Office Action Predictor
Last updated: April 15, 2026
Application No. 18/157,589

COMPOSITIONS AND METHODS FOR THE TREATMENT OF EYE DISEASES

Final Rejection §103§112
Filed
Jan 20, 2023
Examiner
ZARA, JANE J
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Frontera Therapeutics, INC.
OA Round
1 (Final)
71%
Grant Probability
Favorable
2-3
OA Rounds
2y 10m
To Grant
87%
With Interview

Examiner Intelligence

Grants 71% — above average
71%
Career Allow Rate
769 granted / 1085 resolved
+10.9% vs TC avg
Strong +16% interview lift
Without
With
+15.9%
Interview Lift
resolved cases with interview
Typical timeline
2y 10m
Avg Prosecution
38 currently pending
Career history
1123
Total Applications
across all art units

Statute-Specific Performance

§101
5.0%
-35.0% vs TC avg
§103
29.1%
-10.9% vs TC avg
§102
17.8%
-22.2% vs TC avg
§112
31.2%
-8.8% vs TC avg
Black line = Tech Center average estimate • Based on career data from 1085 resolved cases

Office Action

§103 §112
DETAILED ACTION The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . This Office action is in response to the communication filed 11-11-25. Claims 47, 48, 50-52, 54-66 are pending in the instant application. Response to Arguments and Amendments Withdrawn Rejections Any objections or rejections not repeated in this Office action are hereby withdrawn. Maintained Rejections Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 65 and 66 are rejected under 35 U.S.C. 112, first paragraph, because the specification, while being enabling for he particular constructs providing in vivo effects, does not reasonably enable methods of compositions and methods of treating X linked retinitis pigmentosa comprising administration by any route of any recombinant adeno-associated virus (rAAV) particle for the reasons of record set forth in the Office action mailed 8-14-25 and as set forth below. Applicant’s Arguments Applicants disagree and argue the following: Applicant respectfully disagrees. Without conceding in the basis of the rejection and solely to expedite prosecution, claim 64 is herein amended to recite, in part, "wherein the system is formulated for injection." Applicant submits that claim 64 as amended herein does not recite a system for administration by any route of administration but rather a system formulated for administration via injection Response to Applicant’s Arguments As stated previously, the specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention commensurate in scope with these claims. The claims are drawn to a kit with instructions and methods of treating X linked retinitis pigmentosa comprising administration to any cell, optionally in a system formulated for injection, of a recombinant adeno-associated virus (rAAV) particle comprising a first polynucleotide comprising a first sequence operably linked to a first promoter and a second sequence operably linked to a second promoter suitable for expression in insect cells, the first sequence encoding an adeno-associated virus (AAV) capsid protein, the second sequence encoding an AAV rep protein, the first promoter and the second promoter are suitable for expression in insect cells; and a second polynucleotide, which second polynucleotide comprises a third sequence operably linked to a Rhodopsin kinase (GRK1) promoter optionally comprising SEQ ID NO: 7 or 8, and wherein the third sequence encodes a retinitis pigmentosa GTPase regulator (RPGR) polypeptide optionally comprising a codon-optimized RPGR ORF 15 polypeptide comprising SEQ ID NO: 4 or SEQ ID NO: 5, which insect cells are Sf9 cells, which first or second promoter optionally comprises a p10 or polh promoter, wherein the 3’ end of the first sequence further comprises a first poly A sequence, and/or wherein the 3’ end of the second sequence further comprises a second poly A sequence, and/or wherein the 3’ end of the third sequence further comprises a third poly A sequence optionally comprising one of SEQ ID NOs: 9-12, or which second polynucleotide optionally further comprises an adeno-associated virus (AAV) serotype 2 ITR sequence, and which second polynucleotide optionally further comprises a fourth sequence encoding a therapeutic protein optionally comprising RPGRIP1, RPGRIPIL, SMC1, SMC3, Whirlin, PDES, and RAB8, and which intron sequence optionally comprises SEQ ID NO: 13, or which first polynucleotide