Prosecution Insights
Last updated: April 19, 2026
Application No. 18/132,278

Polynucleotides, Compositions, and Methods for Genome Editing

Final Rejection §102§103§DP
Filed
Apr 07, 2023
Examiner
POLIAKOVA-GEORGAN, EKATERINA
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Intellia Therapeutics, Inc.
OA Round
2 (Final)
65%
Grant Probability
Favorable
3-4
OA Rounds
2y 8m
To Grant
81%
With Interview

Examiner Intelligence

Grants 65% — above average
65%
Career Allow Rate
434 granted / 668 resolved
+5.0% vs TC avg
Strong +16% interview lift
Without
With
+16.2%
Interview Lift
resolved cases with interview
Typical timeline
2y 8m
Avg Prosecution
55 currently pending
Career history
723
Total Applications
across all art units

Statute-Specific Performance

§101
5.4%
-34.6% vs TC avg
§103
28.6%
-11.4% vs TC avg
§102
22.8%
-17.2% vs TC avg
§112
24.2%
-15.8% vs TC avg
Black line = Tech Center average estimate • Based on career data from 668 resolved cases

Office Action

§102 §103 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claim Objections Claims 14, 101, 106-107, 115, 126-127, 130, 132-134 are objected to because of the following informalities: all claims claim mRNAs but specify that thymidines (Ts) in them are substituted with uridines or modified uridines. It is well known in the art that RNA molecules do not comprise thymidines, but have uridines in their place. Appropriate correction is required. Claim Rejections - 35 USC § 102 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claim(s) 14, 102-104, 116-118, 120 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Chen et al (CN 105821072 A, August 2016, cited from machine translation, of record). Concerning claims 14, 100, 102-104 Chen et al disclose Cas9 mRNA of SEQ ID NO: 12 (see page 23 of machine translation, sequence listing of original publication), which is 98% identical to instant SEQ ID NOs: 150 and 153. According to sequence alignment below (Qy is SEQ ID NO: 150, Db is SEQ ID NO: 12) such SEQ ID NO: 12 comprises substitution of C to A (see the alignment on the very top line emphasized in bold and italic), therefore satisfying structural requirements of adenine content as in instant claim 14: Qy 1 GACAAGAAGTACTCCATCGGCCTGGCCATCGGCACCAACTCCGTGGGCTGGGCCGTGATC 60 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Db 180 GACAAGAAGTACTCCATCGGCCTGGACATCGGCACCAACTCCGTGGGCTGGGCCGTGATC 239 Qy 61 ACCGACGAGTACAAGGTGCCCTCCAAGAAGTTCAAGGTGCTGGGCAACACCGACCGGCAC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Db 240 ACCGACGAGTACAAGGTGCCCTCCAAGAAGTTCAAGGTGCTGGGCAACACCGACCGCCAC 299 Qy 121 TCCATCAAGAAGAACCTGATCGGCGCCCTGCTGTTCGACTCCGGCGAGACCGCCGAGGCC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 300 TCCATCAAGAAGAACCTGATCGGCGCCCTGCTGTTCGACTCCGGCGAGACCGCCGAGGCC 359 Qy 181 ACCCGGCTGAAGCGGACCGCCCGGCGGCGGTACACCCGGCGGAAGAACCGGATCTGCTAC 240 ||||| |||||||| |||||||| || || |||||||| || |||||||| ||||||||| Db 360 ACCCGCCTGAAGCGCACCGCCCGCCGCCGCTACACCCGCCGCAAGAACCGCATCTGCTAC 419 Qy 241 CTGCAGGAGATCTTCTCCAACGAGATGGCCAAGGTGGACGACTCCTTCTTCCACCGGCTG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Db 420 CTGCAGGAGATCTTCTCCAACGAGATGGCCAAGGTGGACGACTCCTTCTTCCACCGCCTG 479 Qy 301 GAGGAGTCCTTCCTGGTGGAGGAGGACAAGAAGCACGAGCGGCACCCCATCTTCGGCAAC 360 