Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Applicant's preliminary amendment filed on January 19, 2026 is acknowledged. Claims 4-44, 46-67, 69-77, 79-82, 84, 86, 89-133, 135-156, 159-175, and 177-191 have been canceled. Claims 1-3, 45, 68, 83, 87, 88, 134, 157, 158, and 176 were amended. Claims 1-3, 45, 68, 78, 83, 85, 87, 88, 134, 157, 158, 176, and 192-199 are pending.
Election/Restrictions
Applicant’s election without traverse of Group I (claims 1-3, 45, 68, 78, 83, 85, 87, 88, 134, 157, 158, and 176) in the reply filed on January 19, 2026 is acknowledged.
Applicant’s election of the following species:
PNG
media_image1.png
158
718
media_image1.png
Greyscale
in the reply filed on January 19, 2026 is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)).
Upon further consideration and in the interest of compact prosecution, the election of species (a) has been withdrawn.
It is noted that newly added claims 192-199 are drawn to the dsRNA molecule of claim 1; therefore, claims 192-199 will be examined with the elected invention.
Claims 1-3, 45, 68, 78, 83, 85, 87, 88, 134, 157, 158, 176, and 192-199 are examined on the merits herein.
Priority
PNG
media_image2.png
28
396
media_image2.png
Greyscale
Information Disclosure Statement
The information disclosure statement (IDS) submitted on January 7, 2025 is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered.
Drawings
The drawings were received on May 3, 2023.
The drawings are objected to because the title of the x axis in FIG. 3 for “1499” and “1619” appears to be slightly cut off. Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Color photographs and color drawings are not accepted in utility applications unless a petition filed under 37 CFR 1.84(a)(2) is granted. Any such petition must be accompanied by the appropriate fee set forth in 37 CFR 1.17(h), one set of color drawings or color photographs, as appropriate, if submitted via the USPTO patent electronic filing system or three sets of color drawings or color photographs, as appropriate, if not submitted via the via USPTO patent electronic filing system, and, unless already present, an amendment to include the following language as the first paragraph of the brief description of the drawings section of the specification:
The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
Color photographs will be accepted if the conditions for accepting color drawings and black and white photographs have been satisfied. See 37 CFR 1.84(b)(2).
Specification
The substitute specification filed on October 13, 2023 has been entered.
Applicant is reminded of the proper language and format for an abstract of the disclosure.
The abstract should be in narrative form and generally limited to a single paragraph on a separate sheet within the range of 50 to 150 words in length. The abstract should describe the disclosure sufficiently to assist readers in deciding whether there is a need for consulting the full patent text for details.
The language should be clear and concise and should not repeat information given in the title. It should avoid using phrases which can be implied, such as, “The disclosure concerns,” “The disclosure defined by this invention,” “The disclosure describes,” etc. In addition, the form and legal phraseology often used in patent claims, such as “means” and “said,” should be avoided.
The abstract of the disclosure is objected to because the abstract is less than 50 words in length. A corrected abstract of the disclosure is required and must be presented on a separate sheet, apart from any other text. See MPEP § 608.01(b).
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1, 2, 3, 45, 68, 78, 83, 85, 87, 88, 134, 157, 158, 176, and 192-199 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
The term “sufficient complementarity” in claims 1, 2, 87, and 157 is a relative term which renders the claim indefinite. The term “sufficient complementarity” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. Paragraph [0234] of the specification provides the following definition:
PNG
media_image3.png
136
726
media_image3.png
Greyscale
However, the functional definition fails to “provide a clear-cut indication of the scope of the subject matter embraced by the claim” and thus is indefinite under MPEP 2173.05(g).
Claims 3, 45, 68, 78, 83, 85, 88, 134, 158, 176, and 192-199 are indefinite because the claims depend from a rejected claim without addressing the 35 U.S.C. 112(b) indefiniteness issue.
The term “about” in claims 192 and 194 is a relative term which renders the claim indefinite. The term “about” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. Therefore, the phrase “about 15 nucleotides to about 25 nucleotides” (claim 192) and “about a 2-nucleotide to about 5-nucleotide” (claim 194) has been rendered indefinite by the use of the term “about”. One of skill cannot know the metes and bounds of the claims because the term “about” is an undefined relative term.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Section 33(a) of the America Invents Act reads as follows:
Notwithstanding any other provision of law, no patent may issue on a claim directed to or encompassing a human organism.
Claim 83 is rejected under 35 U.S.C. 101 and section 33(a) of the America Invents Act as being directed to or encompassing a human organism. See also Animals - Patentability, 1077 Off. Gaz. Pat. Office 24 (April 21, 1987) (indicating that human organisms are excluded from the scope of patentable subject matter under 35 U.S.C. 101).
