Prosecution Insights
Last updated: April 19, 2026
Application No. 18/156,184

Oncolytic Vaccinia Virus

Final Rejection §112
Filed
Jan 18, 2023
Examiner
NGUYEN, QUANG
Art Unit
1631
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Queen Mary University Of London
OA Round
4 (Final)
38%
Grant Probability
At Risk
5-6
OA Rounds
3y 11m
To Grant
91%
With Interview

Examiner Intelligence

Grants only 38% of cases
38%
Career Allow Rate
280 granted / 734 resolved
-21.9% vs TC avg
Strong +53% interview lift
Without
With
+52.7%
Interview Lift
resolved cases with interview
Typical timeline
3y 11m
Avg Prosecution
65 currently pending
Career history
799
Total Applications
across all art units

Statute-Specific Performance

§101
1.9%
-38.1% vs TC avg
§103
37.9%
-2.1% vs TC avg
§102
15.8%
-24.2% vs TC avg
§112
27.8%
-12.2% vs TC avg
Black line = Tech Center average estimate • Based on career data from 734 resolved cases

Office Action

§112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Applicant’s amendment filed on 01/28/2026 has been entered. Amended claims 27-29 and 31-43 are pending in the present application, and they are examined on the merits herein. Response to Amendment All 103 rejections that were set forth in the Non-Final Office action dated 09/30/2025 were withdrawn in light of currently amended independent claims 27, 31-32, 34 and 37, particular with the new limitation “wherein the vaccinia virus promoters are modified H5 promoters, and the expression cassette comprising the three modified H5 promoters comprises a nucleotide sequence of SEQ ID NO: 2”. Claim Rejections - 35 USC § 112 (New Matter) The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Amended claim 27-29 and 31-43 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a new ground of rejection necessitated by Applicant’s amendment. Amended independent claims 27, 31-32, 34 and 37 recite the limitation “wherein the N1L gene is inactivated by the insertion of a single expression cassette, said expression cassette comprising a nucleic acid sequence, said nucleic acid sequence encoding a single heterologous polypeptide…..and wherein the vaccinia virus promoters are modified H5 promoters, and the expression cassette comprising the three modified H5 promoters comprises a nucleotide sequence of SEQ ID NO: 2”. The claims encompass a thymidine kinase (TK)-deficient vaccinia virus comprising an inactivated N1L gene, wherein the N1L gene is inactivated by the insertion of a single expression cassette, said expression cassette comprising a nucleic acid sequence, said nucleic acid sequence encoding a single heterologous polypeptide, and wherein the nucleic acid sequence comprises three vaccinia virus promoters positioned in the same orientation, wherein the orientation of the vaccinia virus promoters is opposite to that of the adjacent intact reading frame L024, wherein the TK-deficient vaccinia virus contains intact L024 coding sequence, and wherein the vaccinia virus promoters are modified H5 promoters (mH5 promoters), and the expression cassette comprising the three modified H5 promoters comprises a polynucleotide of any length (e.g., 5-, 10-, 25-, 50-, 100-, 1000-, 2000-, 3000- or more nucleotides), and not necessarily limited to the full-length nucleotide sequence of SEQ ID NO: 2 (4,102-nucleotide sequence); a method of treating cancer in a subject or a method of treating cancer using the same vaccinia virus. The as-filed specification does not have a written support for the above limitation. As an initial matter, amended claims 27-29 and 31-43 have been introduced in the Amendment filed on 01/28/2026, so the claims themselves are not part of the original disclosure. 