Prosecution Insights
Last updated: April 19, 2026
Application No. 18/162,652

CRISPR-BASED ASSAY FOR DETECTING TB IN BODILY FLUIDS

Non-Final OA §102§103§112§DP
Filed
Jan 31, 2023
Examiner
WILDER, CYNTHIA B
Art Unit
1681
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
The Administrators Of The Tulane Educational Fund
OA Round
1 (Non-Final)
71%
Grant Probability
Favorable
1-2
OA Rounds
3y 1m
To Grant
97%
With Interview

Examiner Intelligence

Grants 71% — above average
71%
Career Allow Rate
630 granted / 891 resolved
+10.7% vs TC avg
Strong +27% interview lift
Without
With
+26.6%
Interview Lift
resolved cases with interview
Typical timeline
3y 1m
Avg Prosecution
49 currently pending
Career history
940
Total Applications
across all art units

Statute-Specific Performance

§101
7.6%
-32.4% vs TC avg
§103
36.2%
-3.8% vs TC avg
§102
16.3%
-23.7% vs TC avg
§112
26.5%
-13.5% vs TC avg
Black line = Tech Center average estimate • Based on career data from 891 resolved cases

Office Action

§102 §103 §112 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Priority This application is a CIP of 17/797,425 filed 08/03/2022 which is a 371 of PCT/US21/16931 02/05/2021 which claims benefit of 62/971,210 filed 02/06/2020. Information Disclosure Statement The information disclosure statement (IDS) submitted on 5/30/2025, 6/5/2024 and 7/13.2023 are acknowledged. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner. Drawings The drawings were received on 1/31/2023. These drawings are found acceptable by the Examiner. Specification The disclosure is objected to because of the following informalities: (a) The use of the term “Vent DNA polymerase” at paragraph [0084] and [0086] which is a trade name(s) or a mark(s) used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore, the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM, or ® following the term. Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1-18 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. (a) Claims 1-18 lacks proper antecedent basis in the claim 1 for “the MTB target nucleic acid fragment” in the final wherein clause because no prior steps recite wherein the target is “MTB”. Nowhere in the claim is the target limited to “MTB”. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claim(s) 1-4, 10, 12, 14, 15 and 16 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Ai et al., {Ai, used interchangeably herein} (Emerging Microbes & Infections, citation made of record 7/13/2019, publication date Sept. 15, 2019). Regarding claims 1-2, Ai et al teach a method of detecting Mycobacterium tuberculosis (MTB) in a bodily fluid sample (Abstract; page 1362, col. 1, paragraph 2), comprising the steps of: a) amplifying an MTB target nucleic acid sequence from a bodily fluid sample (page 1363, col. 1 paragraph 3) and b) detecting the presence of the MTB target nucleic acid sequence using a CRISPR-mediated system (1363, col. 1, para. 3); wherein said CRISPR -mediated systems comprises a CRISPR-effector protein, a guide RNA that hybridizes the MTB target with the MTB target nucleic acid fragment, and a reporter molecule that is detectable on cleavage by said CRISPR effector protein (see entire section entitled “Materials and Methods”, pages 1362, col. 2 to page 1363). Regarding claim 3, Ai et al teach the embodiment of claim 1, wherein the method further comprises, prior to step a) the following step: a-1) extracting nucleic acids from the bodily fluid sample (see page 1363). Regarding claim 4, Ai teaches wherein the time between step a-10 and a) is less than 24 hours (see section entitled DNA Rapid Extraction, page 1363, col. 1). Regarding claim 10, Ai teaches the embodiment of claim 1, wherein step a) is carried out using recombinase polymerase amplification (RPA) step (page 1363 col. 1). Regarding claim 12, Ai teaches wherein the CRISPR effector protein is selected from the group consisting of Cas12a (page 1363, col1). Regarding claim 14, Ai teaches the embodiment of claim 1, wherein the reporter molecule is a single-stranded DNA or a single-stranded RNA labeled with fluorescence and quencher (page 1363, col. 1). Regarding claim 15, Ai teaches the method of claim 1, wherein said bodily fluid is obtained from urine and pus (page 1367, col 1). Regarding claim 16, Ai teaches the method of claim 2, wherein the target DNA sequence is IS6110 (pages 1362, col. 2 and pages 1363, page 2). Thus, Ai meets the limitations of the claims recited above. Claim(s) 1-4, 10, 12-15 and 17 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Xu et al, {Xu, used interchangeably herein} (CN 109811072A, English translation pages 1-23, publication date May 28, 2019). Regarding claims 1-2, Xu et al teach a method of detecting Mycobacterium