Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Status of Application/Amendment/Claims
Applicant's response filed 11/26/2025 has been considered. Rejections and/or objections not reiterated from the previous office action mailed 07/30/2025 are hereby withdrawn. The following rejections and/or objections are either newly applied or are reiterated and are the only rejections and/or objections presently applied to the instant application. The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action.
With entry of the amendment filed 11/26/2025, claims 1, 5-12, 15 and 16 are pending in the application. Applicant has canceled claims 1-4, 13 and 14 have been canceled.
The 102, 103 and enablement rejections are withdrawn in view of the new grounds of rejection below.
This O.A. is a Non-Final action because a new Double Patenting rejection is included that should have been included in the previous Office action.
New Claim Rejection
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1, 5-12, 15 and 16 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor, or for pre-AIA the applicant regards as the invention.
In the previous O.A. mailed 07/30/2025, claims 2-4 were rejected because the shRNA structure was unclear and could not be examined. In the amended claims filed 11/26/2025, Applicant canceled the claims and amended claim 1 with the limitations of claims 3 and 4. These claims are still unclear.
Claim 1 recites a shRNA structure of: a) 5' - CCGG - RNAi sequence - CTCGAG - reverse complementary sequence of said RNAi sequence - TTTTTG -3'.
Including RNAi sequence of SEQ ID NO. 1 ATGAAGCCACTGGTAACAAAT into this formula, the structure would look like below with SEQ ID No. 1 and its complement:
CCGGATGAAGCCACTGGTAACAAATCTCGAGATTTGTTACCAGTGGCTTCATTTTTTG
SEQ ID NO. 1 Complement of SEQ ID NO. 1
It is unclear if the complement region is intended to fold back onto SEQ ID NO. 1 and the CTCGAG is a hairpin loop of the shRNA. If so it is unclear what the CCGGA sequence represents or the TTTTTG sequence represents. The specification in [0061] describes shRNA as a DNA molecule that includes a RNAi molecule and its reverse complementary sequence, “plus necessary nucleotides”. What are the necessary nucleotides? [0061] would describe the structure above but does not define what the necessarily nucleotides are in the shRNA. Are they hairpins?
In [0063], the specification describes two shRNA with a sense and antisense strand represented as shRNA1 SEQ ID No. 16 and 17 and shRNA2 SEQ ID No. 18 and 19. These structures are not represented in amended claim 1 because they appear to be a combination of (a) and (b) but claim 1 recites the shRNA is selected from the group having (a) and (b) and not that (a) and (b) are the sense and antisense strands of the shRNA.
In order for the invention to be accurately searched and examined, Applicant must clearly point out and distinctly claim the invention. These claims, as amended are not further searched on the merits because just searching the sequences in claim 1 will not accurately represent the amended structure in claim 1. Further, even if the Examiner were to search the structures stated as shRNA1 and shRNA2 in [0063], these also would not represent the structures in now amended claim 1.
Claims 6 and 11 are indefinite because claim 6 recites “further comprise an introduction of a lentiviral vector expression the shRNA in the cell and depends from claim 5 which recites a shRNA. It is unclear how the shRNA can be further introduced using a lentiviral vector when it was already introduced into the cells in claim 5. Claim 11 also recites further injecting a lentiviral vector comprising the shRNA that has already been injected in step 10.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the "right to exclude" granted by a patent and to prevent possible harassment by multiple assignees. See In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970);and, In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on a nonstatutory double patenting ground provided the reference application or patent either is shown to be commonly owned with this application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP §§ 706.02(l)(1) - 706.02(l)(3) for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/forms/. The filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to http://www.uspto.gov/patents/process/file/efs/guidance/eTD-info-I.jsp.
Claims 1, 5-12, 15 and 16 are provisionally rejected under the judicially created doctrine of double patenting over claims 1-20 of co-pending Application No. 18/307,258 (APP258). This is a provisional double patenting rejection since the conflicting claims have not yet been patented. Although the conflicting claims are not identical, they are not patentably distinct from each other because the instant claims and the claims of the patent are drawn to patently indistinguishable subject matter. Both the instant claims and claims of App258 are drawn to a shRNA having the structure of claim 1 and to methods of inhibiting TUBB2B expression in cell using the claimed shRNA.
This is a provisional obviousness-type double patenting rejection.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Kimberly Chong at (571)272-3111. The examiner can normally be reached Monday thru Friday between M-F 8:00am-4:30pm.
If attempts to reach the examiner by telephone are unsuccessful please contact the SPE for 1636 Neil Hammell at 571-272-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Patent applicants with problems or questions regarding electronic images that can be viewed in the Patent Application Information Retrieval system (PAIR) can now contact the USPTO’s Patent Electronic Business Center (Patent EBC) for assistance. Representatives are available to answer your questions daily from 6 am to midnight (EST). The toll free number is (866) 217-9197. When calling please have your application serial or patent number, the type of document you are having an image problem with, the number of pages and the specific nature of the problem. The Patent Electronic Business Center will notify applicants of the resolution of the problem within 5-7 business days. Applicants can also check PAIR to confirm that the problem has been corrected. The USPTO’s Patent Electronic Business Center is a complete service center supporting all patent business on the Internet. The USPTO’s PAIR system provides Internet-based access to patent application status and history information. It also enables applicants to view the scanned images of their own application file folder(s) as well as general patent information available to the public. For more information about the PAIR system, see http://pair-direct.uspto.gov.
For all other customer support, please call the USPTO Call Center (UCC) at 800-786-9199.
/KIMBERLY CHONG/
Primary Examiner Art Unit 1636