optionally comprises an adeno-associated virus (AAV) serotype 5 sequence. The Teachings in the Specification: The specification teaches the following: Example 1—Design of Recombinant AAV Constructs [0153] The cap and rep coding sequences derived from AAVS5 and AAV2, respectively, together with their corresponding promoters were synthesized and cloned into modified pFastBac1 to obtain the first polynucleotide comprising the coding sequences of cap and rep proteins. [0154] The nucleotide sequence encoding the RPGR ORF15 polypeptide shown in SEQ ID NO:1 and their corresponding promoters were cloned into modified pFastBacl to obtain the second polynucleotide comprising the coding sequence of RPGR ORF 15. [0155] Codon optimization was used to optimize the expression of RPGR ORF1S. [0156] To codon optimize the RPGR ORF15 sequence, various expression constructs listed in TABLE 2 were created. TABLE 2: Designs of Codon-optimized RPGR ORF15 Expression Constructs co:codon-optimized; GRK1S: GRK1 short promoter; GRK1L: GRK1 long promoter. [0157] Four codon-optimized RPGR ORF15 cDNA sequences were created (RPGR ORF15 col- co4; SEQ ID NOs: 3-6). The constructs contained either the long form Rhodopsin kinase 1 (GRKIL; SEQ ID NO: 7) promoter or short form GRK1 promoter (GRK1S; SEQ ID NO: 8). Various constructs also contained different poly A sequences—bGHpA (SEQ ID NO: 9), SV40pA (SEQ ID NO: 10), rbGlobpA (SEQ ID NO: 11) and hGHpA (SEQ ID NO: 12)— and the SV40 intron sequence (SEQ ID NO: 13). [0158] Example 2—Robust Expression of the Codon-optimized RPGR ORF15 Constructs in vitro [0159] To determine the expression intensity of designed constructs, 2 x 10° HEK293T cells were seeded in a 24-well plate and cultured overnight. 0.5 microgram (ug) of each expression construct plasmid was mixed with 1.5 microliter (uL) Mirus TransT-VirusGEN® Transfection Reagent per well in 50 uwL Opti-Mem medium (DNA (ug): Mirus reagent (ul) = 1:3). After 48 hours, the expression of RPGR ORF15 protein was detected by a Western blotting. As shown in FIGs. 1A-B, all constructs expressed the recombinant RPGR ORF15 proteins in high levels. These proteins were also glutamylated, suggesting that they had undergone endogenous post-translational modification, similar to that of a wild type RPGR ORF15 protein. [0160] The expression of the recombinant RPGR ORF 15 protein from the codon-optimized cDNA construct was analyzed. [0161] These data suggest that the codon-optimized RPGR ORF15 cDNA constructs can express a high level of functional recombinant proteins in vitro. [0162] Example 3—Preparation of Recombinant AAV Virus Particles [0163] The AAV particles were produced by the bac to AAV technology. Specifically, two bacmids containing Rep-Cap and transgene expression cassette, respectively, were generated, and baculoviruses for these two bacmids were then produced. The rAAV was produced by infecting both Rep-Cap and transgene baculoviruses in Sf9 cells. The recombinant AAV2/5/RPGR ORF15 virus particles were isolated and purified using gradient ultracentrifugation or affinity columns. [0164] Example 4—Functional RPGR ORF15 Proteins in the Eye [0165] The functional properties of the RPGR ORF15 proteins expressed from the constructs in TABLE 2 in the eye were evaluated using a RPGR knockout mouse model. [0166] The mice were injected with selected rAAV5 viral particles of Example 3 according to the schedule listed in TABLE 3 using bilateral subretinal injection. TABLE 3: Injection Schedule of the RPGR knockout mice [0167] For each injection other than the negative control (Vehicle), ~1x10“9 viral particles were injected into each eye. [0168] Rolling injections were carried out as mice became available from breeding. The functional properties of the recombinant RPGR ORF 15 protein were tested in a visual test using electroretinopaphy (ERG). Wild type mice (C57 mice) was used as a positive control. The first analysis was carried out one month after the injection. As shown in FIGs. 2A-2B, all the constructs except for PAO14 were able to statistically significantly rescue the scotopic A-wave and B-wave defect of the RPGR knockout mice. The phenotypes of the mice injected PA002, PAQ04, and PAO12 were similar to that of the positive control mice. Further, the mice injected with PAOO2 and PAO12 also rescued the photopic B-wave phenotype of the RPGR