tuberculosis (MTB) in a bodily fluid sample, comprising the steps of: a) amplifying an MTB target nucleic acid sequence from a bodily fluid sample and b) detecting the presence of the MTB target nucleic acid sequence using a CRISPR-mediated system; wherein said CRISPR-mediated systems comprises a CRISPR-effector protein, a guide RNA that hybridizes the MTB target with the MTB target nucleic acid fragment, and a reporter molecule that is detectable on cleavage by said CRISPR effector protein (see entire document, especially section entitled “Experimental Materials” at pages 6-13). Regarding claim 3, Xu et al teach the embodiment of claim 1, wherein the method further comprises, prior to step a) the following step: a-1) extracting nucleic acids from the bodily fluid sample (see pages 4-10). Regarding claim 4, Xu et al teach wherein the time between step a-1) and step a) is less than 24 hours (page 3, line 2 at top of page). Regarding claim 10, Xu teaches the embodiment of claim 3, wherein step a) is carried out using recombinase polymerase amplification (RPA) step (page 2-10) or using PCR techniques or LAMP assay (see page 2). Regarding claim 12, Xu teaches the embodiment of claim 1, wherein the CRISPR effector protein is selected from the group consisting of Cas12a (pages 4, 11). Regarding claim 13, Xu et al teaches wherein the in the step (b), the CRISPR effector protein is selected from LbCas12a, AsCas12a and FnCas12a (page 4). Regarding claim 14, Xu teaches the embodiment of claim 1, wherein the reporter molecule is a single-stranded DNA or a single-stranded RNA labeled with fluorescence and quencher (pages 8-12). Regarding claim 15, Xu teaches the embodiment of claim 1, wherein said bodily fluid is obtained from serum, urine and pus (bottom of page 10 to top of page 11). Regarding claim 17, Xu teaches the method of claim 2, wherein a pair of primers are used in step (b) for the DNA amplification, wherein said the primers are SEQ ID NO: 1 (SEQ ID NO: 4 of Xu at page 4) and SEQ ID NO: 2 (SEQ ID NO: 5 of Xu at page 4). query Match 100.0%; Score 31; Length 31; Best Local Similarity 100.0%; Matches 31; Conservative 0; Mismatches 0; Indels 0; Gaps 0; SEQ ID NO: 1 1 GGTCGGAAGCTCCTATGACAATGCACTAGCC 31 ||||||||||||||||||||||||||||||| Xu SEQ ID NO: 4 1 GGTCGGAAGCTCCTATGACAATGCACTAGCC 31 Query Match 100.0%; Score 30; Length 30; Best Local Similarity 100.0%; Matches 30; Conservative 0; Mismatches 0; Indels 0; Gaps 0; SEQ ID NO: 2 1 TTGAGCGTAGTAGGCAGCCTCGAGTTCGAC 30 |||||||||||||||||||||||||||||| Xu SEQ ID NO: 5 1 TTGAGCGTAGTAGGCAGCCTCGAGTTCGAC 30 Therefore, Xu meets the limitations of the claims recited above. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim(s) 8 is/are rejected under 35 U.S.C. 103 as being unpatentable over Ai (Emerging Microbes & Infections, vol. 8, pages 1361-1369, 2019) as previously applied above in view of Kim et al (US 20160115471, citation made of record on IDS filed 5/30/2025) or Shell et al (PLOS Pathogens, 2013, citation made of record on IDS filed 7/13/2023) (Citations made of record of record on IDS). Regarding claim 8, Ai et al teach a method of detecting Mycobacterium tuberculosis as previously discussed above. Ai et al does not teach wherein the extracting steps comprises depleting human DNA using anti human DNA antibodies. Kim teaches use of an antibody specific for methyl-cytosine for selective isolation of DNA containing methyl-cytosine from non-methylated DNA or DNA lacking such methylation (Abstract), the method comprising one or more of: (a) eluting small nucleic acid fragments preferentially from silica; (b) retaining large nucleic acid fragments preferentially on silica; (c) enriching small nucleic acid based on differences in methylation relative to other nucleic acid (e.g., by methylated DNA immunoprecipitation (MeDIP, e.g., as provided by Cyprus Genetics) (e.g., with antibody-coated particles that are captured by a magnetic field (e.g., paramagnetic or magnetic particles)’; para [0024] - 'In some embodiments, enriching based on methylation status comprises use of agents that are specific for methylated DNA relative to non-methylated DNA (e.g., an antibody recognizing methylated DNA, e.g., an antibody specific for methyl-cytosine or an antibody specific for methyl-cytosine in a CpG dinucleotide, e.g., in a CpG island)'). Since Kim teaches selective enrichment of methylated DNA using methylated DNA antibody capture, it would have been obvious to one of ordinary skill in the art at the time of the effective filing date of the claimed invention that the antibody capture method of Kim could be used to deplete human DNA from the sample extract of Ai, thereby enriching MTB DNA. The ordinary artisan would have been motivated to do so for