Methods and Compositions for Detecting Virulent and Avirulent Escherichia coli Strains

Application No. 18/157,434

• Filed: Jan 20, 2023
• Priority: Jan 20, 2022 — provisional 63/301,236
• Examiner: KIM, YOUNG J
• Art Unit: 1681
• Tech Center: 1600 — Biotechnology & Organic Chemistry
• Assignee: The Florida State University Research Foundation Inc.
• OA Round: 2 (Final)

Office Action

DETAILED ACTION
The present Office Action is responsive to the Amendment received on March 17, 2026.
Preliminary Remark
Claims 4 and 11-53 are canceled.
Claim Rejections - 35 USC § 112
The rejection of claims 1-10 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter, made in the Office Action mailed on November 20, 2025 is withdrawn in view of the Amendment received on March 17, 2026.
Claim Rejections - 35 USC § 102
The rejection of claims 1, 5, and 10 under 35 U.S.C. 102(a)(1) as being anticipated by Quinones et al. (Frontiers in Cellular and Infection Microbiology, May 2012, vol. 2, pages 1-10), made in the Office Action mailed on November 20, 2025 is withdrawn in view of the Amendment received on March 17, 2026.
Claim Rejections - 35 USC § 103
The rejection of claims 1-4 under 35 U.S.C. 103 as being unpatentable over Harada et al. (Journal of Food Protection, 2015, vol. 78, no. 10, pages 1800-1811) in view of Bono et al. (US 8,900,809, issued December 2014), made in the Office Action mailed on November 20, 2025 is withdrawn in view of the Amendment received on March 17, 2026.
The rejection of claims 6-9 under 35 U.S.C. 103 as being unpatentable over Quinones et al. (Frontiers in Cellular and Infection Microbiology, May 2012, vol. 2, pages 1-10) in view of Singh et al. (Food Control, 2019, vol. 96, pages 251-259), made in the Office Action mailed on November 20, 2025 is withdrawn in view of the Amendment received on March 17, 2026.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
The rejection of claims 1, 2, and 4-101 on the ground of nonstatutory double patenting as being unpatentable over claims 1, 7-12, 67, 71, and 72 of 17/185,077 (issued and accorded the U.S. Patent No. 12,385,100, herein, “the ‘100 patent”)2 in view of Singh et al. (Food Control, 2019, vol. 96, pages 251-259), made in the Office Action mailed on November 20, 2025 is maintained for the reasons of record.
Applicants’ arguments presented in the Amendment received on March 17, 2026 have been carefully considered but they have not been found persuasive for the reasons discussed in the, “Response to Arguments” section below.
The Rejection:
Although the claims at issue are not identical, they are not patentably distinct from each other as discussed below.
With regard to instant claim 1, claims of the ‘100 patent claims a method for detecting virulent STEC O26 strain in a biological sample (“method for discriminating a virulent Shiga toxin-producing E. coli (STEC) O26 strain DNA from an avirulent Shiga-toxin producing E. coli (STEC) O26 strain DNA in a biological sample”, see claim 1), comprising the steps of:
enriching bacterial concentration of the biological sample to result in an enriched sample (“enriching bacterial concentration of the biological sample to result in an enriched sample”, see claim 1(i));
isolating DNA from said enriched biological sample (“isolating a DNA from said enriched biological sample”, see claim 1(ii)); and
detecting virulent O26 in said isolated DNA sample using real-time PCR high-resolution melt curve assay or probe-based assay; wherein said real-time PCR comprises at least one primer pair, wherein said primer pair comprises SEQ ID NO: 1 and SEQ ID NO: 2 (“hybridizing a target region of the DNA sample to at least one primer pair or at least one probe, wherein the at least one primer pair comprises SEQ ID NO: 1 and SEQ ID NO: 2 … or the at least one probe comprises SEQ ID NO: 11 or SEQ ID N: 12 and the at least one probe discriminates between the virulent STEC O26 DNA and avirulent STEC O26 DNA”, see claim 1(iii); see also claim 7).
SEQ ID Number 1 of the ‘100 patent is identical to instant SEQ ID Numbers 1 (see below alignment):
‘100 patent SEQ ID NO: 1 1 GTGGCACTGGTTCTTTTGGT 20
||||||||||||||||||||
Instant SEQ ID NO: 1 1 GTGGCACTGGTTCTTTTGGT 20

SEQ ID NO: 2 of the ‘100 patent is a reverse primer that is used with the identical forward primer of SEQ ID Number 1. However, SEQ ID NO: 2 of the ‘100 patent anneals on a different portion from the instantly claimed reverse primer of SEQ ID NO: 2.
Therefore, the ‘100 patent does not teach the claimed pair of primers being SEQ ID NO: 1 and 2.
With regard to instant claims 2 and 3, claims of the ‘100 patent claims labeled probes (see claim 71) of SEQ ID NO: 11 and 12 (see claim 55) wherein SEQ ID NO: 11 is identical to instant SEQ ID NO: 11 and 12 aligns with high overlap (see below):
SEQ ID NO: 11 cagatattactgaaatacg
|||||||||||||||||||
Instant SEQ ID NO: 11 cagatattactgaaatacg