37 CFR § 1.115(a)(2). “New or amended claims which introduce elements or limitations that are not supported by the as-filed disclosure violate the written description requirement. . . . While there is no in haec verba requirement, newly added claims or claim limitations must be supported in the specification through express, implicit, or inherent disclosure. . . . The fundamental factual inquiry is whether the specification conveys with reasonable clarity to those skilled in the art that, as of the filing date sought, applicant was in possession of the invention as now claimed.” MPEP § 2163, part (I)(B); see also MPEP § 2163.02. In this case, the original specification does not convey the particular invention recited in claims 27-29 and 31-43 with reasonable clarity to skilled artisans. “The trouble is that there is no such disclosure, easy though it is to imagine it.” MPEP § 2163.05, part (II) (quoting In re Ruschig, 379 F.2d 990, 995, 154 USPQ 118, 123 (CCPA 1967)). In the Amendment filed on 01/28/2026 (first paragraph at page 5) Applicant cited previously presented claim 30 (now canceled) and Figure 2 of the as-filed specification as an alleged written support for the above limitation. It is noted that claim 30 merely recites the limitation “wherein the vaccinia virus promoters are selected from the group consisting of modified H5, H5, P7l5, and PE/L”; while Figure 2 simply shows the full-length 4,102-basepair sequence of SEQ ID NO: 2 for the expression cassette comprising three mH5 promoters, without any further description of the expression cassette. Nothing in Figure 2 teaches or remotely suggests a concept of a single expression cassette comprising a nucleic acid sequence encoding a single heterologous polypeptide and three modified H5 promoters positioned in the same orientation, wherein the expression cassette comprises a nucleotide sequence of any length (e.g., 5-, 10-, 25-, 50-, 100-, 1000-, 2000-, 3000- or more nucleotides) and including the full-length of SEQ ID NO: 2 as encompassed by currently amended claims. Moreover, upon further analysis of the nucleotide sequence of SEQ ID NO: 2 and in light of the description of an expression cassette in pUC19-N1L shuttle vector in Example 1 and Fig 3 that is reproduced below, PNG media_image1.png 95 393 media_image1.png Greyscale it appears that the expression cassette of SEQ ID NO: 2 comprising: three mH5 promoters; a reporter RFP (Red Fluorescent Protein) gene (a 1st encoded heterologous polypeptide) located between the second and the third mH5 promoters (each promoter has the mH5 sequence listed in Fig. 1 of the instant application) and operably linked to the second mH5 promoter; and the nucleotide sequence that is downstream of the third mH5 promoter in the expression cassette exhibits sequence similarity to a hIL-12 nucleotide sequence (a 2nd encoded heterologous polypeptide) as evidenced by sequence similarity searches to SEQ ID NO: 4 of Medin et al (US 10,258,653; the sequence of nucleotides 236-2791 of SEQ ID NO: 4 displays 55% sequence identity to the sequence of nucleotides 1392-3810 in SEQ ID NO: 2 of the present application) and SEQ ID NO: 7 of Anderson et al (US 5,994,104; the sequence of nucleotides 3193-4934 of SEQ ID NO: 7 exhibits 40.2% sequence identity of nucleotides 1817-3546 in SEQ ID NO: 2 of the present application) (see attached sequence searches below). Accordingly, the as-filed specification does not have a written support for the limitation recited in currently amended claims 27-29 and 31-43. The fact that the person of ordinary skill in the art could have carried out the claimed invention without undue experimentation based on applicants’ disclosure is inadequate to meet this requirement. “The Federal Circuit has pointed out that, under United States law, a description that merely renders a claimed invention obvious may not sufficiently describe the invention for the purposes of the written description requirement of 35 U.S.C. 112.” MPEP § 2163, part (I)(A). Therefore, given the lack of sufficient guidance provided by the originally filed specification, it would appear that Applicants did not contemplate or have possession of invention as now claimed at the time the application was filed. Claim Rejections - 35 USC § 112 (Lack of Written Description) Amended claims 27-29 and 31-43 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a new ground of rejection necessitated by Applicant’s amendment. MPEP 2163 - 35 U.S.C. 112(a) and the first paragraph of pre-AIA 35 U.S.C. 112 require that the “specification shall contain a written description of the invention ....” This requirement is separate and distinct from the enablement requirement. Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1340, 94 USPQ2d 1161, 1167 (Fed. Cir. 2010) (en banc). Vas-Cath Inc. v. Mahurkar, 19USPQ2d 1111 (Fed. Cir. 1991), clearly states that “applicant must convey with reasonable clarity to those skilled in the art that, as of the filing date sought, he or she was in possession of the invention. The invention is, for purposes of the ‘written description’ inquiry, whatever is now claimed.” Vas-Cath Inc. v. Mahurkar, 19USPQ2d at 1117. The specification does not “clearly allow persons of ordinary skill in the art to recognize that [he or she] invented what is claimed. ”Vas-Cath Inc. v. Mahurkar, 19USPQ2d at 1116. The instant claims encompass a thymidine kinase (TK)-deficient vaccinia virus comprising an inactivated N1L gene, wherein the N1L gene is inactivated by the insertion of a single expression cassette, said expression cassette comprising a nucleic acid sequence, said nucleic acid sequence encoding a single heterologous polypeptide, and wherein the nucleic acid sequence comprises three vaccinia virus promoters positioned in the same orientation, wherein the orientation of the vaccinia virus promoters is opposite to that of the adjacent intact reading frame L024, wherein the TK-deficient vaccinia virus contains intact L024 coding sequence, and wherein the vaccinia virus promoters are modified H5 promoters, and the expression cassette comprising the three modified H5 promoters comprises a polynucleotide of any length (e.g., 5-, 10-, 25-, 50-, 100-, 1000-, 2000-, 3000- or more nucleotides), and not necessarily limited to the full-length nucleotide sequence of SEQ ID NO: 2 (4,102-nucleotide sequence); a method of treating cancer in a subject or a method of treating cancer using the same vaccinia virus. Apart from disclosing the expression cassette of SEQ ID NO: 2 comprising three mH5 promoters, and it appears that the expression cassette comprises: (i) three mH5 promoters; (ii) a reporter RFP (Red Fluorescent Protein) gene (a 1st encoded heterologous polypeptide) located between the second and the third mH5 promoters (each mH5 promoter has the mH5 sequence listed in Fig. 1 of the instant application) and operably linked to the second mH5 promoter; and (iii) the nucleotide sequence that is downstream of the third mH5 promoter in the expression cassette exhibits sequence similarity to a hIL-12 nucleotide sequence (a 2nd encoded heterologous polypeptide) as evidenced by sequence similarity searches to SEQ ID NO: 4 of Medin et al (US 10,258,653; the sequence of nucleotides 236-2791 of SEQ ID NO: 4 displays 55% sequence identity to the sequence of nucleotides 1392-3810 in SEQ ID NO: 2 of the present application) and SEQ ID NO: 7 of Anderson et al (US 5,994,104; the sequence of nucleotides 3193-4934 of SEQ ID NO: 7 exhibits 40.2% sequence identity of nucleotides 1817-3546 in SEQ ID NO: 2 of the present application) (see at least Figures 1-3; Example 1; and attached sequence searches below); the instant specification failed to describe any other expression cassette comprising the three mH5 promoters and a nucleic acid sequence encoding a single heterologous polypeptide (e.g., GM-CSF, IL-10, IL-12, IL-21 or any other cytokine) as long as the expression cassette comprises any nucleotide sequence of any length (e.g., 5-, 10-, 25-, 50-, 100-, 1000-, 2000-, 3000- or more nucleotides), and including the full-length sequence of SEQ ID NO: 2 to be inserted for inactivation of an N1L gene in a TK-deficient vaccina virus as encompassed broadly by the instant claims. For example, which specific nucleotide sequence with a length of 10-, 25-, 100-, 250-, 500-, 1000-, 2000- or more nucleotides in the sequence of SEQ ID NO: 2 constitutes an expression cassette comprising three mH5 promoters and a nucleic acid sequence encoding a single heterologous polypeptide, let alone the single heterologous polypeptide is any cytokine such as GM-CSF, IL-10, IL-12 and IL-21 as encompassed broadly by the instant claims? Moreover, even with the disclosed expression cassette with the full-length sequence of SEQ ID NO:2 that apparently contains three mH5 promoters and nucleic acid sequences encoding two distinct heterologous