. The phrase “less than about” is therefore also deemed indefinite.
See MPEP 2173.05(b) III.
Those claims identified in the statement of rejection but not explicitly referenced in the rejection are also rejected for depending from a rejected claim but failing to remedy the indefiniteness therein.
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1, 5, and 7-20 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claims contain subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
MPEP 2163.II.A3.(a).(i) states the following:
“The written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the inventor was in possession of the claimed genus.”
Satisfactory disclosure of a "representative number" depends on whether one of skill in the art would recognize that the inventor was in possession of the necessary common attributes or features possessed by the members of the genus in view of the species disclosed. For inventions in an unpredictable art, adequate written description of a genus which embraces widely variant species cannot be achieved by disclosing only one species within the genus. See, e.g., Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406. Instead, the disclosure must adequately reflect the structural diversity of the claimed genus, either through the disclosure of sufficient species that are "representative of the full variety or scope of the genus," or by the establishment of "a reasonable structure-function correlation." Such correlations may be established "by the inventor as described in the specification," or they may be "known in the art at the time of the filing date.” See AbbVie, 759 F.3d at 1300-01, 111 USPQ2d 1780, 1790-91 (Fed. Cir. 2014).”
Written Description Rejection
Claim 1 recites “An inhibitory molecule that inhibits miR-181, wherein the inhibitory molecule is RNA and the RNA has at least 95% identity to SEQ ID NO:1 (TuD-181), SEQ ID NO:2, SEQ ID NO:3 or SEQ ID NO:4.” Claims 5, 17, and 19 recite similar language.
Species Encompassed
SEQ ID NO: 1 is 113 nucleotides in length. A sequence that comprises 95-100% of SEQ ID NO: 1 includes a large genus of sequences comprising nucleotide sequences that may be ≤5% different from SEQ ID NO: 1; i.e., 5 nucleotides could be different. Furthermore, a nucleotide sequence could be or have:
up to 5% of the nucleotides removed from SEQ ID NO: 1;
a single chunk comprising ≤5% of the nucleotides different from SEQ ID NO: 1;
every 20th nucleotide (starting at any position) different from SEQ ID NO: 1;
every 20th nucleotide (starting at any position) removed from SEQ ID NO: 1;
any other combination of nucleotides mutated or removed as long as the total adds up to ≤5% of total nucleotides.
Each of those categories comprises a broad subgenus with diverse members and different structures that affect their functions. Some of those structures may have altered miRNA activity, altered ability to hybridize with a target, or other altered function(s).
Although the specification discloses what the SEQ ID NO is intended for, it does not teach any core structure that is responsible for the function of binding to miR-181a, miR-181b, miR-181c, and miR-181d, as recited in claim 2. It does not teach what stretch of contiguous nucleotides must be retained. It does not teach which 5% of nucleotides may or may not be altered for the TuD-181 to function. It does not teach which 95% of nucleotides must be present or must not be altered for the TuD-181 to function. It does not teach the portion of the sequence necessary to carry out those functions. Although the specification teaches what SEQ ID NO: 1 is in terms of their functional characteristic, the functional characteristic is not coupled with a known structure.
The specification has not adequately described the genus of sequences for these reasons.
Species Disclosed in the Specification
The specification states one sequence in the genus – SEQ ID NO: 1 which is “The sequence of the mature expressed inhibitor, TuD-181”(top of pg. 7).
Function associated with Species Disclosed in the Specification
The function for SEQ ID NO: 1 disclosed in pg. 7 of the specification is in the form of embodiments. E.g., the spec states: In certain embodiments, the present invention provides an inhibitory molecule that inhibits miR-181. In certain embodiments, the inhibitor is one of the following anti-miR sequences: of SEQ ID NO: 2 and SEQ ID NO: 3 and SEQ ID NO: 4. In certain embodiments, the RNA has at least 95%, 96%, 97%, 98%, 99% or 100% identity to any one of SEQ ID NO: 1 (TuD-181 ). The sequences of TuD-181 may be complementary to a sequence of miR-181” (pg. 5, description of Fig. 6). The specification does not disclose any further embodiments of species within the genus of 95% identity to SEQ ID NO: 1. The spec discloses, the miR-181 family includes four members: miR-181a, -181b, -181c, and -181d, some of which are duplicated throughout the genome (pg. 43). The miR- miR-181a, -181b, -181c, and -181d family is highly-enriched for expression in the nervous system with highest levels in post-mitotic neurons (including DA neurons), particularly for miR-18 1a/b 12-14 (top of pg. 25). Thus, the specification gives the impression that a sequence of the inhibitor of the invention binds to all miR-181 family members (miR-181a/b/c/d). … The specification discloses promoter-driven expression cassette that results in sustained intracellular production of TuD; in vivo tissue targeting by AAV delivery system, Figs. 2D, 5; MiR-181 suppression in SN, spec: Figs. 2F, 5A-5D; retinal degeneration, Fig. 10.
Thus, the specification does not actually describe I) what regions of SEQ ID NO: 1 are complementary to miR-181, II) how many sequences of nucleic acids that target miR-181 are in SEQ ID NO: 1, or III) how SEQ ID NO: 1 may bind to, and which family member of, miR-181 (to inactivate miR-181).