Claim 83 recites the following:
PNG
media_image4.png
76
866
media_image4.png
Greyscale
The specification discloses that rAAVs and their associated vectors can be used to deliver one or more siRNAs into cells, e.g., neural cells (e.g., brain cells) [0456]. Thus, in view of the specification, the broadest reasonable interpretation of the claimed cell in claim 83 includes a human being. Therefore, the claim is directed to nonstatutory subject matter. It would be remedial to amend the claim to recite in part “An isolated cell” (emphasis added).
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1-3, 68, 192, and 195-198 are rejected under 35 U.S.C. 103 as being unpatentable over Grabczyk et al. (US 2017/0183655) in view of GenBank (Homo sapiens PMS1 homolog 1, mismatch repair system component (PMS1), transcript variant 1, mRNA, NCBI Reference Sequence: NM_000534.5, available April 19, 2022).
Regarding claims 1-3, Grabczyk et al. teaches oligonucleotide compositions capable of treating DNA repeat expansion diseases and oligonucleotides directed to subunits of the DNA mismatch repair system [abstract]. Grabczyk et al. teaches that DNA mismatch repair (MMR) has been implicated in repeat expansions of numerous disorders including Huntington's disease (HD) and myotonic dystrophy (DM). Currently there is no treatment and no cure for Friedreich ataxia or any of the many other DNA repeat expansion diseases [0006]. Grabczyk et al. teaches an isolated nuclease-resistant oligonucleotide comprising a nucleic acid sequence that hybridizes to a complementary target nucleic acid sequence of a gene or gene product encoding a component of a mismatch repair (MMR) complex. For example, the oligonucleotide comprises a sequence that specifically hybridizes in a human cell with a nucleic acid sequence encoding a subunit of the MMR system such as PMS1 [0008].
Regarding claim 68, Grabczyk et al. teaches a pharmaceutical composition comprising a nuclease-resistant oligonucleotide comprising a nucleic acid sequence that hybridizes to a complementary target nucleic acid sequence of a gene or gene product encoding a component of a mismatch repair (MMR) complex, and a pharmaceutically acceptable carrier [0009].
Regarding claim 192, Grabczyk et al. teaches that oligonucleotide compounds directed to a nucleic acid sequence of a subunit of the MMR system such as PMS1 can comprise shorter or longer fragment lengths (e.g., 15-, 16-, 17-, 18-, 19-20-, 21-, 22-, 23-, 24-, 25-mers) [0069].
Regarding claim 195, Grabczyk et al. teaches that oligonucleotide compounds directed to a nucleic acid sequence of a subunit of the MMR system such as PMS1 can comprise one or more modified nucleotides [0069].
Regarding claim 196, Grabczyk et al. teaches modified ASOs directed to a nucleic acid sequence of a subunit of the MMR system such as PMS1. Modified oligonucleotides can comprise 2′-O-methyl modified oligoribonucleotides, which render the antisense oligonucleotide resistant to RNase H degradation [0070].
Regarding claims 197 and 198, Grabczyk et al. teaches that oligonucleotide compounds directed to a nucleic acid sequence of a subunit of the MMR system such as PMS1 can comprise modified bonds or internucleotide linkages such as phosphorothioate [0069].
However, Grabczyk et al. does not teach a double stranded RNA molecule wherein the antisense strand comprises a sequence substantially complementary to a PMS1 nucleic acid sequence of SEQ ID NO: 7 or 15.
GenBank teaches a human PMS1 mRNA sequence, NM_000534.5, to which the sense strand sequences corresponding to SEQ ID NOS: 7 and 15 are 100% identical as shown in the alignments below.
Query Match 100.0%; Score 45; DB 1; Length 3156;
Best Local Similarity 100.0%;
Matches 45; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
SEQ ID NO: 7 1 TGTCATAAAACAGCATGAGTCTGGTTTTAAATTATCTTTGTATTA 45
|||||||||||||||||||||||||||||||||||||||||||||
NM_000534.5 3006 TGTCATAAAACAGCATGAGTCTGGTTTTAAATTATCTTTGTATTA 3050
Query Match 100.0%; Score 20; DB 1; Length 3156;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
SEQ ID NO: 15 1 TGAGTCTGGTTTTAAATTAT 20
||||||||||||||||||||
NM_000534.5 3021 TGAGTCTGGTTTTAAATTAT 3040
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to design a double stranded RNA molecule with a reasonable expectation of success because the PMS1 mRNA sequence is known and Grabczyk et al. taught oligonucleotide compositions capable of treating DNA repeat expansion diseases and design rules of oligonucleotides directed to subunits of the DNA mismatch repair system. Grabczyk et al. also taught an isolated nuclease-resistant oligonucleotide comprising a nucleic acid sequence that hybridizes to a complementary target nucleic acid sequence of a gene or gene product encoding a component of a mismatch repair (MMR) complex such as PMS1. One of ordinary skill in the art would have been motivated to do so because Grabczyk et al. taught that DNA mismatch repair (MMR) has been implicated in repeat expansions of numerous disorders including Huntington's disease (HD) and currently there is no treatment and no cure for any of the many other DNA repeat expansion diseases [0006].