knockout mice, as shown in FIG. 2C. [0169] These data show that the RPGR ORF15 proteins expressed from AAV vectors are functional in vivo. [0170] Example 5—Design and Cloning of Recombinant AAV Vectors [0171] The cap and rep coding sequences and their corresponding promoters derived from AAV2 are cloned into the baculovirus plasmid vector to obtain the first polynucleotide of the present disclosure comprising the coding sequences of the cap and rep proteins. [0172] The nucleotide sequence encoding the green fluorescent protein (GFP) and the nucleotide sequence encoding the RPGR ORF 15 polypeptide shown in SEQ ID NO:1 and their corresponding promoters are cloned into the baculovirus plasmid vector to obtain the second polynucleotide comprising the coding sequence of GFP and RPGR ORF15. [0173] Example 6—Delivery and Expression of Reporter Genes in the Mouse Eyes [0174] In this embodiment, mice are divided into an experimental group and a control group. The purified rAAV2/GFP virus particles obtained by methods described Example 3 and PBS are injected into the eyes of the experimental group and the control group, respectively. After a period of time, the fluorescence expression in the mouse retinal pigment epithelial cells is evaluated. [0175] Compared to the control group, green fluorescence is observed in the retina pigment of the mice in the experimental group. This result shows that the rAAV vector comprising the first polynucleotide containing the GFP coding sequence in this disclosure can be successfully packaged into the rAAV2/GFP viral particles for the delivery, and the delivered GFP coding sequence can be successfully expressed in the mouse retinal pigment epithelium. [0176] Example 7—Delivery and Expression of RPGR ORF 15 in Mice [0177] The mice are divided into two groups (control and experiment), wherein the control group and the experimental group are injected intraocularly with rAAV2/GFP and rAAV2/RPGR ORF15 virus particles purified by methods described in Example 3. The eyes of mice are evaluated after the injection. The result shows that GFP can be successfully expressed in the mouse retinal pigment epithelium, indicating that the recombinant RPGR ORF 15 coding sequence can be expressed on the retina. The examples provided in the instant specification, of the particular constructs providing in vivo effects upon direct administration to the eye, are not representative or correlative of the ability to provide in vivo effects comprising the administration to any cell in a subject. In light of the teachings in the art and the specification, one skilled in the art would not accept on its face the examples provided in the instant disclosure, and summarized above, as being correlative or representative of the ability to provide therapeutic effects in any subject as instantly claimed. It is unclear, for instance, what is prophetic and what has been reduced to practice regarding the instant compositions and methods described in the specification (see, e.g., pages 48-49 of the specification). Since the specification fails to provide the requisite guidance for delivery and provision of therapeutic effects in a subject using the broad genus of compounds claimed, and since determination of the factors required for accomplishing therapeutic efficacy in a subject is highly unpredictable, it would require undue experimentation to practice the invention over the broad scope claimed. For the aforementioned reasons, the instant rejection under 35 U.S.C. 112, first paragraph is properly maintained. New Rejections Necessitated by Amendments Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim(s) 47, 48, 50-52, 54-66 is/are rejected under 35 U.S.C. 103 as being unpatentable over Maclaran et al (WO 2017/042584) and Le et al (USPN 9534,225), the combination in view of Young,,et al, J, Invest. Opthamol. Vis. Sci. 44 (9), 4076-4085 (2003)), Research Institute at Nationwide Children’s Hospital (US 2020/0360534), and Oxford University Innovation Limited (US 2018/0273594), the combination further in view of Buchlis et al (US 2016/0346359). The claims are drawn to compositions and methods of treating X linked retinitis pigmentosa comprising administration of a recombinant adeno-associated virus (rAAV) particle comprising a first polynucleotide comprising a first sequence operably linked to a first