polypeptides namely the reporter Red Fluorescent Protein (RFP) and IL-12 polypeptide; and not a single heterologous polypeptide as required by the instant claims. Since the prior art before the effective filing date of the present application (04/01/2014) failed to provide sufficient guidance and/or written description for the above issues as evidenced at least by the teachings of Kirn (WO 2007/030668; IDS), Meador et al (US 5,547,862; IDS), Diamond et al (US 8,580,276; IDS), Chakrabarti et al (BioTechniques 23:1094-1097, 1997) and Chen et al (US 2009/0098529; IDS); it is incumbent upon the instant specification to do so. Furthermore, the instant specification also fails to provide and describe at least a representative number of species for a broad genus of an expression cassette containing three modified H5 promoters that comprises a nucleotide sequence of SEQ ID NO:2, and wherein said expression cassette comprises a nucleic acid sequence encoding a single heterologous polypeptide, in a TK-deficient vaccinia virus with an inactivated N1L gene as claimed broadly. The claimed invention as a whole is not adequately described if the claims require essential or critical elements which are not adequately described in the specification and which are not conventional in the art as of Applicants’ filing date. Possession may be shown by actual reduction to practice, clear depiction of the invention in a detailed drawing, or by describing the invention with sufficient relevant identifying characteristics such that a person skilled in the art would recognize that the inventor had possession of the claimed invention. Pfaff v. Wells Electronics, Inc., 48 USPQ2d 1641, 1646 (1998). The skilled artisan cannot envision at least a representative number of species for a broad genus of an expression cassette containing three modified H5 promoters that comprises a nucleotide sequence of SEQ ID NO:2, and wherein said expression cassette comprises a nucleic acid sequence encoding a single heterologous polypeptide, in a TK-deficient vaccinia virus with an inactivated N1L gene as claimed broadly; and therefore conception is not achieved until reduction to practice has occurred, regardless of the complexity or simplicity of the method. Adequate written description requires more than a mere statement that it is part of the invention and reference to a potential method of isolating it. See Fiers v. Revel, 25 USPQ2d 1601, 1606 (Fed. Cir. 1993) and Amgen Inc. v. Chugai Pharmaceutical Co. Ltd., 18 USPQ2d 1016 (Fed. Cir. 1991). One cannot describe what one has not conceived. See Fiddes v. Baird, 30 USPQ2d 1481, 1483. Applicant is reminded that Vas-Cath makes clear that the written description provision of 35 U.S.C. §112 is severable from its enablement provision (see page 1115). The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claim 41 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 41 recites the limitation "the gene therapy" in line 1 of the claim. There is insufficient antecedent basis for this limitation in the claim. This is because prior to this limitation and in claim 37 from which claim 41 is dependent upon, there is no recitation of any gene therapy. Accordingly, it is unclear which particular gene therapy that the limitation refers to. Clarification is requested because the metes and bounds of the claim are not clearly determined. Conclusions No claim is allowed. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Quang Nguyen, Ph.D., at (571) 272-0776. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s SPE, James Douglas (Doug) Schultz, Ph.D., may be reached at (571) 272-0763. To aid in correlating any papers for this application, all further correspondence regarding this application should be directed to Group Art Unit 1631; Central Fax No. (571) 273-8300. Any inquiry of a general nature or relating to the status of this application or proceeding should be directed to (571) 272-0547. Patent applicants with problems or questions regarding electronic images that can be viewed in the Patent Application Information Retrieval system (PAIR) can now contact the USPTO’s Patent Electronic Business Center (Patent EBC) for assistance. Representatives