Claim 45 is rejected under 35 U.S.C. 103 as being unpatentable over Grabczyk et al. (US 2017/0183655) in view of GenBank (Homo sapiens PMS1 homolog 1, mismatch repair system component (PMS1), transcript variant 1, mRNA, NCBI Reference Sequence: NM_000534.5, available April 19, 2022) as applied to claims 1-3, 68, 192, and 195-198 above, and further in view of Foster et al. (Molecular Therapy 2018).
Regarding claim 45, the teachings of Grabczyk et al. and GenBank are discussed above.
However, Grabczyk et al. and GenBank do not teach the specific modifications recited in the claim.
Foster et al. teaches that substantial efficacy improvements can be achieved through further refinement of siRNA chemistry, optimizing the positioning of 2’-deoxy-2’-fluoro and 2’-O-methyl ribosugar modifications across both strands of the double stranded siRNA duplex to enhance stability without compromising intrinsic RNAi activity [abstract]. Foster et al. teaches that modifying the 2’ position of RNA can significantly enhance the nuclease stability of oligonucleotides and that sterically more demanding modifications, such as 2’-OMe, can have a greater stabilizing effect compared to less bulky modifications, such as 2’-F [page 708, right column, second full paragraph]. Foster et al. also teaches that relative to the 5’ end of the respective strand, antisense strand positions 2, 6, and 14 as well as sense strand position 11 were found to exhibit the highest apparent preference for 2’-F [page 709, left column, third full paragraph]. Foster et al. demonstrates in Figures 1-2 that different placements for 2’-OMe and 2’-F modifications within each strand of a dsRNA can affect efficacy to varying degrees.
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the dsRNA of Grabczyk et al. and GenBank using a siRNA design of Foster et al. so that the dsRNA comprises a specific chemical modification pattern because Foster et al. taught that substantial efficacy improvements can be achieved through further refinement of siRNA chemistry by optimizing the positioning of 2’-deoxy-2’-fluoro and 2’-O-methyl ribosugar modifications across both strands of the double stranded siRNA duplex to stability and activity. One of ordinary skill in the art would have been motivated to do so because it would have amounted to combining known prior art elements to yield predictable results.
Claims 78 and 83 are rejected under 35 U.S.C. 103 as being unpatentable over Grabczyk et al. (US 2017/0183655) in view of GenBank (Homo sapiens PMS1 homolog 1, mismatch repair system component (PMS1), transcript variant 1, mRNA, NCBI Reference Sequence: NM_000534.5, available April 19, 2022) as applied to claims 1-3, 68, 192, and 195-198 above, and further in view of Khvorova et al. (WO 2020/198509).
Regarding claims 78 and 83, the teachings of Grabczyk et al. and GenBank are discussed above.
However, Grabczyk et al. and GenBank do not teach a vector comprising a regulatory sequence operably linked to a nucleotide sequence that encodes the dsRNA molecule of claim 1 (claim 78) or a rAAV comprising the vector of claim 78 wherein the rAAV comprises an AAV capsid (claim 83).
Khvorova et al. teaches that recombinant adeno-associated viruses (rAAVs) and their associated vectors can be used to deliver one or more siRNAs into cells, e.g., neural cells (e.g., brain cells). Khvorova et al. also teaches that AAV with hybrid capsids have improved transduction efficiencies in vitro (AAV-DJ) and in vivo (AAV-DJ/8) in a variety of cells and tissues [0564].
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to incorporate the dsRNA molecule of Grabczyk et al. and GenBank in a vector or a rAAV because Grabczyk et al. taught oligonucleotide compositions capable of treating DNA repeat expansion diseases and design rules of oligonucleotides directed to subunits of the DNA mismatch repair system, GenBank taught the PMS1 mRNA sequence, and Khvorova et al. taught that rAAVs and their associated vectors can be used to deliver one or more siRNAs into cells and AAV with hybrid capsids have improved transduction efficiencies in a variety of cells and tissues. One of ordinary skill in the art would have made such a modification because it would have amounted to combining known prior art elements to yield predictable results.
