Prosecution Insights
Last updated: May 29, 2026
Application No. 18/157,434

Methods and Compositions for Detecting Virulent and Avirulent Escherichia coli Strains

Final Rejection §102§103§112§DOUBLEPATENT
Filed
Jan 20, 2023
Priority
Jan 20, 2022 — provisional 63/301,236
Examiner
KIM, YOUNG J
Art Unit
1681
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
The Florida State University Research Foundation, Inc.
OA Round
2 (Final)
65%
Grant Probability
Moderate
3-4
OA Rounds
0m
Est. Remaining
83%
With Interview

Examiner Intelligence

Grants 65% of resolved cases
65%
Career Allowance Rate
717 granted / 1107 resolved
+4.8% vs TC avg
Strong +18% interview lift
Without
With
+17.9%
Interview Lift
resolved cases with interview
Typical timeline
3y 2m
Avg Prosecution
57 currently pending
Career history
1165
Total Applications
across all art units

Statute-Specific Performance

§101
4.2%
-35.8% vs TC avg
§103
61.4%
+21.4% vs TC avg
§102
6.0%
-34.0% vs TC avg
§112
7.6%
-32.4% vs TC avg
Black line = Tech Center average estimate • Based on career data from 1107 resolved cases

Office Action

§102 §103 §112 §DOUBLEPATENT
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restrictions Applicant's election with traverse of Group I, claims 1-10 in the reply filed on October 2, 2025 is acknowledged. The traversal is on the ground(s) that “the Office Action has not shown that a serious burden would be required to examine all of the claims.” (page 1, Response). This is not found persuasive because the Restriction mailed on August 15, 2025 sufficiently demonstrated that the inventions categorized had: a) acquired a separate status in the art in view of their different classification; b) required different field of search with different search queries; c) one prior art would likely not be appliable to another invention; and d) inventions likely raise different non-prior art issues under 101 and 112, 1st paragraph, all of which would tantamount to an undue search burden (based on the reasons above), and examination burden (for considering and formulating rejections which are directed to different inventions based on different prior art that are not applicable to different inventions, based on different statutes. Applicants’ simple assertion is not demonstrative of negating the above factors and therefore, is not deemed persuasive. The Office also acknowledges Applicants’ request for rejoinder between Groups I and V (page 1, Response). This request has been carefully considered but has been denied because Applicants chose to elect a method claim instead of the product claims (i.e., Group V). Applicants’ right to rejoinder (under In re Ochiai) and instructions to retain said right has been clearly explained in the Restriction mailed on August 15, 2025. Because Applicants opted to choose a method and not a product, the rejoinder right is lost. The requirement is still deemed proper and is therefore made FINAL. Claims 11-53 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to nonelected inventions, there being no allowable generic or linking claim. Applicant timely traversed the restriction (election) requirement in the reply filed on October 2, 2025. Information Disclosure Statement The IDS received on January 30, 2023 and November 2, 2023 are proper and are being considered by the Examiner. Drawings The drawings received on January 20, 2023 are acceptable. The depicted sequences in Figures 3 and 4 are identified by their respective SEQ ID numbers in the specification. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1-10 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 1 recites the phrase, “detecting … using real-time PCR high-resolution melt curve assay or probe-based assay”. It is unclear whether the phrase is reciting an alternative between “real-time PCR high-resolution melt curve assay” and “real-time PCR probe-based assay”; or an alternative between “real-time PCR high-resolution melt curve assay” and probe-based assay (i.e., real-time PCR is not required). For the purpose of prosecution, the latter interpretation is assumed. Claim 3 recites the phrase, “the probe” comprises SEQ ID NO: 11 or 12 or both. This phrase is indefinite for the following reasons. The alignment of SEQ ID NO: 11 and 12 are shown below: SEQ ID NO: 11 cagatattactgaaatacg SEQ ID NO: 12 acagatattgctgaa As seen, SEQ ID NO: 11 and 12 appear to share a common region. While one can adopt the interpretation that a probe comprising both SEQ ID NO: 11 and 12 has the sequence having the extra sequences at the unshared ends (resulting in a total of 20 base sequence), the phrase also embraces a probe sequence which comprises the sequences of SEQ ID NO: 11 and 12 adjacent to each other (resulting in a total of 34 base sequence). Therefore, the phrase is indefinite. Claim 4 indefinite for using the trademark, “TaqMan®.” The Office also notes that claim 4 recites the term, “Sunrise” with capitalization. While the Office cannot verify that the term is a trademarked element, Applicants are advised to remove the term and recite the probe using a generic language. Where a trademark or trade name is used in a claim as a limitation to identify or describe a particular material or product, the claim does not comply with the requirements of 35 U.S.C. 112, second paragraph. See Ex parte Simpson, 218 USPQ 1020 (Bd. App. 1982). The claim scope is uncertain since the trademark or trade name cannot be used properly to identify any particular material or product. A trademark or trade name is used to identify a source of goods, and not the goods themselves. Thus, a trademark or trade name does not identify or describe the goods associated with the trademark or trade name. Claims 2-10 are indefinite by way of their dependency on claim 1. Claim Rejections - 35 USC § 102 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claims 1, 5, and 10 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Quinones et al. (Frontiers in Cellular and Infection Microbiology, May 2012, vol. 2, pages 1-10). The present rejection adopts the “latter interpretation” as discussed in the above 112(b) rejection, that is, the embodiment directed toward the probe-based assay and not requiring the real-time PCR high-resolution melt curve assay (and therefore do not require the primers of SEQ ID NO: 1 and 2). With regard to claim 1, Quinones et al. teach a method of detecting STEC O26 strain in a biological sample (“this microarray-based colorimetric method was … employed to genotype a group of E. coli isolates from watershed sediment and animal fecal samples that were collected from an important region for leafy-vegetable production in the central coast of California”, Abstract), comprising the steps of: enriching bacterial concentration for the biological sample to result in an enriched sample (“[f]or the isolation of STEC isolates from environmental sources … watershed sediment/animal feces were subjected to a non-selective enrichment …”, page 2, 2nd column); isolating DNA from said enriched biological sample (“bacterial cultures of … environmental isolates were grown aerobically in LB broth … aliquots of the bacterial cultures were collected by centrifugation … Cell pellets were resuspended … lysates were centrifuged … the supernatants were collected”, page 3, 2nd column, bottom paragraph to page 4, 1st column, 1st paragraph); and detecting virulent O26 in said isolated DNA using a probe-based assay (i.e., microarray, see “45 ml of PCR amplicons were purified by using the MinElute® PCR purification kit … hybridization mixture was applied to each microarray …”, page 4, 2nd column; see Table 2, O26 probe used on the microarray “WZYO26”; “analysis of the O26 strain RM2016 resulted in polymer formation exclusively where O26 wzy gene probes were spotted on the microarray”, page 5, 1st column, bottom paragraph; see Table 4 detection of O26 strain from environmental isolates”). With regard to claims 5 and 10, the embodiments are directed to performing real-time PCR high-resolution melt curve analysis, which is an alternative that is not actively required in these claims. Therefore, the invention as claimed is anticipated by Quinones et al. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 1-4 are rejected under 35 U.S.C. 103 as being unpatentable over Harada et al. (Journal of Food Protection, 2015, vol. 78, no. 10, pages 1800-1811) in view of Bono et al. (US 8,900,809, issued December 2014). The present rejection adopts the “latter interpretation” as discussed in the above 112(b) rejection, that is, the embodiment directed toward the probe-based assay and not requiring the real-time PCR high-resolution melt curve assay (and therefore do not require the primers of SEQ ID NO: 1 and 2). With regard to claims 1, 2, and 4, Harada et al. teach a method of detecting virulent Shiga toxin-producing E. coli (STEC) O26 strain in a biological sample (“we have developed multiplex real-time PCR assays for