are available to answer your questions daily from 6 am to midnight (EST). The toll-free number is (866) 217-9197. When calling please have your application serial or patent number, the type of document you are having an image problem with, the number of pages and the specific nature of the problem. The Patent Electronic Business Center will notify applicants of the resolution of the problem within 5-7 business days. Applicants can also check PAIR to confirm that the problem has been corrected. The USPTO’s Patent Electronic Business Center is a complete service center supporting all patent business on the Internet. The USPTO’s PAIR system provides Internet-based access to patent application status and history information. It also enables applicants to view the scanned images of their own application file folder(s) as well as general patent information available to the public. /QUANG NGUYEN/ Primary Examiner, Art Unit 1631 Sequence 4, Patent No. 10258653 Synthetic Construct (pORF-hIL-12 Sequence) Query Match 55.0%; Score 2257.6; Length 5048; Best Local Similarity 94.3%; Matches 2410; Conservative 0; Mismatches 9; Indels 137; Gaps 1; Qy 1392 ATCATAAATAAAGCTTCGAGGGGCTCGCATCTCTCCTTCACGCGCCCGCCGCCCTACCTG 1451 | || | | |||||||||||||||||||||||||||||||||||||||||||||||||| Db 236 AACACAGCTGAAGCTTCGAGGGGCTCGCATCTCTCCTTCACGCGCCCGCCGCCCTACCTG 295 Qy 1452 AGGCCGCCATCCACGCCGGTTGAGTCGCGTTCTGCCGCCTCCCGCCTGTGGTGCCTCCTG 1511 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 296 AGGCCGCCATCCACGCCGGTTGAGTCGCGTTCTGCCGCCTCCCGCCTGTGGTGCCTCCTG 355 Qy 1512 AACTGCGTCCGCCGTCTAGGTAAGTTTAAAGCTCAGGTCGAGACCGGGCCTTTGTCCGGC 1571 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 356 AACTGCGTCCGCCGTCTAGGTAAGTTTAAAGCTCAGGTCGAGACCGGGCCTTTGTCCGGC 415 Qy 1572 GCTCCCTTGGAGCCTACCTAGACTCAGCCGGCTCTCCACGCTTTGCCTGACCCTGCTTGC 1631 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 416 GCTCCCTTGGAGCCTACCTAGACTCAGCCGGCTCTCCACGCTTTGCCTGACCCTGCTTGC 475 Qy 1632 TCAACTCTACGTCTTTGTTTCGTTTTCTGTTCTGCGCCGTTACAGATCCAAGCTGTGACC 1691 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 476 TCAACTCTACGTCTTTGTTTCGTTTTCTGTTCTGCGCCGTTACAGATCCAAGCTGTGACC 535 Qy 1692 GGCGCCTACGTAAGTGATATCTACTAGATTTATCAAAAAGAGTGTTGACTTGTGAGCGCT 1751 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 536 GGCGCCTACGTAAGTGATATCTACTAGATTTATCAAAAAGAGTGTTGACTTGTGAGCGCT 595 Qy 1752 CACAATTGATACTTAGATTCATCGAGAGGGACACGTCGACTACTAACCTTCTTCTCTTTC 1811 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 596 CACAATTGATACTTAGATTCATCGAGAGGGACACGTCGACTACTAACCTTCTTCTCTTTC 655 Qy 1812 CTACAGCTGAGATCACCGGCGAAGGAGGGCCACCATGGGTCACCAGCAGTTGGTCATCTC 1871 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 656 CTACAGCTGAGATCACCGGCGAAGGAGGGCCACCATGGGTCACCAGCAGTTGGTCATCTC 715 Qy 1872 TTGGTTTTCCCTGGTTTTTCTGGCATCTCCCCTCGTGGCCATATGGGAACTGAAGAAAGA 1931 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 716 TTGGTTTTCCCTGGTTTTTCTGGCATCTCCCCTCGTGGCCATATGGGAACTGAAGAAAGA 775 Qy 1932 TGTTTATGTCGTAGAATTGGATTGGTATCCGGATGCCCCTGGAGAAATGGTGGTCCTCAC 1991 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 776 TGTTTATGTCGTAGAATTGGATTGGTATCCGGATGCCCCTGGAGAAATGGTGGTCCTCAC 835 Qy 1992 CTGTGACACCCCTGAAGAAGATGGTATCACCTGGACCTTGGACCAGAGCAGTGAGGTCTT 2051 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 836 CTGTGACACCCCTGAAGAAGATGGTATCACCTGGACCTTGGACCAGAGCAGTGAGGTCTT 895 Qy 2052 AGGCTCTGGCAAAACCCTGACCATCCAAGTCAAAGAGTTTGGAGATGCTGGCCAGTACAC 2111 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 896 AGGCTCTGGCAAAACCCTGACCATCCAAGTCAAAGAGTTTGGAGATGCTGGCCAGTACAC 955 Qy 2112 CTGTCACAAAGGAGGCGAGGTTCTAAGCCATTCGCTCCTGCTGCTTCACAAAAAGGAAGA 2171 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 956 CTGTCACAAAGGAGGCGAGGTTCTAAGCCATTCGCTCCTGCTGCTTCACAAAAAGGAAGA 1015 Qy 2172 TGGAATTTGGTCCACTGATATTTTAAAGGACCAGAAAGAACCCAAAAATAAGACCTTTCT 2231 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1016 TGGAATTTGGTCCACTGATATTTTAAAGGACCAGAAAGAACCCAAAAATAAGACCTTTCT 1075 Qy 2232 AAGATGCGAGGCCAAGAATTATTCTGGACGTTTCACCTGCTGGTGGCTGACGACAATCAG 2291 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1076 AAGATGCGAGGCCAAGAATTATTCTGGACGTTTCACCTGCTGGTGGCTGACGACAATCAG 1135 Qy 2292 TACTGATTTGACATTCAGTGTCAAAAGCAGCAGAGGCTCTTCTGACCCCCAAGGGGTGAC 2351 