Claims 85, 87, 88, and 176 are rejected under 35 U.S.C. 103 as being unpatentable over Grabczyk et al. (US 2017/0183655) in view of GenBank (Homo sapiens PMS1 homolog 1, mismatch repair system component (PMS1), transcript variant 1, mRNA, NCBI Reference Sequence: NM_000534.5, available April 19, 2022) as applied to claims 1-3, 68, 192, and 195-198 above, and further in view of Khvorova et al. (WO 2020/198509).
Regarding claims 85, 87, 88, and 176, the teachings of Grabczyk et al. and GenBank are discussed above.
However, Grabczyk et al. and GenBank do not teach a branched RNA compound as recited in claims 85 and 87 or a pharmaceutical composition comprising the branched RNA compound (claim 176).
Khvorova et al. teaches a branched compound comprising two or more oligonucleotides, wherein: (a) the oligonucleotides are connected to one another by one or more moieties selected from a linker, a spacer and a branching point [073]. Khvorova et al. also teaches that branched oligonucleotides comprising RNA silencing agents can be incorporated into pharmaceutical compositions wherein the pharmaceutical composition comprises the nucleic acid molecule, protein, antibody, or branched oligonucleotide compound and a pharmaceutically acceptable carrier [0587]. Khvorova et al. defines the term “RNA silencing agent” as an RNA which is capable of inhibiting or "silencing" the expression of a target gene [0294].
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the branched oligonucleotide compound of Khvorova et al. with the dsRNA molecule of Grabczyk et al. and GenBank because Khvorova et al. taught a branched compound comprising two or more oligonucleotides, Grabczyk et al. taught oligonucleotide compositions capable of treating DNA repeat expansion diseases and design rules of oligonucleotides directed to subunits of the DNA mismatch repair system, and GenBank taught the PMS1 mRNA sequence. One of ordinary skill in the art would have made such a modification because it would have amounted to a simple substitution of one known element for another to obtain predictable results.
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to incorporate the branched oligonucleotide compound of Grabczyk et al. and GenBank in a pharmaceutical composition as taught by Khvorova et al. for the purposes of inhibiting the expression of the PMS1 target gene. One of ordinary skill in the art would have been motivated to do so because it would have amounted to combining known prior art elements to yield predictable results.
Claim 134 is rejected under 35 U.S.C. 103 as being unpatentable over Grabczyk et al. (US 2017/0183655) in view of GenBank (Homo sapiens PMS1 homolog 1, mismatch repair system component (PMS1), transcript variant 1, mRNA, NCBI Reference Sequence: NM_000534.5, available April 19, 2022) and Khvorova et al. (WO 2020/198509) as applied to claims 85, 87, 88, and 176 above, and further in view of Foster et al. (Molecular Therapy 2018).
Regarding claim 134, the teachings of Grabczyk et al., GenBank, and Khvorova et al. are discussed above.
However, Grabczyk et al., GenBank, and Khvorova et al. do not teach the specific modifications recited in the claim.
Foster et al. teaches that substantial efficacy improvements can be achieved through further refinement of siRNA chemistry, optimizing the positioning of 2’-deoxy-2’-fluoro and 2’-O-methyl ribosugar modifications across both strands of the double stranded siRNA duplex to enhance stability without compromising intrinsic RNAi activity [abstract]. Foster et al. teaches that modifying the 2’ position of RNA can significantly enhance the nuclease stability of oligonucleotides and that sterically more demanding modifications, such as 2’-OMe, can have a greater stabilizing effect compared to less bulky modifications, such as 2’-F [page 708, right column, second full paragraph]. Foster et al. also teaches that relative to the 5’ end of the respective strand, antisense strand positions 2, 6, and 14 as well as sense strand position 11 were found to exhibit the highest apparent preference for 2’-F [page 709, left column, third full paragraph]. Foster et al. demonstrates in Figures 1-2 that different placements for 2’-OMe and 2’-F modifications within each strand of a dsRNA can affect efficacy to varying degrees.
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the dsRNA of Grabczyk et al. and GenBank using a siRNA design of Foster et al. so that the dsRNA comprises a specific chemical modification pattern because Foster et al. taught that substantial efficacy improvements can be achieved through further refinement of siRNA chemistry by optimizing the positioning of 2’-deoxy-2’-fluoro and 2’-O-methyl ribosugar modifications across both strands of the double stranded siRNA duplex to stability and activity. One of ordinary skill in the art would have been motivated to do so because it would have amounted to combining known prior art elements to yield predictable results.