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Db 480 GAGGAGTCCTTCCTGGTGGAGGAGGACAAGAAGCACGAGCGCCACCCCATCTTCGGCAAC 539 Qy 361 ATCGTGGACGAGGTGGCCTACCACGAGAAGTACCCCACCATCTACCACCTGCGGAAGAAG 420 ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| Db 540 ATCGTGGACGAGGTGGCCTACCACGAGAAGTACCCCACCATCTACCACCTGCGCAAGAAG 599 Qy 421 CTGGTGGACTCCACCGACAAGGCCGACCTGCGGCTGATCTACCTGGCCCTGGCCCACATG 480 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Db 600 CTGGTGGACTCCACCGACAAGGCCGACCTGCGCCTGATCTACCTGGCCCTGGCCCACATG 659 Qy 481 ATCAAGTTCCGGGGCCACTTCCTGATCGAGGGCGACCTGAACCCCGACAACTCCGACGTG 540 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Db 660 ATCAAGTTCCGCGGCCACTTCCTGATCGAGGGCGACCTGAACCCCGACAACTCCGACGTG 719 Qy 541 GACAAGCTGTTCATCCAGCTGGTGCAGACCTACAACCAGCTGTTCGAGGAGAACCCCATC 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 720 GACAAGCTGTTCATCCAGCTGGTGCAGACCTACAACCAGCTGTTCGAGGAGAACCCCATC 779 Qy 601 AACGCCTCCGGCGTGGACGCCAAGGCCATCCTGTCCGCCCGGCTGTCCAAGTCCCGGCGG 660 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || Db 780 AACGCCTCCGGCGTGGACGCCAAGGCCATCCTGTCCGCCCGCCTGTCCAAGTCCCGCCGC 839 Qy 661 CTGGAGAACCTGATCGCCCAGCTGCCCGGCGAGAAGAAGAACGGCCTGTTCGGCAACCTG 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 840 CTGGAGAACCTGATCGCCCAGCTGCCCGGCGAGAAGAAGAACGGCCTGTTCGGCAACCTG 899 Qy 721 ATCGCCCTGTCCCTGGGCCTGACCCCCAACTTCAAGTCCAACTTCGACCTGGCCGAGGAC 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 900 ATCGCCCTGTCCCTGGGCCTGACCCCCAACTTCAAGTCCAACTTCGACCTGGCCGAGGAC 959 Qy 781 GCCAAGCTGCAGCTGTCCAAGGACACCTACGACGACGACCTGGACAACCTGCTGGCCCAG 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 960 GCCAAGCTGCAGCTGTCCAAGGACACCTACGACGACGACCTGGACAACCTGCTGGCCCAG 1019 Qy 841 ATCGGCGACCAGTACGCCGACCTGTTCCTGGCCGCCAAGAACCTGTCCGACGCCATCCTG 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1020 ATCGGCGACCAGTACGCCGACCTGTTCCTGGCCGCCAAGAACCTGTCCGACGCCATCCTG 1079 Qy 901 CTGTCCGACATCCTGCGGGTGAACACCGAGATCACCAAGGCCCCCCTGTCCGCCTCCATG 960 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Db 1080 CTGTCCGACATCCTGCGCGTGAACACCGAGATCACCAAGGCCCCCCTGTCCGCCTCCATG 1139 Qy 961 ATCAAGCGGTACGACGAGCACCACCAGGACCTGACCCTGCTGAAGGCCCTGGTGCGGCAG 1020 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||| Db 1140 ATCAAGCGCTACGACGAGCACCACCAGGACCTGACCCTGCTGAAGGCCCTGGTGCGCCAG 1199 Qy 1021 CAGCTGCCCGAGAAGTACAAGGAGATCTTCTTCGACCAGTCCAAGAACGGCTACGCCGGC 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1200 CAGCTGCCCGAGAAGTACAAGGAGATCTTCTTCGACCAGTCCAAGAACGGCTACGCCGGC 1259 Qy 1081 TACATCGACGGCGGCGCCTCCCAGGAGGAGTTCTACAAGTTCATCAAGCCCATCCTGGAG 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1260 TACATCGACGGCGGCGCCTCCCAGGAGGAGTTCTACAAGTTCATCAAGCCCATCCTGGAG 1319 Qy 1141 AAGATGGACGGCACCGAGGAGCTGCTGGTGAAGCTGAACCGGGAGGACCTGCTGCGGAAG 1200 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||| Db 1320 AAGATGGACGGCACCGAGGAGCTGCTGGTGAAGCTGAACCGCGAGGACCTGCTGCGCAAG 1379 Qy 1201 CAGCGGACCTTCGACAACGGCTCCATCCCCCACCAGATCCACCTGGGCGAGCTGCACGCC 1260 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1380 CAGCGCACCTTCGACAACGGCTCCATCCCCCACCAGATCCACCTGGGCGAGCTGCACGCC 1439 Qy 1261 ATCCTGCGGCGGCAGGAGGACTTCTACCCCTTCCTGAAGGACAACCGGGAGAAGATCGAG 1320 |||||||| || ||||||||||||||||||||||||||||||||||| |||||||||||| Db 1440 ATCCTGCGCCGCCAGGAGGACTTCTACCCCTTCCTGAAGGACAACCGCGAGAAGATCGAG 1499 Qy 