promoter and a second sequence operably linked to a second promoter, which first and second promoter are suitable for expression in Sf9 cells, the first sequence encoding an adeno-associated virus (AAV) capsid protein, the second sequence encoding an AAV rep protein, the first promoter and the second promoter are suitable for expression in insect cells; and a second polynucleotide, which second polynucleotide comprises a third sequence operably linked to Rhodopsin kinase (GRK1) promoter optionally comprising SEQ ID NO: 7 or 8, and wherein the third sequence encodes a codon-optimized RPGR ORF 15 polypeptide comprising SEQ ID NO: 4 or SEQ ID NO: 5, which insect cells are Sf9 cells, which first or second promoter optionally comprises a p10 or polh promoter, wherein the 3’ end of the first sequence further comprises a first poly A sequence, and/or wherein the 3’ end of the second sequence further comprises a second poly A sequence, and/or wherein the 3’ end of the third sequence further comprises a third poly A sequence optionally comprising one SEQ ID NO: 10, or which second polynucleotide optionally further comprises an adeno-associated virus (AAV) serotype 2 ITR sequence, and which second polynucleotide optionally further comprises a fourth sequence encoding a therapeutic protein optionally comprising RPGRIP1, RPGRIPIL, SMC1, SMC3, Whirlin, PDES, and RAB8, and which intron sequence optionally comprises SEQ ID NO: 13, or which first polynucleotide optionally comprises an adeno-associated virus (AAV) serotype 5 sequence. Maclaran et al (WO 2017/042584) teach the treatment of X linked retinitis pigmentosa comprising administration of a recombinant adeno-associated virus (rAAV) particle comprising a first polynucleotide comprising a codon optimized sequence encoding retinitis pigmentosa GTPase regulator (RPGR), which rAAV comprises an AAV capsid and AAV rep protein, and a GRK 1 promoter (see entire document, esp. pages 1-14, 19, 20, 27-32, 38-44, 46). Ye et al (USPN 9,534,225) teach an RPGR ORF polypeptide comprising 99.9% alignment with SEQ ID No. 4. The only mismatch is the stop codon. The instantly claimed stop codon is TGA and Le teaches the stop codon TAA (See the alignment below). ALIGN WITH SEQ ID NO. 4: RESULT 2 US-14-687-227A-7 Sequence 7, US/14687227A Patent No. 9534225 GENERAL INFORMATION APPLICANT: APPLIED GENETIC TECHNOLOGIES CORPORATION TITLE OF INVENTION: CODON OPTIMIZED NUCLEIC ACID ENCODING A RETINITIS PIGMENTOSA TITLE OF INVENTION: GTPASE REGULATOR (RPGR) FILE REFERENCE: 119561-01020 CURRENT APPLICATION NUMBER: US/14/687,227A CURRENT FILING DATE: 2015-04-15 PRIOR APPLICATION NUMBER: PCT/US2015/025887 PRIOR FILING DATE: 2015-04-15 PRIOR APPLICATION NUMBER: 61/979,633 PRIOR FILING DATE: 2014-04-15 NUMBER OF SEQ ID NOS: 12 SEQ ID NO 7 LENGTH: 3871 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic polynucleotide Query Match 99.9%; Score 3457.4; Length 3871; Best Local Similarity 99.9%; Matches 3458; Conservative 0; Mismatches 1; Indels 0; Gaps 0; Qy 1 ATGAGAGAGCCAGAGGAGCTGATGCCAGATAGCGGAGCAGTGTTTACCTTCGGAAAGTCC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 199 ATGAGAGAGCCAGAGGAGCTGATGCCAGATAGCGGAGCAGTGTTTACCTTCGGAAAGTCC 258 Qy 61 AAGTTCGCAGAGAATAACCCAGGAAAGTTCTGGTTTAAAAACGACGTGCCCGTCCACCTG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 259 AAGTTCGCAGAGAATAACCCAGGAAAGTTCTGGTTTAAAAACGACGTGCCCGTCCACCTG 318 Qy 121 TCTTGTGGCGATGAGCATAGTGCCGTGGTCACTGGGAACAATAAGCTGTATATGTTCGGG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 319 TCTTGTGGCGATGAGCATAGTGCCGTGGTCACTGGGAACAATAAGCTGTATATGTTCGGG 378 Qy 181 TCCAACAATTGGGGACAGCTGGGGCTGGGATCCAAATCTGCTATCTCTAAGCCAACCTGC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 379 TCCAACAATTGGGGACAGCTGGGGCTGGGATCCAAATCTGCTATCTCTAAGCCAACCTGC 438 Qy 241 GTGAAGGCACTGAAACCCGAGAAGGTCAAACTGGCCGCTTGTGGCAGAAACCACACTCTG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 439 GTGAAGGCACTGAAACCCGAGAAGGTCAAACTGGCCGCTTGTGGCAGAAACCACACTCTG 498 Qy 301 GTGAGCACCGAGGGCGGGAATGTCTATGCCACCGGAGGCAACAATGAGGGACAGCTGGGA 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 499 GTGAGCACCGAGGGCGGGAATGTCTATGCCACCGGAGGCAACAATGAGGGACAGCTGGGA 558 Qy 361 CTGGGGGACACTGAGGAAAGGAATACCTTTCACGTGATCTCCTTCTTTACATCTGAGCAT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 559 CTGGGGGACACTGAGGAAAGGAATACCTTTCACGTGATCTCCTTCTTTACATCTGAGCAT 618 Qy 421 