Further, 1) An ABSS search of SEQ ID NO: 1 failed to uncover any hits to facilitate identification of the anti-miRNA-encoding sequences therein; and 2) An alignment between SEQ ID NO: 1 and miR-181 a/b sequences uncovered minimal regions of identity between SEQ ID NO: 1 and its intended target. See alignment I:
instant SEQ 1 aligns so with miR181b:
miRbase/c
Query Match 14.7%; Score 16.6; DB 1; Length 23;
Best Local Similarity 82.6%;
Matches 19; Conservative 0; Mismatches 4; Indels 0; Gaps 0;
Qy 20 ACTCACCGACAAAGATGAATGTT 42
|| |||||||| |||||||||
Db 23 ACCCACCGACAGCAATGAATGTT 1
instant SEQ 1 aligns so with miR181a:
miR181a/c
Query Match 18.8%; Score 21.2; DB 1; Length 87;
Best Local Similarity 88.5%;
Matches 23; Conservative 0; Mismatches 3; Indels 0; Gaps 0;
Qy 19 AACTCACCGACAAAGATGAATGTTCA 44
|||||||||||| | ||||||||||
Db 37 AACTCACCGACAGCGTTGAATGTTCA 12
Based on this alignment alone, the identity and location of anti-miRNA-encoding sequences in SEQ ID NO: 1 remain elusive.
Because the specification does not describe the locations of the anti-miRNA-encoding sequences, in SEQ ID NO: 1, there is no guidance for the skilled artisan to prepare a TuD with less than 100% identity to SEQ ID NO: 1 that retains the claimed function; i.e., “binds to miR-181 family members”.
Species Not Disclosed in the Specification
As discussed above species less than 100% identity to SEQ ID NO: 1 are not described. Similar considerations can be made for the remaining sequences, SEQ ID NO: 2/3/4, recited in the claims. The remaining recited sequences are contained within SEQ ID NO: 1. Further, the experiments state administration of TuD-181, without reference to sequence. Therefore, it isn’t evident if SEQ ID NO: 2/3/4 are administered and have directly bind to the target of these sequences are generated post-processing in the cell. This information is necessary for one of skill in the art to make a sequence at least 95% or 99% identical to SEQ ID NO: 1/2/3/4 that will bind its target mir-181 family member.
Guidance Provided by the Art
O’Brien teaches that functional miRNAs bind with full or partial complementarity to their target mRNAs; partially complementary miRNAs pair with their target mRNAs via the 5’ “seed region” at nucleotides 2-8 (O’Brien et al., Frontiers in Endocrinology, VOL 9, 2018, pg. 1-2). Thus, in the case of instant, the “missing” first or last 5 nucleotides, or up to 5 non-identical nucleotides could disrupt regions of complementarity that are essential for anti-miRNA function, e.g., the 5’ seed region. It is not predictable based on the singular species disclosed in the specification, or the level of guidance provided in the specification, that a skilled artisan could prepare an anti-miR with less than 100% identity to SEQ ID NO: 1 and retain the claimed function of binding to mir-181 family members.
In summary, the specification describes a single species within the claimed genus – a sequence consisting of SEQ ID NO: 1. The specification does not provide predictability for sequences I) with less than 100% identity to SEQ ID NO: 1 and II) which target miRNA-181 family members.
Independent Claims
Since the composition is not fully described then the method of using the composition is also not fully described. Independent claims 17 and 19 are similarly rejected for failing to demonstrate possession of the claimed invention used in the method of inhibiting miR-181… (claim 17) and the method of treating a disease.. (claim 19), wherein the inhibitory molecule is RNA and the RNA has at least 95% identity to SEQ ID NO:1 (TuD-181), SEQ ID NO:2,SEQ ID NO:3 or SEQ ID NO:4.
Dependent Claim
Claims 5-16 and 18 and 20 do not further limit the genus of nucleic acid molecules so as to resolve the issues above, and are therefore, not sufficiently described for at least the reasons above.
Conclusion of Written Description Rejection
Conception is not achieved until reduction to practice has occurred, regardless of the complexity or simplicity of the method of isolation. See Amgen v. Sanofi, 872 F.3d 1367 (Fed Cir. 2017) cited in MPEP 2163. Regardless of the percent sequence identity between a candidate sequence and a reference, one of skill in the art knows that the candidate sequence must retain the function (e.g., the ability to bind to mir-181 family members). Thus, while it is routine and conventional to make and screen oligonucleotides that would function as TuDs, it would require further experimentation to determine if the TuD has the combination of at least 95% sequence identity to the nucleic acid sequence set forth in SEQ ID NO: 1/2/3/4 and possesses the desired biological activity. Therefore, the species disclosed in the instant specifications do not represent the generic limitations recited in these claims and it is not clear that the inventors had contemplated the full scope of their generic claims and therefore do not seem to have full possession of the invention at the time of filing.
While none of the above elements are specifically required to demonstrate possession, in combination their absence means that one skilled in the art at the time of filing would conclude that the inventors lacked possession of an invention which is:
an inhibitory molecule wherein the inhibitory molecule is RNA and the RNA has at least 99% identity to SEQ ID NO:1 (TuD-181), SEQ ID NO:2,SEQ ID NO:3 or SEQ ID NO:4 (claim 5);
AND wherein the inhibitory molecule is RNA and the RNA has at least 95% identity to SEQ ID NO:1 (TuD-181), SEQ ID NO:2,SEQ ID NO:3 or SEQ ID NO:4 and
the use of this molecule in a method.
Examiner Suggestion: Amend the claims to recite wherein the inhibitory molecule (TuD-181) is RNA and the RNA is one of: SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4.
Conclusion
No claims are allowed.
Correspondence
Any inquiry concerning this communication or earlier communications from the examiner should be directed to SHABANA MEYERING, Ph.D. whose telephone number is (703)756-4603. The examiner can normally be reached M - F: 9am to 5pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571) 272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
SHABANA S. MEYERING, Ph.D.
Examiner
Art Unit 1635
/SHABANA S MEYERING/Examiner, Art Unit 1635
/CATHERINE KONOPKA/Primary Examiner, Art Unit 1635
Prosecution Insights