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1136 TACTGATTTGACATTCAGTGTCAAAAGCAGCAGAGGCTCTTCTGACCCCCAAGGGGTGAC 1195 Qy 2352 GTGCGGAGCTGCTACACTCTCTGCAGAGAGAGTCAGAGGGGACAACAAGGAGTATGAGTA 2411 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1196 GTGCGGAGCTGCTACACTCTCTGCAGAGAGAGTCAGAGGGGACAACAAGGAGTATGAGTA 1255 Qy 2412 CTCAGTGGAGTGCCAGGAGGACAGTGCCTGCCCAGCTGCTGAGGAGAGTCTGCCCATTGA 2471 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1256 CTCAGTGGAGTGCCAGGAGGACAGTGCCTGCCCAGCTGCTGAGGAGAGTCTGCCCATTGA 1315 Qy 2472 GGTCATGGTGGATGCCGTTCACAAGCTCAAGTATGAAAACTACACCAGCAGCTTCTTCAT 2531 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1316 GGTCATGGTGGATGCCGTTCACAAGCTCAAGTATGAAAACTACACCAGCAGCTTCTTCAT 1375 Qy 2532 CAGGGACATCATCAAACCTGACCCACCCAAGAACTTGCAGCTGAAGCCATTAAAGAATTC 2591 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1376 CAGGGACATCATCAAACCTGACCCACCCAAGAACTTGCAGCTGAAGCCATTAAAGAATTC 1435 Qy 2592 TCGGCAGGTGGAGGTCAGCTGGGAGTACCCTGACACCTGGAGTACTCCACATTCCTACTT 2651 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1436 TCGGCAGGTGGAGGTCAGCTGGGAGTACCCTGACACCTGGAGTACTCCACATTCCTACTT 1495 Qy 2652 CTCCCTGACATTCTGCGTTCAGGTCCAGGGCAAGAGCAAGAGAGAAAAGAAAGATAGAGT 2711 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1496 CTCCCTGACATTCTGCGTTCAGGTCCAGGGCAAGAGCAAGAGAGAAAAGAAAGATAGAGT 1555 Qy 2712 CTTCACGGACAAGACCTCAGCCACGGTCATCTGCCGCAAAAATGCCAGCATTAGCGTGCG 2771 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1556 CTTCACGGACAAGACCTCAGCCACGGTCATCTGCCGCAAAAATGCCAGCATTAGCGTGCG 1615 Qy 2772 GGCCCAGGACCGCTACTATAGCTCATCTTGGAGCGAATGGGCATCTGTGCCCTGCAGTGT 2831 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1616 GGCCCAGGACCGCTACTATAGCTCATCTTGGAGCGAATGGGCATCTGTGCCCTGCAGTGT 1675 Qy 2832 TCCTGGAGTAGGGGTACCTGGGGTGGGCGCCAGAAACCTCCCCGTGGCCACTCCAGACCC 2891 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1676 TCCTGGAGTAGGGGTACCTGGGGTGGGCGCCAGAAACCTCCCCGTGGCCACTCCAGACCC 1735 Qy 2892 AGGAATGTTCCCATGCCTTCACCACTCCCAAAACCTGCTGAGGGCCGTCAGCAACATGCT 2951 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1736 AGGAATGTTCCCATGCCTTCACCACTCCCAAAACCTGCTGAGGGCCGTCAGCAACATGCT 1795 Qy 2952 CCAGAAGGCCAGACAAACTCTAGAATTTTACCCTTGCACTTCTGAAGAGATTGATCATGA 3011 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1796 CCAGAAGGCCAGACAAACTCTAGAATTTTACCCTTGCACTTCTGAAGAGATTGATCATGA 1855 Qy 3012 AGATATCACAAAAGATAAAACCAGCACAGTGGAGGCCTGTTTACCATTGGAATTAACCAA 3071 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1856 AGATATCACAAAAGATAAAACCAGCACAGTGGAGGCCTGTTTACCATTGGAATTAACCAA 1915 Qy 3072 GAATGAGAGTTGCCTAAATTCCAGAGAGACCTCTTTCATAACTAATGGGAGTTGCCTGGC 3131 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1916 GAATGAGAGTTGCCTAAATTCCAGAGAGACCTCTTTCATAACTAATGGGAGTTGCCTGGC 1975 Qy 3132 CTCCAGAAAGACCTCTTTTATGATGGCCCTGTGCCTTAGTAGTATTTATGAAGACTTGAA 3191 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Db 1976 CTCCAGAAAGACCTCTTTTATGATGGCCCTGTGCCTTAGTAGTATTTATGAAGACTCGAA 2035 Qy 3192 GATGTACCAGGTGGAGTTCAAGACCATGAATGCAAAGCTGCTGATGGATCCTAAGAGGCA 3251 ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| Db 2036 GATGTACCAGGTGGAGTTCAAGACCATGAATGCAAAGCTTCTGATGGATCCTAAGAGGCA 2095 Qy 3252 GATCTTTCTAGATCAAAACATGCTGGCAGTTATTGATGAGCTGATGCAGGCCCTGAATTT 3311 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2096 GATCTTTCTAGATCAAAACATGCTGGCAGTTATTGATGAGCTGATGCAGGCCCTGAATTT 2155 Qy 3312 CAACAGTGAGACTGTGCCACAAAAATCCTCCCTTGAAGAACCGGATTTTTATAAAACTAA 3371 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2156 CAACAGTGAGACTGTGCCACAAAAATCCTCCCTTGAAGAACCGGATTTTTATAAAACTAA 2215 Qy 3372 AATCAAGCTCTGCATACTTCTTCATGCTTTCAGAATTCGGGCAGTGACTATTGATAGAGT 3431 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2216 AATCAAGCTCTGCATACTTCTTCATGCTTTCAGAATTCGGGCAGTGACTATTGATAGAGT 2275 Qy 3432 GATGAGCTATCTGAATGCTTCCTAAAAAGCGAGGTCCCTCCAAACCGTTGTCATTTTTAT 3491 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2276 GATGAGCTATCTGAATGCTTCCTAAAAAGCGAGGTCCCTCCAAACCGTTGTCATTTTTAT 2335 Qy 3492 AAAACTTTGAAATGAGGAAACTTTGATAGGATGTGGATTAAGAACTAGGGAGGGG----- 3546 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2336 AAAACTTTGAAATGAGGAAACTTTGATAGGATGTGGATTAAGAACTAGGGAGGGGGAAAG 2395 Qy 3547 ------------------------------------------------------------ 3546 Db 2396 AAGGATGGGACTATTACATCCACATGATACCTCTGATCAAGTATTTTTGACATTTACTGT 