AAGATCAAGCAGCTGAGCGCCGGCTCCAACACATCTGCAGCCCTGACTGAGGACGGGCGC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 619 AAGATCAAGCAGCTGAGCGCCGGCTCCAACACATCTGCAGCCCTGACTGAGGACGGGCGC 678 Qy 481 CTGTTCATGTGGGGAGATAATTCAGAGGGCCAGATTGGGCTGAAAAACGTGAGCAACGTG 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 679 CTGTTCATGTGGGGAGATAATTCAGAGGGCCAGATTGGGCTGAAAAACGTGAGCAACGTG 738 Qy 541 TGCGTGCCTCAGCAGGTGACCATCGGAAAGCCAGTCAGTTGGATTTCATGTGGCTACTAT 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 739 TGCGTGCCTCAGCAGGTGACCATCGGAAAGCCAGTCAGTTGGATTTCATGTGGCTACTAT 798 Qy 601 CATAGCGCCTTCGTGACCACAGATGGCGAGCTGTACGTCTTTGGGGAGCCCGAAAACGGA 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 799 CATAGCGCCTTCGTGACCACAGATGGCGAGCTGTACGTCTTTGGGGAGCCCGAAAACGGA 858 Qy 661 AAACTGGGCCTGCCTAACCAGCTGCTGGGCAATCACCGGACACCCCAGCTGGTGTCCGAG 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 859 AAACTGGGCCTGCCTAACCAGCTGCTGGGCAATCACCGGACACCCCAGCTGGTGTCCGAG 918 Qy 721 ATCCCTGAAAAAGTGATCCAGGTCGCCTGCGGGGGAGAGCATACAGTGGTCCTGACTGAG 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 919 ATCCCTGAAAAAGTGATCCAGGTCGCCTGCGGGGGAGAGCATACAGTGGTCCTGACTGAG 978 Qy 781 AATGCCGTGTACACCTTCGGACTGGGCCAGTTTGGCCAGCTGGGGCTGGGAACCTTCCTG 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 979 AATGCCGTGTACACCTTCGGACTGGGCCAGTTTGGCCAGCTGGGGCTGGGAACCTTCCTG 1038 Qy 841 TTTGAGACATCCGAACCAAAAGTGATCGAGAACATTCGCGACCAGACTATCAGCTACATT 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1039 TTTGAGACATCCGAACCAAAAGTGATCGAGAACATTCGCGACCAGACTATCAGCTACATT 1098 Qy 901 TCCTGCGGAGAGAATCACACCGCACTGATCACAGACATTGGCCTGATGTATACCTTTGGC 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1099 TCCTGCGGAGAGAATCACACCGCACTGATCACAGACATTGGCCTGATGTATACCTTTGGC 1158 Qy 961 GATGGGCGGCACGGGAAGCTGGGACTGGGCCTGGAGAACTTCACTAATCACTTCATCCCC 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1159 GATGGGCGGCACGGGAAGCTGGGACTGGGCCTGGAGAACTTCACTAATCACTTCATCCCC 1218 Qy 1021 ACCCTGTGCTCTAACTTCCTGCGGTTCATCGTGAAACTGGTCGCTTGCGGCGGGTGTCAC 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1219 ACCCTGTGCTCTAACTTCCTGCGGTTCATCGTGAAACTGGTCGCTTGCGGCGGGTGTCAC 1278 Qy 1081 ATGGTGGTCTTCGCTGCACCTCATAGGGGCGTGGCTAAGGAGATCGAATTTGACGAGATT 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1279 ATGGTGGTCTTCGCTGCACCTCATAGGGGCGTGGCTAAGGAGATCGAATTTGACGAGATT 1338 Qy 1141 AACGATACATGCCTGAGCGTGGCAACTTTCCTGCCATACAGCTCCCTGACTTCTGGCAAT 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1339 AACGATACATGCCTGAGCGTGGCAACTTTCCTGCCATACAGCTCCCTGACTTCTGGCAAT 1398 Qy 1201 GTGCTGCAGAGAACCCTGAGTGCAAGGATGCGGAGAAGGGAGAGGGAACGCTCTCCTGAC 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1399 GTGCTGCAGAGAACCCTGAGTGCAAGGATGCGGAGAAGGGAGAGGGAACGCTCTCCTGAC 1458 Qy 1261 AGTTTCTCAATGCGACGAACCCTGCCACCTATCGAGGGGACACTGGGACTGAGTGCCTGC 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1459 AGTTTCTCAATGCGACGAACCCTGCCACCTATCGAGGGGACACTGGGACTGAGTGCCTGC 1518 Qy 1321 TTCCTGCCTAACTCAGTGTTTCCACGATGTAGCGAGCGGAATCTGCAGGAGTCTGTCCTG 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1519 TTCCTGCCTAACTCAGTGTTTCCACGATGTAGCGAGCGGAATCTGCAGGAGTCTGTCCTG 1578 Qy 1381 AGTGAGCAGGATCTGATGCAGCCAGAGGAACCCGACTACCTGCTGGATGAGATGACCAAG 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1579 AGTGAGCAGGATCTGATGCAGCCAGAGGAACCCGACTACCTGCTGGATGAGATGACCAAG 1638 Qy 1441 GAGGCCGAAATCGACAACTCTAGTACAGTGGAGTCCCTGGGCGAGACTACCGATATCCTG 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1639 GAGGCCGAAATCGACAACTCTAGTACAGTGGAGTCCCTGGGCGAGACTACCGATATCCTG 1698 Qy 1501 AATATGACACACATTATGTCACTGAACAGCAATGAGAAGAGTCTGAAACTGTCACCAGTG 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1699 AATATGACACACATTATGTCACTGAACAGCAATGAGAAGAGTCTGAAACTGTCACCAGTG 1758 Qy 1561 CAGAAGCAGAAGAAACAGCAGACTATTGGCGAGCTGACTCAGGACACCGCCCTGACAGAG 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1759 CAGAAGCAGAAGAAACAGCAGACTATTGGCGAGCTGACTCAGGACACCGCCCTGACAGAG 1818 Qy 1621 AACGACGATAGCGATGAGTATGAGGAAATGTCCGAGATGAAGGAAGGCAAAGCTTGTAAG 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1819 AACGACGATAGCGATGAGTATGAGGAAATGTCCGAGATGAAGGAAGGCAAAGCTTGTAAG 1878 Qy 1681 CAGCATGTGAGTCAGGGGATCTTCATGACACAGCCAGCCACAACTATTGAGGCTTTTTCA 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1879 CAGCATGTGAGTCAGGGGATCTTCATGACACAGCCAGCCACAACTATTGAGGCTTTTTCA 1938 Qy 1741 GACGAGGAAGTGGAGATCCCCGAGGAAAAAGAGGGCGCAGAAGATTCCAAGGGGAATGGA 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1939 GACGAGGAAGTGGAGATCCCCGAGGAAAAAGAGGGCGCAGAAGATTCCAAGGGGAATGGA 