targeting Stx1 and Stx2 genes, including all stx-subtype genes, and E. coli O26-, O111-, and O157-specific genes and evaluated the specificity and quantitative accuracy of these assays”, page 1801, 2nd column) comprising the steps of: enriching bacterial concentration of the biological sample to result in an enriched sample (“[t]wenty-five grams of each food sample was added to 225 ml of modified EC (mEC) medium … incubated at 42oC”, page 1803, 2nd column); isolating DNA from said enriched biological sample (“real-time PCR assay were performed using the DNA templates from the mEC enrichment cultures”, page 1803, 2nd column); and detecting the virulent O26 in the isolated DNA sample using probe-based assay (that is, PCR in combination with molecular beacon probe, see “real-time PCR assay were used using the DNA templates”, page 1803, 2nd column; and use of a TaqMan® probe, see Table 2, mixture B having a probes labeled with FRET pair, FAM/HEX with IBFQ). Therefore, the artisans teach a probe-based method that employs a FRET/dual labeled probes which are hydrolyzed during amplification. Harada et al., however do not teach all possible target regions useful detecting the STEC O26 strain. Consequently, the Harada et al. do not each that the TaqMan probe has the sequence of SEQ ID NO: 11. Bono et al., however teach a region (SEQ ID NO: 72) on STEC O26 strain which is useful for detection, wherein the region entirely encompasses SEQ ID NO: 11 (see below alignment): SEQ ID NO: 11 1 CAGATATTACTGAAATACG 19 ||||||||||||||||||| Bono et al. 80 CAGATATTACTGAAATACG 98 “method for determining whether a sample has a Shiga toxin-producing Escherichia coli strain serotype O26 … detecting in a nucleic acid sample isolated from a sample of a genotype indicative of Shiga toxin-producing Escherichia coli serotype O26, wherein the genotype comprises … A at position 88 of SEQ ID NO: 72 … is indicative of Shiga toxin-producing Escherichia coli serotype O26” (column 3, lines 2-18) It would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Harada et al. and Bono et al., thereby arriving at the inventio as claimed for the following reasons. The art of utilizing a TaqMan® real-time PCR to detect STEC O26 strain of in the sample had been well-known in the art. While Harada et al. did not explicitly teach all possible sequence of O26 strain which could be targeted for the detection, one of ordinary skill in the art would have had the requisite knowledge to incorporate other known regions on of O26 which have been known to be useful for the same detection. Indeed, Bono et al. teaches that a detection portion of O26 strains sequence (i.e., SEQ ID NO: 72 of Bono) with the base “A” at position 88 (which aligns and contains all of instant probe of SEQ ID NO: 11) is useful for such a detection. Therefore, one of ordinary skill in the art would have been motivated as well as would have realized that a probe directed to this region would have provided a predictable outcome of STEC O26 specific detection from a sample. For these reasons, the invention as claimed is deemed prima facie obvious over the cited references. Claims 6-9 are rejected under 35 U.S.C. 103 as being unpatentable over Quinones et al. (Frontiers in Cellular and Infection Microbiology, May 2012, vol. 2, pages 1-10) in view of Singh et al. (Food Control, 2019, vol. 96, pages 251-259). The teachings of Quinones et al. have already been discussed above. Quinones et al. do not explicitly teach the samples being assayed as being from food or beverage (claim 6), meat, product, or juice (claim 7), or clinical sample such as stool, urine, or blood (claims 8 and 9). Singh et al. teach a well-known fact that STEC strains causes debilitating and fatal human diseases and such can be present in sources such as water contaminated with fecal matter, food products and beverages (milk, juice, etc.): “Shiga toxin producing Escherichia coli (STEC) are a group of E. coli strains that can produce Shiga toxins and cause debilitating and fatal human diseases … STEC infections has been traced to ruminants, water contaminated with ruminant manure … Food products of cattle origin … raw milk … fruit juice …” (page 251) It would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Quinones et al. and Singh et al., thereby arriving at the invention as claimed because applying the method of Quinones et al. for detecting from sample types which have long been known to be assayed (as explicitly taught by Singh et al.) would have yielded no more than a predictable outcome1 of detecting STEC presence from samples so as diagnose and treat diseases known to cause illness and/or death. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1-10 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 7-12, 67, 71, and 72 of 17/185,077 (issued and accorded the U.S. Patent No. 12,385,100, herein, “the ‘100 patent”)2 in view of Singh et al. (Food Control, 2019, vol. 96, pages 251-259). Although the claims at issue are not identical, they are not patentably distinct from each other as discussed below. With regard to instant claim 1, claims of the ‘100 patent claims a method for detecting virulent STEC O26 strain in a biological sample (“method for discriminating a virulent Shiga toxin-producing E. coli (STEC) O26 strain DNA from an avirulent Shiga-toxin producing E. coli (STEC) O26 strain DNA in a biological sample”, see claim 1), comprising the steps of: enriching bacterial concentration of the biological sample to result in an enriched sample (“enriching bacterial concentration of the biological sample to result in an enriched sample”, see claim 1(i)); isolating DNA from said enriched biological sample (“isolating a DNA from said enriched biological sample”, see claim 1(ii)); and detecting virulent O26 in said isolated DNA sample using real-time PCR high-resolution melt curve assay or probe-based assay; wherein said real-time PCR comprises at least one primer pair, wherein said primer pair comprises SEQ ID NO: 1 and SEQ ID NO: 2 (“hybridizing a target region of the DNA sample to at least one primer pair or at least one probe, wherein the at least one primer pair comprises SEQ ID NO: 1 and SEQ ID NO: 2 … or the at least one probe comprises SEQ ID NO: 11 or SEQ ID N: 12 and the at least one probe discriminates between the virulent STEC O26 DNA and avirulent STEC O26 DNA”, see claim 1(iii); see also claim 7). SEQ ID Number 1 of the ‘100 patent is identical to instant SEQ ID Numbers 1 (see below alignment): ‘100 patent SEQ ID NO: 1 1 GTGGCACTGGTTCTTTTGGT 20 |||||||||||||||||||| Instant SEQ ID NO: 1 1 GTGGCACTGGTTCTTTTGGT 20 SEQ ID NO: 2 of the ‘100 patent is a reverse primer that is used with the identical forward primer of SEQ ID Number 1. However, SEQ ID NO: 2 of the ‘100 patent anneals on a different portion from the instantly claimed reverse primer of SEQ ID NO: 2. Therefore, the ‘100 patent does not teach the claimed pair of primers being SEQ ID NO: 1 and 2. With regard to instant claims 2 and 3, claims of the ‘100 patent claims labeled probes (see claim 71) of SEQ ID NO: 11 and 12 (see claim 55) wherein SEQ ID NO: 11 is identical to instant SEQ ID NO: 11 and 12 aligns with high overlap (see below): SEQ ID NO: 11 cagatattactgaaatacg ||||||||||||||||||| Instant SEQ ID NO: 11 cagatattactgaaatacg SEQ ID NO: 12 cagatattgctgaaatacg |||||||||||||| Instant SEQ ID NO: 12 acagatattgctgaa With regard to instant claim 4, claim 7 of the ‘100 patent claims that the method performs a real-time PCR high resolution melt curve assay on the virulent STEC O26 DNA. With regard to instant claim 5, the amplicons produced in step (iii) comprise a melting temperature differing by 0.2-4oC from avirulent amplicons in real-time PCR high-resolution melt curve assay (“melting temperature between virulent and avirulent O26 DNA differs by 0.2-4oC”, see claim 67). With regard to instant claims 6-9, claims of the ‘100 patent claims also claims as the sample (see claims 8-11). With regard to instant claim 10, claims of the ‘100 patent claims internal amplification controls of SEQ ID NO: 19 and 20 which are identical to instant SEQ ID NO: 19 and 20, and significantly overlaps in SEQ ID NO: 21 (see below): SEQ ID NO: 19 cctcttgcca tcggatgtg |||||||||| ||||||||| Instant SEQ ID NO: 19 cctcttgcca tcggatgtg SEQ ID NO: 20 ggctggtcat cctctcagac c |||||||||| |||||||||| | Instant SEQ ID NO: 20 ggctggtcat cctctcagac c SEQ ID NO: 21 gtggggtaac ggctcaccta ggcgac |||| |||||||||| |||||| Instant SEQ ID NO: 21 taac ggctcaccta ggcgac It would have been prima facie obvious to take the claims of the ‘100 patent, the teachings of Singh et al., and knowledge of the art before the effective filing date of the claimed invention and arrive at the instantly claimed method for the reasons that follow. As discussed above, methods of the ‘100 patent claims a method of distinguishing a virulent and avirulent STEC O26 strains from a biological sample that includes the steps of (i) enrichment; (ii) DNA isolation therefrom; and (iii) detecting the O26 strain based on a real-time PCR high-resolution melt curve assay or a probe-based assay. The art of detecting various strains of pathogens utilizing a melt curve assay has been well established, as evidenced by Singh et al.: “aim of this study was to develop high resolution melt (HRM) curve real-time PCR assays for the detection of seven STEC serogroups (E. coli O145, O121, O157, O26, O45, O103, and O111), virulence genes (stx1 and stx2) …” (page 252, 1st column) “Genomic DNA from all bacterial strains and enriched food samples was isolated …” (page 252, 1st column) “PCR primers used in this stud were designed using Primer 3 software … serogroup-specific … O-antigen gene, and Siga-toxin producing virulence genes (stx1 and stx2) were targeted” (page 252 1st column) “Real-time PCR was performed … A melt curve weas performed at the end of the PCR amplification steps (from 60oC to 95oC, with gradual temperature increments of 0.04oC/s)” (page 253, 1st column) Therefore, all the steps involving as well as assaying/distinguishing between virulent and avirulent STEC O26 strain from samples targeting stx1 and stx2 virulence genes with primers in a real-time PCR high resolution melting point assay have been known and utilized before the effective filing date. Claims of the ‘100 paten provides a primer pair that provides a starting point of the amplification product in the form of a forward primer of SEQ ID NO: 1, which is identical to the instantly claimed forward primer of SEQ ID NO: 1. The sequence of SEQ ID NO: 2, that is, the reverse primer that is to be used with said forward primer aligns to the known gene and they differ between that of the instant reverse primer (SEQ ID NO: 2) and the reverse primer of the ’100 patent (SEQ ID NO: 2) as shown below: ‘100 patent 1 TTTCATCCCTGCTAAATATTCG 22 |||||||||||||||||||||| GenBank AP042605 2885441 TTTCATCCCTGCTAAATATTCG 2885462 Instant SEQ ID NO: 2 1 ACCACGCGTTGCATTTAGAA 20 |||||||||||||||||||| GenBank AP042605 2885340 ACCACGCGTTGCATTTAGAA 2885359 As seen, the amplification product produced from primer pair of the ‘100 patent starts at the same point on the gene and ends 103 bases beyond the amplification product produced form the instantly claimed primer pair. The Office contends that such is an obvious arrival to an alternative amplification product based on the claimed primer pair of the ‘100 patent because the forward primer of the ‘100 patent provided an exact starting point from which to amplify a region which can be used to distinguish between a virulent and an avirulent O26 strain. Given that the template sequence of the O26 strain was known before the effective filing date of the application, one of ordinary skill in the art would have been capable of arriving at additional amplification products of varying lengths that can be used to distinguish between the strains by observing a melting point difference of such amplicons using an empirical determination. Similarly, while of SEQ ID NO: 20 differs between the instant claims and that of the ’100 patent, the difference is minimal due having a significant overlap (see below): SEQ ID NO: 21 gtggggtaac ggctcaccta ggcgac |||| |||||||||| |||||| Instant SEQ ID NO: 21 taac ggctcaccta ggcgac As well, the specification teaches that SEQ ID NO: 21 is a probe designed to anneal to the amplification product produced from the pair of primers SEQ ID NO: 19 and 20 (see section [00102]). Since the pair of primers used by instant application and the ‘100 paten are identical (see below alignment), the amplification product produced would have been identical. And choosing a probe that specifically anneals to the same amplicon would have been well-within the purview of an ordinarily skilled artisans as the number of strain specific regions would have been finite and such would have been discoverable based on routine experimentation, yielding no more than a predictable outcome. Sequence Alignment of forward/reverse primers (SEQ ID NO: 19 & 20) SEQ ID NO: 19 cctcttgcca tcggatgtg |||||||||| ||||||||| Instant SEQ ID NO: 19 cctcttgcca tcggatgtg SEQ ID NO: 20 ggctggtcat cctctcagac c |||||||||| |||||||||| | Instant SEQ ID NO: 20 ggctggtcat cctctcagac c The Supreme Court particularly emphasized “the need for caution in granting a patent based on the combination of elements found in the prior art,” Id. at 415, 82 USPQ2d at 1395, and discussed circumstances in which a patent