2455 Qy 3547 ------------------------------------------------------------ 3546 Db 2456 GGATAAATTGTTTTTAAGTTTTCATGAATGAATTGCTAAGAAGGGGGGAATTCTTTTGCT 2515 Qy 3547 ------------CTAGCTCGACATGATAAGATACATTGATGAGTTTGGACAAACCACAAC 3594 |||||||||||||||||||||||||||||||||||||||||||||||| Db 2516 TTTTACCCTCGACTAGCTCGACATGATAAGATACATTGATGAGTTTGGACAAACCACAAC 2575 Qy 3595 TAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGT 3654 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2576 TAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATGCTATTGCTTTATTTGT 2635 Qy 3655 GAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAAC 3714 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2636 GAAATTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAAC 2695 Qy 3715 AACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAA 3774 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2696 AACAACAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAA 2755 Qy 3775 AGCAAGTAAAACCTCTACAAATGTGGTAGATCCATT 3810 |||||||||||||||||||||||||||||||| || Db 2756 AGCAAGTAAAACCTCTACAAATGTGGTAGATCATTT 2791 Sequence 7, INTERLUKIN-12 FUSION PROTEIN Patent No. 5994104 Query Match 40.2%; Score 1650.4; Length 6139; Best Local Similarity 97.2%; Matches 1694; Conservative 0; Mismatches 36; Indels 12; Gaps 1; Qy 1817 GCTGAGATCACCGGCGAAGGAGGGCCACCATGGGTCACCAGCAGTTGGTCATCTCTTGGT 1876 | | || |||| | | | |||||||||||||||||||||||||||||||||| Db 3193 GTTTAGTGAACCGTCAGATCCGCTAGACCATGGGTCACCAGCAGTTGGTCATCTCTTGGT 3252 Qy 1877 TTTCCCTGGTTTTTCTGGCATCTCCCCTCGTGGCCATATGGGAACTGAAGAAAGATGTTT 1936 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3253 TTTCCCTGGTTTTTCTGGCATCTCCCCTCGTGGCCATATGGGAACTGAAGAAAGATGTTT 3312 Qy 1937 ATGTCGTAGAATTGGATTGGTATCCGGATGCCCCTGGAGAAATGGTGGTCCTCACCTGTG 1996 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3313 ATGTCGTAGAATTGGATTGGTATCCGGATGCCCCTGGAGAAATGGTGGTCCTCACCTGTG 3372 Qy 1997 ACACCCCTGAAGAAGATGGTATCACCTGGACCTTGGACCAGAGCAGTGAGGTCTTAGGCT 2056 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3373 ACACCCCTGAAGAAGATGGTATCACCTGGACCTTGGACCAGAGCAGTGAGGTCTTAGGCT 3432 Qy 2057 CTGGCAAAACCCTGACCATCCAAGTCAAAGAGTTTGGAGATGCTGGCCAGTACACCTGTC 2116 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3433 CTGGCAAAACCCTGACCATCCAAGTCAAAGAGTTTGGAGATGCTGGCCAGTACACCTGTC 3492 Qy 2117 ACAAAGGAGGCGAGGTTCTAAGCCATTCGCTCCTGCTGCTTCACAAAAAGGAAGATGGAA 2176 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3493 ACAAAGGAGGCGAGGTTCTAAGCCATTCGCTCCTGCTGCTTCACAAAAAGGAAGATGGAA 3552 Qy 2177 TTTGGTCCACTGATATTTTAAAGGACCAGAAAGAACCCAAAAATAAGACCTTTCTAAGAT 2236 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3553 TTTGGTCCACTGATATTTTAAAGGACCAGAAAGAACCCAAAAATAAGACCTTTCTAAGAT 3612 Qy 2237 GCGAGGCCAAGAATTATTCTGGACGTTTCACCTGCTGGTGGCTGACGACAATCAGTACTG 2296 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3613 GCGAGGCCAAGAATTATTCTGGACGTTTCACCTGCTGGTGGCTGACGACAATCAGTACTG 3672 Qy 2297 ATTTGACATTCAGTGTCAAAAGCAGCAGAGGCTCTTCTGACCCCCAAGGGGTGACGTGCG 2356 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3673 ATTTGACATTCAGTGTCAAAAGCAGCAGAGGCTCTTCTGACCCCCAAGGGGTGACGTGCG 3732 Qy 2357 GAGCTGCTACACTCTCTGCAGAGAGAGTCAGAGGGGACAACAAGGAGTATGAGTACTCAG 2416 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3733 GAGCTGCTACACTCTCTGCAGAGAGAGTCAGAGGGGACAACAAGGAGTATGAGTACTCAG 3792 Qy 2417 TGGAGTGCCAGGAGGACAGTGCCTGCCCAGCTGCTGAGGAGAGTCTGCCCATTGAGGTCA 2476 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3793 TGGAGTGCCAGGAGGACAGTGCCTGCCCAGCTGCTGAGGAGAGTCTGCCCATTGAGGTCA 3852 Qy 2477 TGGTGGATGCCGTTCACAAGCTCAAGTATGAAAACTACACCAGCAGCTTCTTCATCAGGG 2536 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3853 TGGTGGATGCCGTTCACAAGCTCAAGTATGAAAACTACACCAGCAGCTTCTTCATCAGGG 3912 Qy 2537 ACATCATCAAACCTGACCCACCCAAGAACTTGCAGCTGAAGCCATTAAAGAATTCTCGGC 2596 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3913 ACATCATCAAACCTGACCCACCCAAGAACTTGCAGCTGAAGCCATTAAAGAATTCTCGGC 3972 Qy 2597 AGGTGGAGGTCAGCTGGGAGTACCCTGACACCTGGAGTACTCCACATTCCTACTTCTCCC 2656 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3973 AGGTGGAGGTCAGCTGGGAGTACCCTGACACCTGGAGTACTCCACATTCCTACTTCTCCC 4032 Qy 2657 TGACATTCTGCGTTCAGGTCCAGGGCAAGAGCAAGAGAGAAAAGAAAGATAGAGTCTTCA 2716 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4033 