1998 Qy 1801 ATTGAGGAACAGGAGGTGGAAGCCAACGAGGAAAATGTGAAAGTCCACGGAGGCAGGAAG 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1999 ATTGAGGAACAGGAGGTGGAAGCCAACGAGGAAAATGTGAAAGTCCACGGAGGCAGGAAG 2058 Qy 1861 GAGAAAACAGAAATCCTGTCTGACGATCTGACTGACAAGGCCGAGGTGTCCGAAGGCAAG 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2059 GAGAAAACAGAAATCCTGTCTGACGATCTGACTGACAAGGCCGAGGTGTCCGAAGGCAAG 2118 Qy 1921 GCAAAATCTGTCGGAGAGGCAGAAGACGGACCAGAGGGACGAGGGGATGGAACCTGCGAG 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2119 GCAAAATCTGTCGGAGAGGCAGAAGACGGACCAGAGGGACGAGGGGATGGAACCTGCGAG 2178 Qy 1981 GAAGGCTCAAGCGGGGCTGAGCATTGGCAGGACGAGGAACGAGAGAAGGGCGAAAAGGAT 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2179 GAAGGCTCAAGCGGGGCTGAGCATTGGCAGGACGAGGAACGAGAGAAGGGCGAAAAGGAT 2238 Qy 2041 AAAGGCCGCGGGGAGATGGAACGACCTGGAGAGGGCGAAAAAGAGCTGGCAGAGAAGGAG 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2239 AAAGGCCGCGGGGAGATGGAACGACCTGGAGAGGGCGAAAAAGAGCTGGCAGAGAAGGAG 2298 Qy 2101 GAATGGAAGAAAAGGGACGGCGAGGAACAGGAGCAGAAAGAAAGGGAGCAGGGCCACCAG 2160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2299 GAATGGAAGAAAAGGGACGGCGAGGAACAGGAGCAGAAAGAAAGGGAGCAGGGCCACCAG 2358 Qy 2161 AAGGAGCGCAACCAGGAGATGGAAGAGGGCGGCGAGGAAGAGCATGGCGAGGGAGAAGAG 2220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2359 AAGGAGCGCAACCAGGAGATGGAAGAGGGCGGCGAGGAAGAGCATGGCGAGGGAGAAGAG 2418 Qy 2221 GAAGAGGGCGATAGAGAAGAGGAAGAGGAAAAAGAAGGCGAAGGGAAGGAGGAAGGAGAG 2280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2419 GAAGAGGGCGATAGAGAAGAGGAAGAGGAAAAAGAAGGCGAAGGGAAGGAGGAAGGAGAG 2478 Qy 2281 GGCGAGGAAGTGGAAGGCGAGAGGGAAAAGGAGGAAGGAGAACGGAAGAAAGAGGAAAGA 2340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2479 GGCGAGGAAGTGGAAGGCGAGAGGGAAAAGGAGGAAGGAGAACGGAAGAAAGAGGAAAGA 2538 Qy 2341 GCCGGCAAAGAGGAAAAGGGCGAGGAAGAGGGCGATCAGGGCGAAGGCGAGGAGGAAGAG 2400 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2539 GCCGGCAAAGAGGAAAAGGGCGAGGAAGAGGGCGATCAGGGCGAAGGCGAGGAGGAAGAG 2598 Qy 2401 ACCGAGGGCCGCGGGGAAGAGAAAGAGGAGGGAGGAGAGGTGGAGGGCGGAGAGGTCGAA 2460 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2599 ACCGAGGGCCGCGGGGAAGAGAAAGAGGAGGGAGGAGAGGTGGAGGGCGGAGAGGTCGAA 2658 Qy 2461 GAGGGAAAGGGCGAGCGCGAAGAGGAAGAGGAAGAGGGCGAGGGCGAGGAAGAAGAGGGC 2520 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2659 GAGGGAAAGGGCGAGCGCGAAGAGGAAGAGGAAGAGGGCGAGGGCGAGGAAGAAGAGGGC 2718 Qy 2521 GAGGGGGAAGAAGAGGAGGGAGAGGGCGAAGAGGAAGAGGGGGAGGGAAAGGGCGAAGAG 2580 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2719 GAGGGGGAAGAAGAGGAGGGAGAGGGCGAAGAGGAAGAGGGGGAGGGAAAGGGCGAAGAG 2778 Qy 2581 GAAGGAGAGGAAGGGGAGGGAGAGGAAGAGGGGGAGGAGGGCGAGGGGGAAGGCGAGGAG 2640 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2779 GAAGGAGAGGAAGGGGAGGGAGAGGAAGAGGGGGAGGAGGGCGAGGGGGAAGGCGAGGAG 2838 Qy 2641 GAAGAAGGAGAGGGGGAAGGCGAAGAGGAAGGCGAGGGGGAAGGAGAGGAGGAAGAAGGG 2700 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2839 GAAGAAGGAGAGGGGGAAGGCGAAGAGGAAGGCGAGGGGGAAGGAGAGGAGGAAGAAGGG 2898 Qy 2701 GAAGGCGAAGGCGAAGAGGAGGGAGAAGGAGAGGGGGAGGAAGAGGAAGGAGAAGGGAAG 2760 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2899 GAAGGCGAAGGCGAAGAGGAGGGAGAAGGAGAGGGGGAGGAAGAGGAAGGAGAAGGGAAG 2958 Qy 2761 GGCGAGGAGGAAGGCGAAGAGGGAGAGGGGGAAGGCGAGGAAGAGGAAGGCGAGGGCGAA 2820 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2959 GGCGAGGAGGAAGGCGAAGAGGGAGAGGGGGAAGGCGAGGAAGAGGAAGGCGAGGGCGAA 3018 Qy 2821 GGAGAGGACGGCGAGGGCGAGGGAGAAGAGGAGGAAGGGGAATGGGAAGGCGAAGAAGAG 2880 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3019 GGAGAGGACGGCGAGGGCGAGGGAGAAGAGGAGGAAGGGGAATGGGAAGGCGAAGAAGAG 3078 Qy 2881 GAAGGCGAAGGCGAAGGCGAAGAAGAGGGCGAAGGGGAGGGCGAGGAGGGCGAAGGCGAA 2940 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3079 GAAGGCGAAGGCGAAGGCGAAGAAGAGGGCGAAGGGGAGGGCGAGGAGGGCGAAGGCGAA 3138 Qy 2941 GGGGAGGAAGAGGAAGGCGAAGGAGAAGGCGAGGAAGAAGAGGGAGAGGAGGAAGGCGAG 3000 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3139 GGGGAGGAAGAGGAAGGCGAAGGAGAAGGCGAGGAAGAAGAGGGAGAGGAGGAAGGCGAG 3198 Qy 3001 GAGGAAGGAGAGGGGGAGGAGGAGGGAGAAGGCGAGGGCGAAGAAGAAGAAGAGGGAGAA 3060 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3199 GAGGAAGGAGAGGGGGAGGAGGAGGGAGAAGGCGAGGGCGAAGAAGAAGAAGAGGGAGAA 3258 Qy 3061 GTGGAGGGCGAAGTCGAGGGGGAGGAGGGAGAAGGGGAAGGGGAGGAAGAAGAGGGCGAA 3120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3259 GTGGAGGGCGAAGTCGAGGGGGAGGAGGGAGAAGGGGAAGGGGAGGAAGAAGAGGGCGAA 3318 Qy 3121 