Claims 157 and 158 are rejected under 35 U.S.C. 103 as being unpatentable over Grabczyk et al. (US 2017/0183655) in view of GenBank (Homo sapiens PMS1 homolog 1, mismatch repair system component (PMS1), transcript variant 1, mRNA, NCBI Reference Sequence: NM_000534.5, available April 19, 2022) as applied to claims 1-3, 68, 192, and 195-198 above, and further in view of Khvorova et al. (WO 2017/132669; reference cited by Applicant).
Regarding claims 157 and 158, the teachings of Grabczyk et al. and GenBank are discussed above.
However, Grabczyk et al. and GenBank do not teach a compound of formula (I): L---(N)n (claim 157) or a structure of formula I-1 (N—L—N) (claim 158).
Khvorova et al. teaches a compound of formula (I): L---(N)n wherein L is selected from an ethylene glycol chain, an alkyl chain, a peptide, RNA, DNA, a phosphate, a phosphonate, a phosphoramidate, an ester, an amide, a triazole, and
combinations thereof; N is an RNA duplex comprising a sense strand and an antisense strand, the sense strand and antisense strand each independently comprise one or more chemical modifications; and n is 2, 3, 4, 5, 6, 7 or 8 [015]. Khvorova et al. also teaches that the compound of formula (I) has a structure selected from formulas (I-1) – (I-9) wherein formula (I-1) is (N—L—N) [016].
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the compound of Khvorova et al. with the dsRNA molecule of Grabczyk et al. and GenBank because Khvorova et al. taught a compound of formula (I): L---(N)n wherein N is an RNA duplex comprising a sense strand and an antisense strand, Grabczyk et al. taught oligonucleotide compositions capable of treating DNA repeat expansion diseases and design rules of oligonucleotides directed to subunits of the DNA mismatch repair system, and GenBank taught the PMS1 mRNA sequence. One of ordinary skill in the art would have made such a modification because it would have amounted to a simple substitution of one known element for another to obtain predictable results.
Claims 193, 194, and 199 are rejected under 35 U.S.C. 103 as being unpatentable over Grabczyk et al. (US 2017/0183655) in view of GenBank (Homo sapiens PMS1 homolog 1, mismatch repair system component (PMS1), transcript variant 1, mRNA, NCBI Reference Sequence: NM_000534.5, available April 19, 2022) as applied to claims 1-3, 68, 192, and 195-198 above, and further in view of Foster et al. (Molecular Therapy 2018).
Regarding claims 193, 194, and 199, the teachings of Grabczyk et al. and GenBank are discussed above.
Although Grabczyk et al. teaches that oligonucleotide compounds directed to a nucleic acid sequence of a subunit of the MMR system such as PMS1 can comprise modified bonds or internucleotide linkages such as phosphorothioate [0069], Grabczyk et al. does not explicitly teach the number of phosphorothioate internucleotide linkages. Grabczyk et al. and GenBank do not teach at least one single stranded nucleotide overhang (claim 193) or a 2 to 5 nucleotide single stranded nucleotide overhang (claim 194).
Foster et al. teaches that combining 2’-O-methyl (2’-OMe) and 2’-deoxy-2’-fluoro (2’-F) ribosugar modifications throughout both strands of the siRNA with terminal phosphorothioate (PS) linkages provides additional protection against 3’ and 5’ exonucleases [page 708, right column, first paragraph]. Foster et al. further teaches that PS linkages were introduced between antisense nucleotides 1 and 2, 2 and 3, 21 and 22, and 22 and 23 from the 5’ end, as well as sense nucleotides 1 and 2 and 2 and 3 from the 5’ end [page 714, right column, last paragraph]. Foster et al. also demonstrates in Figure 2 the antisense and sense strand designs wherein the antisense strand is 23 nucleotides and the sense strand is 21 nucleotides.
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the dsRNA of Grabczyk et al. and GenBank using a siRNA design of Foster et al. so that the dsRNA comprises a 2 to 5 nucleotide single stranded overhang and 4-16 phosphorothioate internucleotide linkages because Foster et al. taught that combining 2’-OMe, 2’-F, and phosphorothioate linkages provides enhanced stabilization against nuclease activity. One of ordinary skill in the art would have been motivated to do so because it would have amounted to combining known prior art elements to yield predictable results.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to CHRISTINA TRAN whose telephone number is (571)270-0550. The examiner can normally be reached M-F 7:30 - 5:00pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/C.T./
Examiner, Art Unit 1637
/Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637
Prosecution Insights