1321 AAGATCCTGACCTTCCGGATCCCCTACTACGTGGGCCCCCTGGCCCGGGGCAACTCCCGG 1380 ||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| Db 1500 AAGATCCTGACCTTCCGCATCCCCTACTACGTGGGCCCCCTGGCCCGCGGCAACTCCCGC 1559 Qy 1381 TTCGCCTGGATGACCCGGAAGTCCGAGGAGACCATCACCCCCTGGAACTTCGAGGAGGTG 1440 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Db 1560 TTCGCCTGGATGACCCGCAAGTCCGAGGAGACCATCACCCCCTGGAACTTCGAGGAGGTG 1619 Qy 1441 GTGGACAAGGGCGCCTCCGCCCAGTCCTTCATCGAGCGGATGACCAACTTCGACAAGAAC 1500 |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Db 1620 GTGGACAAGGGCGCCTCCGCCCAGTCCTTCATCGAGCGCATGACCAACTTCGACAAGAAC 1679 Qy 1501 CTGCCCAACGAGAAGGTGCTGCCCAAGCACTCCCTGCTGTACGAGTACTTCACCGTGTAC 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1680 CTGCCCAACGAGAAGGTGCTGCCCAAGCACTCCCTGCTGTACGAGTACTTCACCGTGTAC 1739 Qy 1561 AACGAGCTGACCAAGGTGAAGTACGTGACCGAGGGCATGCGGAAGCCCGCCTTCCTGTCC 1620 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Db 1740 AACGAGCTGACCAAGGTGAAGTACGTGACCGAGGGCATGCGCAAGCCCGCCTTCCTGTCC 1799 Qy 1621 GGCGAGCAGAAGAAGGCCATCGTGGACCTGCTGTTCAAGACCAACCGGAAGGTGACCGTG 1680 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Db 1800 GGCGAGCAGAAGAAGGCCATCGTGGACCTGCTGTTCAAGACCAACCGCAAGGTGACCGTG 1859 Qy 1681 AAGCAGCTGAAGGAGGACTACTTCAAGAAGATCGAGTGCTTCGACTCCGTGGAGATCTCC 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1860 AAGCAGCTGAAGGAGGACTACTTCAAGAAGATCGAGTGCTTCGACTCCGTGGAGATCTCC 1919 Qy 1741 GGCGTGGAGGACCGGTTCAACGCCTCCCTGGGCACCTACCACGACCTGCTGAAGATCATC 1800 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Db 1920 GGCGTGGAGGACCGCTTCAACGCCTCCCTGGGCACCTACCACGACCTGCTGAAGATCATC 1979 Qy 1801 AAGGACAAGGACTTCCTGGACAACGAGGAGAACGAGGACATCCTGGAGGACATCGTGCTG 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1980 AAGGACAAGGACTTCCTGGACAACGAGGAGAACGAGGACATCCTGGAGGACATCGTGCTG 2039 Qy 1861 ACCCTGACCCTGTTCGAGGACCGGGAGATGATCGAGGAGCGGCTGAAGACCTACGCCCAC 1920 ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| Db 2040 ACCCTGACCCTGTTCGAGGACCGCGAGATGATCGAGGAGCGCCTGAAGACCTACGCCCAC 2099 Qy 1921 CTGTTCGACGACAAGGTGATGAAGCAGCTGAAGCGGCGGCGGTACACCGGCTGGGGCCGG 1980 ||||||||||||||||||||||||||||||||||| || || ||||||||||||||||| Db 2100 CTGTTCGACGACAAGGTGATGAAGCAGCTGAAGCGCCGCCGCTACACCGGCTGGGGCCGC 2159 Qy 1981 CTGTCCCGGAAGCTGATCAACGGCATCCGGGACAAGCAGTCCGGCAAGACCATCCTGGAC 2040 |||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||| Db 2160 CTGTCCCGCAAGCTGATCAACGGCATCCGCGACAAGCAGTCCGGCAAGACCATCCTGGAC 2219 Qy 2041 TTCCTGAAGTCCGACGGCTTCGCCAACCGGAACTTCATGCAGCTGATCCACGACGACTCC 2100 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Db 2220 TTCCTGAAGTCCGACGGCTTCGCCAACCGCAACTTCATGCAGCTGATCCACGACGACTCC 2279 Qy 2101 CTGACCTTCAAGGAGGACATCCAGAAGGCCCAGGTGTCCGGCCAGGGCGACTCCCTGCAC 2160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2280 CTGACCTTCAAGGAGGACATCCAGAAGGCCCAGGTGTCCGGCCAGGGCGACTCCCTGCAC 2339 Qy 2161 GAGCACATCGCCAACCTGGCCGGCTCCCCCGCCATCAAGAAGGGCATCCTGCAGACCGTG 2220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2340 GAGCACATCGCCAACCTGGCCGGCTCCCCCGCCATCAAGAAGGGCATCCTGCAGACCGTG 2399 Qy 2221 AAGGTGGTGGACGAGCTGGTGAAGGTGATGGGCCGGCACAAGCCCGAGAACATCGTGATC 2280 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Db 2400 AAGGTGGTGGACGAGCTGGTGAAGGTGATGGGCCGCCACAAGCCCGAGAACATCGTGATC 2459 Qy 2281 GAGATGGCCCGGGAGAACCAGACCACCCAGAAGGGCCAGAAGAACTCCCGGGAGCGGATG 