GAAGAAGGCGAGGAAAGAGAAAAAGAGGGAGAAGGCGAGGAAAACCGGAGAAATAGGGAA 3180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3319 GAAGAAGGCGAGGAAAGAGAAAAAGAGGGAGAAGGCGAGGAAAACCGGAGAAATAGGGAA 3378 Qy 3181 GAGGAGGAAGAGGAAGAGGGAAAGTACCAGGAGACAGGCGAAGAGGAAAACGAGCGGCAG 3240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3379 GAGGAGGAAGAGGAAGAGGGAAAGTACCAGGAGACAGGCGAAGAGGAAAACGAGCGGCAG 3438 Qy 3241 GATGGCGAGGAATATAAGAAAGTGAGCAAGATCAAAGGATCCGTCAAGTACGGCAAGCAC 3300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3439 GATGGCGAGGAATATAAGAAAGTGAGCAAGATCAAAGGATCCGTCAAGTACGGCAAGCAC 3498 Qy 3301 AAAACCTATCAGAAGAAAAGCGTGACCAACACACAGGGGAATGGAAAAGAGCAGCGAAGT 3360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3499 AAAACCTATCAGAAGAAAAGCGTGACCAACACACAGGGGAATGGAAAAGAGCAGCGAAGT 3558 Qy 3361 AAAATGCCTGTGCAGTCAAAACGGCTGCTGAAGAATGGCCCAAGCGGGTCTAAAAAATTC 3420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3559 AAAATGCCTGTGCAGTCAAAACGGCTGCTGAAGAATGGCCCAAGCGGGTCTAAAAAATTC 3618 Qy 3421 TGGAACAATGTCCTGCCACACTATCTGGAACTGAAGTGA 3459 ||||||||||||||||||||||||||||||||||||| | Db 3619 TGGAACAATGTCCTGCCACACTATCTGGAACTGAAGTAA 3657 Young et al. (Invest. Ophthamol. Vis. Sci., Vol. 44 (9), pages 4076-4085 (2003)) teach a highly active photoreceptor-specific enhancer/promoter region upstream of the human rhodopsin kinase gene comprising SEQ ID No. 8. Align w seq id no: 8 RESULT 1 AY327580 LOCUS AY327580 2213 bp DNA linear PRI 26-JUL-2016 DEFINITION Homo sapiens rhodopsin kinase gene, promoter region, exon 1 and partial cds. ACCESSION AY327580 VERSION AY327580.1 KEYWORDS . SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 2213) AUTHORS Young,J.E., Vogt,T., Gross,K.W. and Khani,S.C. TITLE A short, highly active photoreceptor-specific enhancer/promoter region upstream of the human rhodopsin kinase gene JOURNAL Invest. Ophthalmol. Vis. Sci. 44 (9), 4076-4085 (2003) PUBMED 12939331 REFERENCE 2 (bases 1 to 2213) AUTHORS Young,J.E., Vogt,T., Gross,K.W. and Khani,S.C. TITLE Direct Submission JOURNAL Submitted (23-JUN-2003) Ophthalmology, State University of New York at Buffalo, 462 Grider Street - ECMC, Buffalo, NY 14215, USA FEATURES Location/Qualifiers source 1..2213 /organism="Homo sapiens" /mol_type="genomic DNA" /db_xref="taxon:9606" regulatory 1..1904 /regulatory_class="promoter" misc_feature 1..1448 /note="inhibitory sequence" repeat_region 115..137 misc_feature 1758..1762 /note="putative homeodomain recognition site H2" regulatory 1793..1991 /regulatory_class="enhancer" misc_feature 1877..1883 /note="putative homeodomain recognition site H1" mRNA 1905..>2213 /product="rhodopsin kinase" exon 1905..>2213 /number=1 5'UTR 1905..2175 CDS 2176..>2213 /codon_start=1 /product="rhodopsin kinase" /protein_id="AAQ94192.1" /translation="MDFGSLETVVANS Query Match 100.0%; Score 199; Length 2213; Best Local Similarity 100.0%; Matches 199; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GGGCCCCAGAAGCCTGGTGGTTGTTTGTCCTTCTCAGGGGAAAAGTGAGGCGGCCCCTTG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1793 GGGCCCCAGAAGCCTGGTGGTTGTTTGTCCTTCTCAGGGGAAAAGTGAGGCGGCCCCTTG 1852 Qy 61 GAGGAAGGGGCCGGGCAGAATGATCTAATCGGATTCCAAGCAGCTCAGGGGATTGTCTTT 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1853 GAGGAAGGGGCCGGGCAGAATGATCTAATCGGATTCCAAGCAGCTCAGGGGATTGTCTTT 1912 Qy 121 TTCTAGCACCTTCTTGCCACTCCTAAGCGTCCTCCGTGACCCCGGCTGGGATTTAGCCTG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1913 TTCTAGCACCTTCTTGCCACTCCTAAGCGTCCTCCGTGACCCCGGCTGGGATTTAGCCTG 1972 Qy 181 GTGCTGTGTCAGCCCCGGG 199 ||||||||||||||||||| Db 1973 GTGCTGTGTCAGCCCCGGG 1991 Institute at Nationwide Children’s Hospital (US 2020/0360534) teach the routine use of the intron comprising SEQ ID No. 13. Align w/ Seq id no 13 RESULT 3 US-16-966-407-5 Sequence 5, US/16966407 Publication No. US 2020/0360534A1 GENERAL INFORMATION APPLICANT: RESEARCH INSTITUTE AT NATIONWIDE CHILDREN'S HOSPITAL TITLE OF INVENTION: GENE THERAPY FOR LIMB-GIRDLE MUSCULAR DYSTROPHY TYPE 2C FILE REFERENCE: 106887-7141 CURRENT APPLICATION NUMBER: US/16/966,407 CURRENT FILING DATE: 2020-07-30 PRIOR APPLICATION NUMBER: 62/624,616 PRIOR FILING DATE: 2018-01-31 NUMBER OF SEQ ID NOS: 11 SEQ ID NO 5 LENGTH: 148 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic polynucleotide Query Match 100.0%; Score 97; Length 148; Best Local Similarity 100.0%; Matches 97; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GTAAGTTTAGTCTTTTTGTCTTTTATTTCAGGTCCCGGATCCGGTGGTGGTGCAAATCAA 