the potential benefit of increased sensitivity of detection of MTB DNA, because it was well known in the art that cytosine methylation is specific to eukaryotic DNA and absent in prokaryotic DNA. Likewise, Shell teaches MTB DNA that has specific N6-methyladenine methylation pattern for MTB. Shell teaches that a critical DNA methyltransferase in M. tuberculosis was identified, which was term MamA. MamA creates N6-methyladenine in a six base pair recognition sequence present in approximately 2,000 copies on each strand of the genome (abstract). Since methylated DNA-specific antibodies were well known in the art, it would have been obvious to one of ordinary skill in the art at the effective filing date of the claimed invention that an antibody recognizing the MTB methylated DNA with N6-methyladenine could be used to preferentially enrich MTB DNA during the extraction step for the potential attempt to increase the overall! sensitivity of the detection assay of Ai. Claims 5, 6, 9 and 11 is/are rejected under 35 U.S.C. 103 as being unpatentable over Ai (Emerging Microbes & Infections, vol. 8, pages 1361-1369, 2019) in view of Xu et al as previously applied above in view of Wendt et al (WO 2018001884, January 2018). Regarding claims 5, 6, 9 and 11, Ai et al in view of Xu et al teach a method for detecting MTB as previously applied above. Xu et al further teaches the ability to use PCR for detection of MTB. The combination of references does not teach wherein a hybridization enhancer or blocker protein are added in the amplification reaction. In a general teaching, Wendt et al teach a method comprising the use of a CRISP-CAS9 technology which allow for genome editing and introduction of double-stranded breaks at target sites in an organism’s genome (page 1, lines 25-28). Wendt discloses preparing DNA samples and PCR reagents and amplification process. Wendt et al discloses wherein blocker protein may be encompassed in the PCR amplification-based reaction, wherein the protein may comprise of rTth (page 32 and 33) and a PCR enhancer, e.g., betaine, trehalose, etc.) (page 33). Likewise, Wendt teaches that the extraction steps may comprise the use of proteinase K (page 74, line 12). It would have been obvious to one of ordinary skill in the art at the time of the effective filing date of the claimed invention that a hybridization enhancer and a blocker protein as taught by Wendt could be used for the PCR in the method of Ai in view of Xu et al with a reasonable expectation of success or the obvious benefit of maintaining the specificity of hybridization to improve means of detection. Claim(s) 17 is/are rejected under 35 U.S.C. 103 as being unpatentable over Ai et al and Xu et al as previously discussed above in view of Beklemishev et al (RU 2163638 C1, 2/27/2001, citation made of record on IDS). Regarding claim 17, Ai et al and Xu et al teach a method for detecting MTB as previously discussed above. Xu et al., while teaching the primer sequences of SEQ ID NOS: 1 and 2 for detecting MTB, the references do not teach wherein the amplification reaction comprise the use of the primer pairs represented as SEQ ID NOS: 3 and 4. PNG media_image1.png 694 1318 media_image1.png Greyscale Beklemishev et al provides a teaching of detection of DNA from Tuberculosis Mycobacterium complex comprising a polymerase chain reaction method. Beklemishev et al provides a sequence comprising the sequences of SEQ ID NOS: 3 and 4 (see alignment below). Designing primers for use in PCR are well-known in the art and thus given the teachings of Beklemishev as indicated above, it would have been prima facie obvious to one of ordinary skill in the art at the time of the effective filing date of the claimed invention to have been motivated to design additional specific MTB oligonucleotide sequence for use in PCR assay of Ai and Xu for increase means of detecting MTB for improve means of diagnosis and treatment. Claim(s) 17 is/are rejected under 35 U.S.C. 103 as being unpatentable over Ai et al and Xu et al as previously discussed above in view of Tornack et al (WO 2017207825, 12-7-2017, citation made of record on IDS). Regarding claim 17, Ai et al and Xu et al teach a method for detecting MTB as previously discussed above. Xu et al., while teaching the primer sequences of SEQ ID NOS: 1 and 2 for detecting MTB, the references do not teach wherein the amplification reaction comprise the use of the primer pairs represented as SEQ ID NOS: 5 and 6. Tornack et al provides a teaching of detection of DNA from Tuberculosis Mycobacterium complex comprising a polymerase chain reaction method. Tornack et al provides a sequence comprising the sequences of SEQ ID NOS: 5 and 6 (see alignment below). PNG media_image2.png 680 