2340 ||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| ||| Db 2460 GAGATGGCCCGCGAGAACCAGACCACCCAGAAGGGCCAGAAGAACTCCCGCGAGCGCATG 2519 Qy 2341 AAGCGGATCGAGGAGGGCATCAAGGAGCTGGGCTCCCAGATCCTGAAGGAGCACCCCGTG 2400 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2520 AAGCGCATCGAGGAGGGCATCAAGGAGCTGGGCTCCCAGATCCTGAAGGAGCACCCCGTG 2579 Qy 2401 GAGAACACCCAGCTGCAGAACGAGAAGCTGTACCTGTACTACCTGCAGAACGGCCGGGAC 2460 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Db 2580 GAGAACACCCAGCTGCAGAACGAGAAGCTGTACCTGTACTACCTGCAGAACGGCCGCGAC 2639 Qy 2461 ATGTACGTGGACCAGGAGCTGGACATCAACCGGCTGTCCGACTACGACGTGGACCACATC 2520 |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| Db 2640 ATGTACGTGGACCAGGAGCTGGACATCAACCGCCTGTCCGACTACGACGTGGACCACATC 2699 Qy 2521 GTGCCCCAGTCCTTCCTGAAGGACGACTCCATCGACAACAAGGTGCTGACCCGGTCCGAC 2580 ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| Db 2700 GTGCCCCAGTCCTTCCTGAAGGACGACTCCATCGACAACAAGGTGCTGACCCGCTCCGAC 2759 Qy 2581 AAGAACCGGGGCAAGTCCGACAACGTGCCCTCCGAGGAGGTGGTGAAGAAGATGAAGAAC 2640 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2760 AAGAACCGCGGCAAGTCCGACAACGTGCCCTCCGAGGAGGTGGTGAAGAAGATGAAGAAC 2819 Qy 2641 TACTGGCGGCAGCTGCTGAACGCCAAGCTGATCACCCAGCGGAAGTTCGACAACCTGACC 2700 |||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||| Db 2820 TACTGGCGCCAGCTGCTGAACGCCAAGCTGATCACCCAGCGCAAGTTCGACAACCTGACC 2879 Qy 2701 AAGGCCGAGCGGGGCGGCCTGTCCGAGCTGGACAAGGCCGGCTTCATCAAGCGGCAGCTG 2760 ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| Db 2880 AAGGCCGAGCGCGGCGGCCTGTCCGAGCTGGACAAGGCCGGCTTCATCAAGCGCCAGCTG 2939 Qy 2761 GTGGAGACCCGGCAGATCACCAAGCACGTGGCCCAGATCCTGGACTCCCGGATGAACACC 2820 ||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||| Db 2940 GTGGAGACCCGCCAGATCACCAAGCACGTGGCCCAGATCCTGGACTCCCGCATGAACACC 2999 Qy 2821 AAGTACGACGAGAACGACAAGCTGATCCGGGAGGTGAAGGTGATCACCCTGAAGTCCAAG 2880 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Db 3000 AAGTACGACGAGAACGACAAGCTGATCCGCGAGGTGAAGGTGATCACCCTGAAGTCCAAG 3059 Qy 2881 CTGGTGTCCGACTTCCGGAAGGACTTCCAGTTCTACAAGGTGCGGGAGATCAACAACTAC 2940 ||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||| Db 3060 CTGGTGTCCGACTTCCGCAAGGACTTCCAGTTCTACAAGGTGCGCGAGATCAACAACTAC 3119 Qy 2941 CACCACGCCCACGACGCCTACCTGAACGCCGTGGTGGGCACCGCCCTGATCAAGAAGTAC 3000 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3120 CACCACGCCCACGACGCCTACCTGAACGCCGTGGTGGGCACCGCCCTGATCAAGAAGTAC 3179 Qy 3001 CCCAAGCTGGAGTCCGAGTTCGTGTACGGCGACTACAAGGTGTACGACGTGCGGAAGATG 3060 ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| Db 3180 CCCAAGCTGGAGTCCGAGTTCGTGTACGGCGACTACAAGGTGTACGACGTGCGCAAGATG 3239 Qy 3061 ATCGCCAAGTCCGAGCAGGAGATCGGCAAGGCCACCGCCAAGTACTTCTTCTACTCCAAC 3120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3240 ATCGCCAAGTCCGAGCAGGAGATCGGCAAGGCCACCGCCAAGTACTTCTTCTACTCCAAC 3299 Qy 3121 ATCATGAACTTCTTCAAGACCGAGATCACCCTGGCCAACGGCGAGATCCGGAAGCGGCCC 3180 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| Db 3300 ATCATGAACTTCTTCAAGACCGAGATCACCCTGGCCAACGGCGAGATCCGCAAGCGCCCC 3359 Qy 3181 CTGATCGAGACCAACGGCGAGACCGGCGAGATCGTGTGGGACAAGGGCCGGGACTTCGCC 3240 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| Db 3360 CTGATCGAGACCAACGGCGAGACCGGCGAGATCGTGTGGGACAAGGGCCGCGACTTCGCC 3419 Qy 3241 ACCGTGCGGAAGGTGCTGTCCATGCCCCAGGTGAACATCGTGAAGAAGACCGAGGTGCAG 3300 