DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Applicant’s response filed on June 30, 2026 in response to the Office action on March 30, 2026 is acknowledged. Claims 26 and 27 were canceled. New claim 28 was added. Claims 1-11, 13, 14, 16, and 18-25 and 28 are pending and under examination in this Office action.
Claim Rejections - 35 USC § 102
Rejection of Claim 25 under 35 U.S.C. 102(a)(2) as being anticipated by Baric et al., (US Patent 11,225,508) is withdrawn in view of Applicant’s amendment.
Rejection of Claim 25 under 35 U.S.C. 102(a)(2) as being anticipated by Ying et al. (US Patent 11,510,977) is withdrawn in view of Applicant’s amendment.
New Rejections necessitated by Applicant’s amendment
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claim 28 is rejected under 35 U.S.C. 103 as being unpatentable over Baric et al., (US Patent 11,225,508) in alternative with Ying et al. (US Patent 11,510,977) and in view of Wohlstadter (WO/2021/222827 in IDS on 9/23/25).
Baric et al. teaches a SARS-CoV-2 sequence identical with present SEQ ID NO: 6, and a kit comprising SEQ ID NO: 6 as a primer (see SEQ ID NO: 42 in Baric and a sequence alignment below). Thus, because Baric discloses a nucleic acid sequence identical with present SEQ ID NO: 6, Baric anticipates the present claims.
Additionally, Baric et al. also teach a sequence identical with present SEQ ID NO: 1 (see sequence alignment below).
Present SEQ ID NO: 6 and SEQ ID NO: 42 in Baric.
Query Match 100.0%; Score 25; Length 52;
Best Local Similarity 100.0%;
Matches 25; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GAAACCATATGATTGTAAAGGAAAG 25
|||||||||||||||||||||||||
Db 11 GAAACCATATGATTGTAAAGGAAAG 35
Present SEQ ID NO: 1 and SEQ ID NO: 42 in Baric.
Query Match 100.0%; Score 27; Length 52;
Best Local Similarity 100.0%;
Matches 27; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GGTTTTAATTGTTACTTTCCTTTACAA 27
|||||||||||||||||||||||||||
Db 49 GGTTTTAATTGTTACTTTCCTTTACAA 23
Ying et al. disclose a sequence identical with present SEQ ID NO: 2 SARS-CoV-2 spike protein RBD-3 coding sequence (see SEQ ID NO: 13 in Ying et al. and a sequence alignment below).
Present SEQ ID NO: 2 and SEQ ID NO: 13 in Ying et al.
Query Match 100.0%; Score 27; Length 582;
Best Local Similarity 100.0%;
Matches 27; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GAAAGTACTACTACTCTGTATGGTTGG 27
|||||||||||||||||||||||||||
Db 551 GAAAGTACTACTACTCTGTATGGTTGG 525
Wobble positions 6 and 14 within present SEQ ID NO: 6 are the alternative (optional) positions. SEQ ID NO: 6 reads as follows: 1 gaaaccatatgattgtaaaggaaag 25. While position 6 and 14 can be changed to T/C positions, this option is considered an alternative species of present SEQ ID NO: 6.
Baric and Ying do not teach the kit or the instructions for detecting the virus.
Wohlstadter et al. teach methods and kits for virus detection containing primer sequences of Baric and/or ying (see claims 5 and 7).
It would have been prima facie obvious to provide Wohlstadter et al. kit containing the instructions and the primers of Baric and/or Ying for the purpose of detection of the virus in the sample, because Wohlstadter et al. teach kits containing nucleic acid primers.
Thus, the present invention would have been prima facie obvious at the time the invention was made.
Claim 25 is rejected under 35 U.S.C. 103 as being unpatentable over Annavajhala et al, Accession MZ681163, (August 2, 2021).
Annavajhala et al, Accession MZ681163 teaches a SARS-CoV-2 sequence containing present SEQ ID NO: 13 (see sequence alignment below). The sequence is 22885 nucleotides.
Present SEQ ID NO: 13 and the sequence alignment with Accession MZ681163
Query 5 GTAATTATAATTACCTGTATAGATTGTTTAGGAAGTCC 42
||||||||||||||||||||||||||||||||||||||
Sbjct 22848 GTAATTATAATTACCTGTATAGATTGTTTAGGAAGTCC 22885
It would have been prima facie obvious to provide the sequence of present SEQ ID NO: 13 given the knowledge of the nucleic acid sequence of SARS-CoV-2. It would have been within the skill of the ordinary artisan to design primer sequence identical with present SEQ ID NO: 13 because the entire sequence containing present SEQ ID NO: 13 has been known in the prior art as disclosed by Annavajhala et al, Accession MZ681163.
Thus, the present invention would have been prima facie obvious at the time the invention was made.
Pertinent references
Chukwuemeka et al. (Journal of Genetic Engineering 2020, p. 1-17) teaches degenerate primer bases or mixed bases to accommodate variations in target sequences. These equimolar mixtures of two or more different bases at a specific position, allow for better compatibility with unknown sequences. It is noted that the wobble positions within the claimed primers of SEQ ID NO: 1, 2 and 6 would have been prima facie obvious in view of the teachings of Chukwuemeka et al.
PCT TUS2116953 disclose a sequence identical with present SEQ ID NO: 1 (see SEQ ID NO: 400).
Query Match 96.3%; Score 26; Length 27;
Best Local Similarity 100.0%;
Matches 26; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GGTTTTAATTGTTACTTTCCTTTACA 26
||||||||||||||||||||||||||
Db 2 GGTTTTAATTGTTACTTTCCTTTACA 27
Conclusion
Claims 1-11, 13-14, 16, and 18-24 are allowable.
Contact Information
THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any extension fee pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to AGNIESZKA BOESEN whose telephone number is (571)272-8035. The examiner can normally be reached on 8:30 - 5:00 PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Thomas Visone can be reached on 571-270-0684. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/AGNIESZKA BOESEN/Primary Examiner, Art Unit 1648
Prosecution Insights