SEQ ID NO: 12 cagatattgctgaaatacg
||||||||||||||
Instant SEQ ID NO: 12 acagatattgctgaa

With regard to instant claim 4, claim 7 of the ‘100 patent claims that the method performs a real-time PCR high resolution melt curve assay on the virulent STEC O26 DNA.
With regard to instant claim 5, the amplicons produced in step (iii) comprise a melting temperature differing by 0.2-4oC from avirulent amplicons in real-time PCR high-resolution melt curve assay (“melting temperature between virulent and avirulent O26 DNA differs by 0.2-4oC”, see claim 67).
With regard to instant claims 6-9, claims of the ‘100 patent claims also claims as the sample (see claims 8-11).
With regard to instant claim 10, claims of the ‘100 patent claims internal amplification controls of SEQ ID NO: 19 and 20 which are identical to instant SEQ ID NO: 19 and 20, and significantly overlaps in SEQ ID NO: 21 (see below):
SEQ ID NO: 19 cctcttgcca tcggatgtg
|||||||||| |||||||||
Instant SEQ ID NO: 19 cctcttgcca tcggatgtg

SEQ ID NO: 20 ggctggtcat cctctcagac c
|||||||||| |||||||||| |
Instant SEQ ID NO: 20 ggctggtcat cctctcagac c

SEQ ID NO: 21 gtggggtaac ggctcaccta ggcgac
|||| |||||||||| ||||||
Instant SEQ ID NO: 21 taac ggctcaccta ggcgac

It would have been prima facie obvious to take the claims of the ‘100 patent, the teachings of Singh et al., and knowledge of the art before the effective filing date of the claimed invention and arrive at the instantly claimed method for the reasons that follow.
As discussed above, methods of the ‘100 patent claims a method of distinguishing a virulent and avirulent STEC O26 strains from a biological sample that includes the steps of (i) enrichment; (ii) DNA isolation therefrom; and (iii) detecting the O26 strain based on a real-time PCR high-resolution melt curve assay or a probe-based assay.
The art of detecting various strains of pathogens utilizing a melt curve assay has been well established, as evidenced by Singh et al.:
“aim of this study was to develop high resolution melt (HRM) curve real-time PCR assays for the detection of seven STEC serogroups (E. coli O145, O121, O157, O26, O45, O103, and O111), virulence genes (stx1 and stx2) …” (page 252, 1st column)

“Genomic DNA from all bacterial strains and enriched food samples was isolated …” (page 252, 1st column)

“PCR primers used in this stud were designed using Primer 3 software … serogroup-specific … O-antigen gene, and Siga-toxin producing virulence genes (stx1 and stx2) were targeted” (page 252 1st column)

“Real-time PCR was performed … A melt curve weas performed at the end of the PCR amplification steps (from 60oC to 95oC, with gradual temperature increments of 0.04oC/s)” (page 253, 1st column)

Therefore, all the steps involving as well as assaying/distinguishing between virulent and avirulent STEC O26 strain from samples targeting stx1 and stx2 virulence genes with primers in a real-time PCR high resolution melting point assay have been known and utilized before the effective filing date.
Claims of the ‘100 paten provides a primer pair that provides a starting point of the amplification product in the form of a forward primer of SEQ ID NO: 1, which is identical to the instantly claimed forward primer of SEQ ID NO: 1.
The sequence of SEQ ID NO: 2, that is, the reverse primer that is to be used with said forward primer aligns to the known gene and they differ between that of the instant reverse primer (SEQ ID NO: 2) and the reverse primer of the ’100 patent (SEQ ID NO: 2) as shown below:
‘100 patent 1 TTTCATCCCTGCTAAATATTCG 22
||||||||||||||||||||||
GenBank AP042605 2885441 TTTCATCCCTGCTAAATATTCG 2885462

Instant SEQ ID NO: 2 1 ACCACGCGTTGCATTTAGAA 20
||||||||||||||||||||
GenBank AP042605 2885340 ACCACGCGTTGCATTTAGAA 2885359

As seen, the amplification product produced from primer pair of the ‘100 patent starts at the same point on the gene and ends 103 bases beyond the amplification product produced form the instantly claimed primer pair.
The Office contends that such is an obvious arrival to an alternative amplification product based on the claimed primer pair of the ‘100 patent because the forward primer of the ‘100 patent provided an exact starting point from which to amplify a region which can be used to distinguish between a virulent and an avirulent O26 strain. Given that the template sequence of the O26 strain was known before the effective filing date of the application, one of ordinary skill in the art would have been capable of arriving at additional amplification products of varying lengths that can be used to distinguish between the strains by observing a melting point difference of such amplicons using an empirical determination.
Similarly, while of SEQ ID NO: 20 differs between the instant claims and that of the ’100 patent, the difference is minimal due having a significant overlap (see below):
SEQ ID NO: 21 gtggggtaac ggctcaccta ggcgac
|||| |||||||||| ||||||
Instant SEQ ID NO: 21 taac ggctcaccta ggcgac