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3420 ACCGTGCGCAAGGTGCTGTCCATGCCCCAGGTGAACATCGTGAAGAAGACCGAGGTGCAG 3479 Qy 3301 ACCGGCGGCTTCTCCAAGGAGTCCATCCTGCCCAAGCGGAACTCCGACAAGCTGATCGCC 3360 |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Db 3480 ACCGGCGGCTTCTCCAAGGAGTCCATCCTGCCCAAGCGCAACTCCGACAAGCTGATCGCC 3539 Qy 3361 CGGAAGAAGGACTGGGACCCCAAGAAGTACGGCGGCTTCGACTCCCCCACCGTGGCCTAC 3420 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3540 CGCAAGAAGGACTGGGACCCCAAGAAGTACGGCGGCTTCGACTCCCCCACCGTGGCCTAC 3599 Qy 3421 TCCGTGCTGGTGGTGGCCAAGGTGGAGAAGGGCAAGTCCAAGAAGCTGAAGTCCGTGAAG 3480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3600 TCCGTGCTGGTGGTGGCCAAGGTGGAGAAGGGCAAGTCCAAGAAGCTGAAGTCCGTGAAG 3659 Qy 3481 GAGCTGCTGGGCATCACCATCATGGAGCGGTCCTCCTTCGAGAAGAACCCCATCGACTTC 3540 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Db 3660 GAGCTGCTGGGCATCACCATCATGGAGCGCTCCTCCTTCGAGAAGAACCCCATCGACTTC 3719 Qy 3541 CTGGAGGCCAAGGGCTACAAGGAGGTGAAGAAGGACCTGATCATCAAGCTGCCCAAGTAC 3600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3720 CTGGAGGCCAAGGGCTACAAGGAGGTGAAGAAGGACCTGATCATCAAGCTGCCCAAGTAC 3779 Qy 3601 TCCCTGTTCGAGCTGGAGAACGGCCGGAAGCGGATGCTGGCCTCCGCCGGCGAGCTGCAG 3660 |||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| Db 3780 TCCCTGTTCGAGCTGGAGAACGGCCGCAAGCGCATGCTGGCCTCCGCCGGCGAGCTGCAG 3839 Qy 3661 AAGGGCAACGAGCTGGCCCTGCCCTCCAAGTACGTGAACTTCCTGTACCTGGCCTCCCAC 3720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3840 AAGGGCAACGAGCTGGCCCTGCCCTCCAAGTACGTGAACTTCCTGTACCTGGCCTCCCAC 3899 Qy 3721 TACGAGAAGCTGAAGGGCTCCCCCGAGGACAACGAGCAGAAGCAGCTGTTCGTGGAGCAG 3780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3900 TACGAGAAGCTGAAGGGCTCCCCCGAGGACAACGAGCAGAAGCAGCTGTTCGTGGAGCAG 3959 Qy 3781 CACAAGCACTACCTGGACGAGATCATCGAGCAGATCTCCGAGTTCTCCAAGCGGGTGATC 3840 ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| Db 3960 CACAAGCACTACCTGGACGAGATCATCGAGCAGATCTCCGAGTTCTCCAAGCGCGTGATC 4019 Qy 3841 CTGGCCGACGCCAACCTGGACAAGGTGCTGTCCGCCTACAACAAGCACCGGGACAAGCCC 3900 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| Db 4020 CTGGCCGACGCCAACCTGGACAAGGTGCTGTCCGCCTACAACAAGCACCGCGACAAGCCC 4079 Qy 3901 ATCCGGGAGCAGGCCGAGAACATCATCCACCTGTTCACCCTGACCAACCTGGGCGCCCCC 3960 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4080 ATCCGCGAGCAGGCCGAGAACATCATCCACCTGTTCACCCTGACCAACCTGGGCGCCCCC 4139 Qy 3961 GCCGCCTTCAAGTACTTCGACACCACCATCGACCGGAAGCGGTACACCTCCACCAAGGAG 4020 ||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| Db 4140 GCCGCCTTCAAGTACTTCGACACCACCATCGACCGCAAGCGCTACACCTCCACCAAGGAG 4199 Qy 4021 GTGCTGGACGCCACCCTGATCCACCAGTCCATCACCGGCCTGTACGAGACCCGGATCGAC 4080 ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| Db 4200 GTGCTGGACGCCACCCTGATCCACCAGTCCATCACCGGCCTGTACGAGACCCGCATCGAC 4259 Qy 4081 CTGTCCCAGCTGGGCGGCGAC 4101 ||||||||||||||||||||| Db 4260 CTGTCCCAGCTGGGCGGCGAC 4280 The sequence presented above as DNA, but it is inherent that mRNA of such DNA will have Us in place of Ts, as required in claim 14. It is inherent that Cas9 has double-stranded endonuclease activity, nickase activity and comprises dCas DNA-binding domain. Concerning claims 116-117 Chen et al disclose expression plasmid comprising SEQ ID NO: 12 for Cas9 expression (see page 23 of machine translation). Concerning claim 118 Chen et al disclose cells comprising the expression plasmid (see last paragraph on page 32 of machine translation). Concerning claim 120 Chen et al disclose a composition comprising Cas9 and guide RNA (see page 1 of machine translation). Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim(s) 14, 102-104, 106, 115-118, 120 is/are rejected under 35 U.S.C. 103 as being unpatentable over Chen et al, above, and in further view of Kruse (WO 2014/186334, November 2014, of record). Teachings of Chen et al are discussed above. Chen et al do not teach presence of 5’ UTR of instant SEQ ID NO: 32. Kruse teaches that successful mRNA translation benefits from the presence of 5’UTR (see paragraph [0087]). Kruse gives examples of 5’ UTRs including such of SEQ ID NO: 4 (see paragraph [0071]), fully identical to instant SEQ ID NO: 32. It would have been obvious to one of the ordinary skill in the art before the effective filing date of the claimed invention to add 5’ UTR taught by Kruse to mRNA taught by Chen et al, arriving at instant invention. One of the ordinary skill in the art would be motivated to do so in order to improve translation of mRNA as taught by Kruse. Claim(s) 14, 102-104, 107, 109, 115-118, 120 is/are rejected under 35 U.S.C. 103 as being unpatentable over Chen et al, above, and in further view of Fotin-Mleczek et al (WO 2016/170176, October 2016, of record). Teachings of Chen et al are discussed above. Chen et al do not teach presence of 3’ UTR of instant SEQ ID NO: 33 or comprising heterologous functional domain. Fotin-Mleczek et al teach that successful mRNA translation benefits from the presence of 3’UTR (see lines 5-10 on page 21). Fotin-Mleczek et al gives examples of 3’ UTRs including such of beta-globin gene of SEQ ID NO: 10059 (see lines 20-26 on page 159), fully identical to instant SEQ ID NO: 33. Such 3’UTR may enhance mRNA half-life (see lines 15-20 on page 158). Further Fotin-Mleczek et al teach that mRNA can be delivered using polymeric carriers which can comprise NLS (see lines 15-20 on page 187, lines 25-28 on page 188). Such NLS is a type of heterologous functional domain according to instant specification paragraph [0211]). It would have been obvious to one of the ordinary skill in the art before the effective filing date of the claimed invention to add 3’ UTR taught by Fotin-Mleczek et al to mRNA taught by Chen et al and deliver it using polymeric carrier taught by Fotin-Mleczek et al, arriving at instant invention. One of the ordinary skill in the art would be motivated to do so in order to enhance mRNA half-life as taught by Fotin-Mleczek et al and successfully deliver it using polymeric carrier taught by Fotin-Mleczek et al. Claim(s) 14, 102-104, 108, 111-118, 120-122, 125 is/are rejected under 35 U.S.C. 103 as being unpatentable over Chen et al, above, and in further view of De Fougerolles et al (WO 2013/090648, June 2013, cited from IDS). Teachings of Chen et al are discussed above. Chen et al do not teach presence of Cap0 cap or modifications with N1-methyl pseudouridine, or delivery in lipid nanoparticle, or pharmaceutical compositions, or poly-A tail of SEQ ID NO: 63. De Fougerolles et al teach modifications of mRNA for polypeptide production (see paragraph [0005]). Such modifications can be