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3 GTAAGTTTAGTCTTTTTGTCTTTTATTTCAGGTCCCGGATCCGGTGGTGGTGCAAATCAA 62 Qy 61 AGAACTGCTCCTCAGTGGATGTTGCCTTTACTTCTAG 97 ||||||||||||||||||||||||||||||||||||| Db 63 AGAACTGCTCCTCAGTGGATGTTGCCTTTACTTCTAG 99 Buchlis et al (US 2016/0346359) teach the treatment of retinitis pigmentosa comprising the administration of rAAV comprising RPGRIP1 or Whirlin (see esp. Table 1, ¶¶ 0004, 0049). It would have been obvious to design and optimize the instantly claimed constructs for treating X linked retinitis pigmentosa because the prior art had routinely taught the utilization and optimization and the delivery in appropriate target cells for treating X linked retinitis pigmentosa, relying on the combined teachings of Maclaran, Le, Young,J.E , Research Institute at Nationwide Children’s Hospital and Oxford University Innovation Limited. In light of these teachings, the promoters, therapeutic genes, intron and AAV subcomponents were routinely used and incorporated into therapeutic applications. One of skill in the art would have reasonably expected the instant compositions would provide for treatment of X linked retinitis pigmentosa comprising administration of a recombinant adeno-associated virus (rAAV) particle as instantly claimed. The components and therapeutic proteins were well known in the art and utilized in recombinant AAV vectors for providing therapeutic applications to treat retinitis pigmentosa as taught in the combined teachings of Maclaren, Le, Research Institute at Nationwide Children’s Hospital, Oxford University Innovation Limited, Young, and Buchlis. For these reasons, the instant invention would have been obvious to one of ordinary skill in the art prior to the effective filing date of the instant application. Conclusion Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Certain papers related to this application may be submitted to Art Unit 1637 by facsimile transmission. The faxing of such papers must conform with the notices published in the Official Gazette, 1156 OG 61 (November 16, 1993) and 1157 OG 94 (December 28, 1993) (see 37 C.F.R. ' 1.6(d)). The official fax telephone number for the Group is 571-273-8300. NOTE: If Applicant does submit a paper by fax, the original signed copy should be retained by applicant or applicant's representative. NO DUPLICATE COPIES SHOULD BE SUBMITTED so as to avoid the processing of duplicate papers in the Office. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Jane Zara whose telephone number is (571) 272-0765. The examiner’s office hours are generally Monday-Friday, 10:30am - 7pm. If attempts to reach the examiner by telephone are unsuccessful, the examiner's supervisor, Jennifer Dunston, can be reached on (571)-272-2916. Any inquiry of a general nature or relating to the status of this application should be directed to the Group receptionist whose telephone number is (703) 308-0196. Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). Jane Zara 1-15-26 /JANE J ZARA/Primary Examiner, Art Unit 1637
Read full office action

Prosecution Timeline

Jan 20, 2023
Application Filed
Jan 15, 2026
Final Rejection — §103, §112
Mar 30, 2026
Response after Non-Final Action
Mar 30, 2026
Request for Continued Examination
Apr 01, 2026
Response after Non-Final Action

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12595482
LINKAGE MODIFIED OLIGOMERIC COMPOUNDS AND USES THEREOF
2y 5m to grant Granted Apr 07, 2026
Patent 12589115
HAEMATOPOIETIC STEM CELL TREATMENT
2y 5m to grant Granted Mar 31, 2026
Patent 12582668
METHODS FOR THE TREATMENT OF ALPHA-1 ANTITRYPSIN DEFICIENCY (AATD)
2y 5m to grant Granted Mar 24, 2026
Patent 12576131
ALTERING INFLAMMATORY STATES OF IMMUNE CELLS IN VIVO BY MODULATING CELLULAR ACTIVATION STATES
2y 5m to grant Granted Mar 17, 2026
Patent 12576101
APPLICATION BASED ON NUCLEOTIDES OF LACTOBACILLUS RHAMNOSUS TO PREPARE A COMPOSITION FOR ANTI-LIPOGENESIS
2y 5m to grant Granted Mar 17, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

2-3
Expected OA Rounds
71%
Grant Probability
87%
With Interview (+15.9%)
2y 10m
Median Time to Grant
Low
PTA Risk
Based on 1085 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in for Full Analysis

Enter your email to receive a magic link. No password needed.

Free tier: 3 strategy analyses per month