might be determined to be obvious. Importantly, the Supreme Court reaffirmed principles based on its precedent that “[t]he combination of familiar elements according to known methods is likely to be obvious when it does no more than yield predictable results.” Id. at 415-16, 82 USPQ2d at 1395. The Supreme Court stated that there are “[t]hree cases decided after Graham [that] illustrate this doctrine.” Id. at 416, 82 USPQ2d at 1395. (1) “In United States v. Adams, . . . [t]he Court recognized that when a patent claims a structure already known in the prior art that is altered by the mere substitution of one element for another known in the field, the combination must do more than yield a predictable result.” For these reasons, the claimed invention is obvious over the claims of the ‘100 patent in view of Singh et al. Conclusion No claims are allowed. The combination of using SEQ ID Numbers 19-21 are deemed free of prior art. SEQ ID NO: 19-21 are directed to a primer pair and a probe which is used in combination in the real-time PCR high-resolution melt curve assay and the prior art fails to teach or motivate to amplify the specific region amplified by SEQ ID NO: 19 and 20 and a probe designed to anneal thereto (SEQ ID NO: 21). However, claim 10 is not free of prior art as the claim does not actively require to use real-time PCR high-resolution melt curve assay and that this assay actively employs the combination of the recited SEQ ID Numbers. Inquiries Any inquiry concerning this communication or earlier communications from the Examiner should be directed to Young J. Kim whose telephone number is (571) 272-0785. The Examiner can best be reached from 7:30 a.m. to 4:00 p.m (M-F). The Examiner can also be reached via e-mail to Young.Kim@uspto.gov. However, the office cannot guarantee security through the e-mail system nor should official papers be transmitted through this route. If attempts to reach the Examiner by telephone are unsuccessful, the Examiner's supervisor, Gary Benzion, can be reached at (571) 272-0782. Papers related to this application may be submitted to Art Unit 1681 by facsimile transmission. The faxing of such papers must conform with the notice published in the Official Gazette, 1156 OG 61 (November 16, 1993) and 1157 OG 94 (December 28, 1993) (see 37 CFR 1.6(d)). NOTE: If applicant does submit a paper by FAX, the original copy should be retained by applicant or applicant’s representative. NO DUPLICATE COPIES SHOULD BE SUBMITTED, so as to avoid the processing of duplicate papers in the Office. All official documents must be sent to the Official Tech Center Fax number: (571) 273-8300. Any inquiry of a general nature or relating to the status of this application should be directed to the Group receptionist whose telephone number is (571) 272-1600. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /YOUNG J KIM/Primary Examiner Art Unit 1637 November 17, 2025 /YJK/ 1 “[t]he combination of familiar elements according to known methods is likely to be obvious when it does no more than yield predictable results.” Id. at 415-16, 82 USPQ2d at 1395, KSR 2 The Application has been issued a patent number as recited, but not available. The claims are mapped to the allowed claims in its U.S. Application counter part, having the serial number, 17/185,077.
Read full office action

Prosecution Timeline

Jan 20, 2023
Application Filed
Nov 20, 2025
Non-Final Rejection mailed — §102, §103, §112
Mar 17, 2026
Response Filed
May 27, 2026
Final Rejection mailed — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12637709
Method For Detecting SARS-CoV-Related Betacoronaviruses
3y 10m to grant Granted May 26, 2026
Patent 12631619
USE OF BIOLOGICAL SAMPLE REPRESENTATIVE OF A PASSENGER CABIN ON AN AIRCRAFT TO IDENTIFY ALL KNOWN MICROORGANISMS AND NON-DESCRIBED EMERGING PATHOGENS
4y 6m to grant Granted May 19, 2026
Patent 12630865
PRODUCTS AND PROCESSES FOR MULTIPLEX NUCLEIC ACID IDENTIFICATION
3y 0m to grant Granted May 19, 2026
Patent 12618107
Methods and Enzymatic Compositions for Forming Libraries of Adapter Ligated Nucleic Acid Molecules
4y 6m to grant Granted May 05, 2026
Patent 12612616
SAMPLE PREPARATION APPARATUS AND MULTI-WELL PLATE WITH PCR CHIP
4y 1m to grant Granted Apr 28, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
65%
Grant Probability
83%
With Interview (+17.9%)
3y 2m (~0m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 1107 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month