presence of Cap0 (see paragraph [0029]) and full modifications of uridines to N1-methyl-pseudouridine (see paragraphs [00869, 001024]). Such mRNA can be delivered in lipid nanoparticle (see paragraphs [0005-0006]) and can be a part of pharmaceutical composition comprising pharmaceutically acceptable excipients (see paragraph [00358]). Such mRNA can comprise poly-A tail approximately 100 nucleotides long in order to increase its stability (see paragraph [0090]). Such poly-A tail of 100 nucleotides will comprise instant SEQID NO: 63. It would have been obvious to one of the ordinary skill in the art before the effective filing date of the claimed invention to add modifications taught by De Fougerolles et al to mRNA taught by Chen et al and deliver it in lipid nanoparticle as a pharmaceutical composition, arriving at instant invention. One of the ordinary skill in the art would be motivated to do so in order to improve translation, stability and delivery of mRNA as taught by De Fougerolles et al. Claim(s) 14, 102-104, 109, 115-118, 120, 128-130 is/are rejected under 35 U.S.C. 103 as being unpatentable over Chen et al, above, and in further view of Dombrowski et al (US 2017/0260547, 14 September 2017, of record). Teachings of Chen et al are discussed above. Chen et al do not teach mRNA comprising at least one NLS encoded by a sequence of instant SEQ ID NO: 92. Dombrowski et al teach improvements to mRNA encoding Cas9 protein such as adding encoded at least one NLS (see paragraphs [0054, 0049]). Examples of sequences including such NLS include SEQ ID NO: 14 (see paragraph [0175]), which comprises instant SEQ ID NO: 92. Such NLS is a type of heterologous functional domain according to instant specification paragraph [0211]). It would have been obvious to one of the ordinary skill in the art before the effective filing date of the claimed invention to add NLS taught by Dombrowski et al to mRNA taught by Chen et al, arriving at instant invention. One of the ordinary skill in the art would be motivated to do so in order to improve mRNA as taught by Dombrowski et al. Claim(s) 14, 102-104, 115-118, 120, 131 is/are rejected under 35 U.S.C. 103 as being unpatentable over Chen et al, above, and in further view of Kozak (Nucleic Acid Research, 1987, vol.15, number 20, pages 8125-8148). Teachings of Chen et al are discussed above. Chen et al do not teach mRNA comprising Kozak sequence comprising instant SEQ ID NO: 105. Kozak teaches the sequence identical to instant SEQ ID NO: 105 as the consensus sequence for initiation of translation in verterbrates (see Abstract). It would have been obvious to one of the ordinary skill in the art before the effective filing date of the claimed invention to add the sequence taught by Kozak to mRNA taught by Chen et al, arriving at instant invention. One of the ordinary skill in the art would be motivated to do so in order to initiate translation of mRNA encoding Cas9 taught by Chen inside a cell as taught by Kozak. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 14, 101-109, 111-118, 120-122, 125-132 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-26 of U.S. Patent No. 11,697,806. Although the claims at issue are not identical, they are not patentably distinct from each other because claims from ‘806 recite SEQ ID NO: 114, which is 99.9% identical to instant SEQ ID NOs: 150 and 153. Further claims from ‘806 recite sequences 98% identical to SEQ ID NO: 111, such genus of sequences includes SEQ ID NO: 111 itself (see claim 1). Uridines in such sequences can be substituted with N1-methyl-pseudouridine (see claim 12). Claims 14, 101-104, 106-109, 111-118, 120-122, 125-131 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 3-6, 9, 12-13, 16, 19, 21, 24-28, 31-35 and 51 of copending Application No. 17/882099 in view of Kruse, above, Fotin-Mleczek et al, above, De Fougerolles et al, above, Dombrowski et al, above, Kozak, above. Claim 51 from ‘099 recite nucleic acid comprising SEQ ID NO: 513, which is 99.9% identical to instant SEQ ID NOs: 150 and 153. Teachings of the secondary references are discussed above. Further specification of ‘099 teach substitution of uridine in mRNAs by N1-methyl-pseudouridine (see paragraph [00404]). It would have been obvious to modify Cas9 of SEQ ID NO: 513 with such modifications, arriving at instant invention. This is a provisional nonstatutory double patenting rejection. Allowable Subject Matter Claims 133-134 are objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims and correcting claims objection as above. Response to Arguments Applicant's arguments filed 07/29/2025 have been fully considered but they are not persuasive. Concerning rejections based on Chen et al reference Applicant argues that the reference does not teach the sequence as claimed. In response the reference does teach such sequence as evidenced in modified rejection above. Rejection based on Chen et al-2017 reference is withdrawn in view of new amendments, arguments are moot. Applicant does not provide any arguments concerning double patenting rejections, therefore modified rejections are maintained. Conclusion Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to EKATERINA POLIAKOVA whose telephone number is (571)270-5257. The examiner can normally be reached Mon-Fri 8-5. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571)272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /EKATERINA POLIAKOVA-GEORGANTAS/Primary Examiner, Art Unit 1637
Read full office action

Prosecution Timeline

Apr 07, 2023
Application Filed
Apr 25, 2025
Non-Final Rejection — §102, §103, §DP
Jul 29, 2025
Response Filed
Sep 26, 2025
Final Rejection — §102, §103, §DP (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12600964
Compound for treatment of heart failure
2y 5m to grant Granted Apr 14, 2026
Patent 12595477
COMPLEMENT FACTOR B-MODULATING COMPOSITIONS AND METHODS OF USE THEREOF
2y 5m to grant Granted Apr 07, 2026
Patent 12584130
ANGIOTENSINOGEN (AGT) iRNA COMPOSITIONS AND METHODS OF USE THEREOF
2y 5m to grant Granted Mar 24, 2026
Patent 12576030
COMPOSITIONS FOR DELIVERY OF CODON-OPTIMIZED MRNA
2y 5m to grant Granted Mar 17, 2026
Patent 12570977
NOVEL MRNA COMPOSITION AND PRODUCTION METHOD FOR USE IN ANTI-VIRAL AND ANTI-CANCER VACCINES
2y 5m to grant Granted Mar 10, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
65%
Grant Probability
81%
With Interview (+16.2%)
2y 8m
Median Time to Grant
Moderate
PTA Risk
Based on 668 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month