TGACATTCTGCGTTCAGGTCCAGGGCAAGAGCAAGAGAGAAAAGAAAGATAGAGTCTTCA 4092 Qy 2717 CGGACAAGACCTCAGCCACGGTCATCTGCCGCAAAAATGCCAGCATTAGCGTGCGGGCCC 2776 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4093 CGGACAAGACCTCAGCCACGGTCATCTGCCGCAAAAATGCCAGCATTAGCGTGCGGGCCC 4152 Qy 2777 AGGACCGCTACTATAGCTCATCTTGGAGCGAATGGGCATCTGTGCCCTGCAGTGTTCCTG 2836 |||||||||||||||||||||||||||||||||||||||||||||||||||||| | | Db 4153 AGGACCGCTACTATAGCTCATCTTGGAGCGAATGGGCATCTGTGCCCTGCAGTGGTGGCG 4212 Qy 2837 GAGTAGGGGTACCT------------GGGGTGGGCGCCAGAAACCTCCCCGTGGCCACTC 2884 | | | | | | || | ||| ||||||||||||| ||||||||| Db 4213 GTGGAAGCGGCGGTGGCGGAAGCGGCGGTGGCGGCAGCAGAAACCTCCCCCTGGCCACTC 4272 Qy 2885 CAGACCCAGGAATGTTCCCATGCCTTCACCACTCCCAAAACCTGCTGAGGGCCGTCAGCA 2944 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4273 CAGACCCAGGAATGTTCCCATGCCTTCACCACTCCCAAAACCTGCTGAGGGCCGTCAGCA 4332 Qy 2945 ACATGCTCCAGAAGGCCAGACAAACTCTAGAATTTTACCCTTGCACTTCTGAAGAGATTG 3004 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4333 ACATGCTCCAGAAGGCCAGACAAACTCTAGAATTTTACCCTTGCACTTCTGAAGAGATTG 4392 Qy 3005 ATCATGAAGATATCACAAAAGATAAAACCAGCACAGTGGAGGCCTGTTTACCATTGGAAT 3064 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4393 ATCATGAAGATATCACAAAAGATAAAACCAGCACAGTGGAGGCCTGTTTACCATTGGAAT 4452 Qy 3065 TAACCAAGAATGAGAGTTGCCTAAATTCCAGAGAGACCTCTTTCATAACTAATGGGAGTT 3124 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4453 TAACCAAGAATGAGAGTTGCCTAAATTCCAGAGAGACCTCTTTCATAACTAATGGGAGTT 4512 Qy 3125 GCCTGGCCTCCAGAAAGACCTCTTTTATGATGGCCCTGTGCCTTAGTAGTATTTATGAAG 3184 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4513 GCCTGGCCTCCAGAAAGACCTCTTTTATGATGGCCCTGTGCCTTAGTAGTATTTATGAAG 4572 Qy 3185 ACTTGAAGATGTACCAGGTGGAGTTCAAGACCATGAATGCAAAGCTGCTGATGGATCCTA 3244 |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Db 4573 ACTTGAAGATGTACCAGGTGGAGTTCAAGACCATGAATGCAAAGCTTCTGATGGATCCTA 4632 Qy 3245 AGAGGCAGATCTTTCTAGATCAAAACATGCTGGCAGTTATTGATGAGCTGATGCAGGCCC 3304 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4633 AGAGGCAGATCTTTCTAGATCAAAACATGCTGGCAGTTATTGATGAGCTGATGCAGGCCC 4692 Qy 3305 TGAATTTCAACAGTGAGACTGTGCCACAAAAATCCTCCCTTGAAGAACCGGATTTTTATA 3364 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4693 TGAATTTCAACAGTGAGACTGTGCCACAAAAATCCTCCCTTGAAGAACCGGATTTTTATA 4752 Qy 3365 AAACTAAAATCAAGCTCTGCATACTTCTTCATGCTTTCAGAATTCGGGCAGTGACTATTG 3424 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4753 AAACTAAAATCAAGCTCTGCATACTTCTTCATGCTTTCAGAATTCGGGCAGTGACTATTG 4812 Qy 3425 ATAGAGTGATGAGCTATCTGAATGCTTCCTAAAAAGCGAGGTCCCTCCAAACCGTTGTCA 3484 | ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Db 4813 ACAGAGTGACGAGCTATCTGAATGCTTCCTAAAAAGCGAGGTCCCTCCAAACCGTTGTCA 4872 Qy 3485 TTTTTATAAAACTTTGAAATGAGGAAACTTTGATAGGATGTGGATTAAGAACTAGGGAGG 3544 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4873 TTTTTATAAAACTTTGAAATGAGGAAACTTTGATAGGATGTGGATTAAGAACTAGGGAGG 4932 Qy 3545 GG 3546 || Db 4933 GG 4934
Read full office action

Prosecution Timeline

Jan 18, 2023
Application Filed
Sep 19, 2024
Non-Final Rejection — §112
Jan 17, 2025
Response Filed
Mar 13, 2025
Final Rejection — §112
May 13, 2025
Response after Non-Final Action
Jul 15, 2025
Examiner Interview Summary
Aug 12, 2025
Request for Continued Examination
Aug 13, 2025
Response after Non-Final Action
Sep 25, 2025
Non-Final Rejection — §112
Jan 28, 2026
Response Filed
Mar 13, 2026
Final Rejection — §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12454689
INTEGRATION OF MESA RECEPTORS AND PROMOTORS TO IMPLEMENT CUSTOMIZED CELLULAR FUNCTION
2y 5m to grant Granted Oct 28, 2025
Patent 12454702
MINIGENE THERAPY
2y 5m to grant Granted Oct 28, 2025
Patent 12448426
CHIMERIC ANTIGEN RECEPTORS WITH MYD88 AND CD40 COSTIMULATORY DOMAINS
2y 5m to grant Granted Oct 21, 2025
Patent 12385048
CONSTRUCT AND SEQUENCE FOR ENHANCED GENE EXPRESSION
2y 5m to grant Granted Aug 12, 2025
Patent 12371474
RECOMBINANT ADENO-ASSOCIATED VIRAL VECTORS FOR TREATING BIETTI CRYSTALLINE DYSTROPHY
2y 5m to grant Granted Jul 29, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

5-6
Expected OA Rounds
38%
Grant Probability
91%
With Interview (+52.7%)
3y 11m
Median Time to Grant
High
PTA Risk
Based on 734 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month