As well, the specification teaches that SEQ ID NO: 21 is a probe designed to anneal to the amplification product produced from the pair of primers SEQ ID NO: 19 and 20 (see section [00102]).
Since the pair of primers used by instant application and the ‘100 paten are identical (see below alignment), the amplification product produced would have been identical. And choosing a probe that specifically anneals to the same amplicon would have been well-within the purview of an ordinarily skilled artisans as the number of strain specific regions would have been finite and such would have been discoverable based on routine experimentation, yielding no more than a predictable outcome.
Sequence Alignment of forward/reverse primers (SEQ ID NO: 19 & 20)

SEQ ID NO: 19 cctcttgcca tcggatgtg
|||||||||| |||||||||
Instant SEQ ID NO: 19 cctcttgcca tcggatgtg

SEQ ID NO: 20 ggctggtcat cctctcagac c
|||||||||| |||||||||| |
Instant SEQ ID NO: 20 ggctggtcat cctctcagac c

The Supreme Court particularly emphasized “the need for caution in granting a patent based on the combination of elements found in the prior art,” Id. at 415, 82 USPQ2d at 1395, and discussed circumstances in which a patent might be determined to be obvious. Importantly, the Supreme Court reaffirmed principles based on its precedent that “[t]he combination of familiar elements according to known methods is likely to be obvious when it does no more than yield predictable results.” Id. at 415-16, 82 USPQ2d at 1395. The Supreme Court stated that there are “[t]hree cases decided after Graham [that] illustrate this doctrine.” Id. at 416, 82 USPQ2d at 1395. (1) “In United States v. Adams, . . . [t]he Court recognized that when a patent claims a structure already known in the prior art that is altered by the mere substitution of one element for another known in the field, the combination must do more than yield a predictable result.”
For these reasons, the claimed invention is obvious over the claims of the ‘100 patent in view of Singh et al.
Response to Arguments:
Applicants traverse the rejection but provides no actual arguments. Because an assertion based on the fac that a supporting reference is used in an obviousness rejection in itself, without additional arguments as to why the rejection is improper is not deemed a proper response to a rejection.
“In order to be entitled to reconsideration or further examination, the applicant or patent owner must reply to the Office action. The reply by the applicant or patent owner must be reduced to a writing which distinctly and specifically points out the supposed errors in the examiner’s action and must reply to every ground of objection and rejection in the prior Office action. The reply must present arguments pointing out the specific distinctions believed to render the claims, including any newly presented claims, patentable over any applied references.” (37 CFR 1.111(b))

Therefore, the rejection is maintained for the reasons already of record.
Conclusion
No claims are allowed.
Claims are free of prior art. The prior art does not teach or suggest a combination of SEQ ID Numbers 1 and 2 for detecting virulent Shiga toxin-producing E. coli O26 strain.
The combination of using SEQ ID Numbers 19-21 are deemed free of prior art. SEQ ID NO: 19-21 are directed to a primer pair and a probe which is used in combination in the real-time PCR high-resolution melt curve assay and the prior art fails to teach or motivate to amplify the specific region amplified by SEQ ID NO: 19 and 20 and a probe designed to anneal thereto (SEQ ID NO: 21).
THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Inquiries

Any inquiry concerning this communication or earlier communications from the Examiner should be directed to Young J. Kim whose telephone number is [phone]. The Examiner can best be reached from 7:30 a.m. to 4:00 p.m (M-F). The Examiner can also be reached via e-mail to [e-mail]. However, the office cannot guarantee security through the e-mail system nor should official papers be transmitted through this route.
If attempts to reach the Examiner by telephone are unsuccessful, the Examiner's supervisor, Gary Benzion, can be reached at [phone].
Papers related to this application may be submitted to Art Unit 1681 by facsimile transmission. The faxing of such papers must conform with the notice published in the Official Gazette, 1156 OG 61 (November 16, 1993) and 1157 OG 94 (December 28, 1993) (see 37 CFR 1.6(d)). NOTE: If applicant does submit a paper by FAX, the original copy should be retained by applicant or applicant’s representative. NO DUPLICATE COPIES SHOULD BE SUBMITTED, so as to avoid the processing of duplicate papers in the Office. All official documents must be sent to the Official Tech Center Fax number: [phone]. Any inquiry of a general nature or relating to the status of this application should be directed to the Group receptionist whose telephone number is [phone].
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/YOUNG J KIM/Primary Examiner
Art Unit 1637 May 21, 2026
/YJK/

1 Claim 3 has been canceled by Applicants in the Amendment received on March 17, 2026.
2 The Application has been issued a patent number as recited, but not available. The claims are mapped to the allowed claims in its U.S. Application counter part, having the serial number, 17/185,077.

Prosecution Timeline

• Jan 20, 2023: Application Filed
• Nov 20, 2025: Non-Final Rejection mailed — §102, §103, §112
• Mar 17, 2026: Response Filed
• May 27, 2026: Final Rejection mailed — §102, §103, §112 (current)