1595 media_image2.png Greyscale Tornack et al teach wherein primer and probes were designed to improve the sensitivity and specificity of detecting Mycobacterium Tuberculosis (see pages 32-36). Designing primers for use in PCR are well known in the art and thus given the teachings of Tornack as indicated above, it would have been prima facie obvious to one of ordinary skill in the art at the time of the effective filing date of the claimed invention to have been motivated to design additional specific MTB oligonucleotide sequence for use in PCR assay of Ai and Xu for increase means of detecting MTB for improve means of diagnosis and treatment. Double Patenting 20. The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. 21. Claims 1-18 are provisionally rejected on the ground of non-statutory double patenting as being unpatentable over claims 1-22 of co-pending Application No. 17797425. An obviousness-type double patenting rejection is appropriate where the conflicting claims are not identical, but an examined application claim is not patentably distinct from the reference claim(s) because the examined claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F. 2d 887, 225 USPQ 645 (fed. Cir. 1985). Although the claims at issue are not identical, they are not patentably distinct from each other because both of the inventions of the instant invention and the invention of claims 1-22 are directed to a method of detecting a pathogen in a bodily fluid sample, comprising the steps of amplifying a target nucleic acid sequence from a bodily fluid sample, wherein the target nucleic acid sequence is specific to the pathogen and detecting presence of the target nucleic acid sequence using a CRISPR-mediated system; wherein said CRISPR-mediate system comprises a CRISPR effector protein, a guide RNA (gRNA) that hybridizes with the MTB target nucleic acid fragment, and a reporter molecule that is detectable on cleavage by said CRISPR effector protein. The claims 2-18 are embodied in the claims 1-22 of co-pending application 17797425. They only differ from each in that the claims of the instant invention are broader in scope than the claims of 1-22 of co-pending application 17797425. Thus, the claims 1-18 of the instant invention falls entirely within the scope of the claims 1-22 of co-pending application 17797425. As the court stated in In re Goodman, 29 USPQ2d 2010 (CAFC 1993), “a second application-- "containing a broader claim, more generical in its character than the specific claim in the prior patent"--typically cannot support an independent valid patent. Miller, 151, U.S. at 198; See Stanley, 214 F.2d at 153. Thus, the generic invention, as noted above is "anticipated" by the species of the patented invention. Cf., Titanium metal corp. v. Banner, 778 F.2d 775, 227 USPQ 773 (Fed. Cir. 1985) (holding that an earlier species disclosure in the prior art defeats any generic claims). This court's predecessor has held that, without a terminal disclaimer, the species claims preclude issuance of the generical application. "In re Van Ornum, 686 F.2d 937, 944, 214 USPQ 761, 767 (CCPA 1982); Schneller, 397 F.2d at 354". This is a provisional non-statutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Allowable subject matter 21. The claim 18 comprises of allowable subject matter because no prior art was found teaching of suggesting the nucleic acid sequences of SEQ ID NOS: 7-9. Conclusion 22. Claims 1-18 are rejected. Any inquiry concerning this communication or earlier communications from the examiner should be directed to CYNTHIA B WILDER whose telephone number is (571)272-0791. The examiner can normally be reached Flexible. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, GARY BENZION can be reached at 571-272-0782. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /CYNTHIA B WILDER/Primary Examiner, Art Unit 1681
Read full office action

Prosecution Timeline

Jan 31, 2023
Application Filed
Oct 14, 2025
Non-Final Rejection — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12584161
STABILIZATION OF NUCLEIC ACIDS IN URINE
2y 5m to grant Granted Mar 24, 2026
Patent 12577615
METHODS FOR THE DETECTION OF A NUCLEIC ACID
2y 5m to grant Granted Mar 17, 2026
Patent 12571016
METHODS AND COMPOSITIONS FOR NUCLEIC ACID AMPLIFICATION
2y 5m to grant Granted Mar 10, 2026
Patent 12571024
METHODS AND COMPOSITIONS RELATING TO COVALENTLY CLOSED NUCLEIC ACIDS
2y 5m to grant Granted Mar 10, 2026
Patent 12571040
CHROMATIN PROFILING COMPOSITIONS AND METHODS
2y 5m to grant Granted Mar 10, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
71%
Grant Probability
97%
With Interview (+26.6%)
3y 1m
Median Time to Grant
Low
PTA Risk
Based on 891 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month