DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claims 56, 58-59, 61-62, 66-71, 73-77, 100, 102-110, and 113-115 are pending.
Status of the Application
Applicant’s response and amendment filed 12 March 2026 are acknowledged and entered.
Applicant has amended Claims 56, 59, 62, 66-71, 103-105, 107-109. Applicant has added Claims 113-115.
Response to Amendment
Applicant has explained the gray shading in the Drawings; the objections are withdrawn.
Applicant has amended the Spec. to overcome Objections; the previous objections are withdrawn.
Applicant has argued to overcome the 112(a) rejection; the 112(a) rejection is maintained.
Applicant has amended Claims 56, 59, 62, 66-71, 70-71, 103-105, 107-109 to overcome 112(b) rejections; the previous 112(b) rejections are withdrawn.
Applicant has argued to overcome the 102 and 103 rejections; the 102 and 103 rejections are maintained.
Applicant has argued to overcome the NSDP rejections; the NSDP rejections are maintained. The rejection over copending Application No. 17843774 is withdrawn because the application has been abandoned.
Claims 56, 58-59, 61-62, 66-71, 73-77, 100, 102-110, and 113-115 are examined.
Arguments applicable to newly applied rejections to amended or newly presented claims are addressed below. Arguments that are no longer relevant are not addressed.
Rejections not reiterated here are withdrawn.
Information Disclosure Statement
The IDS has been considered.
Specification
The disclosure is objected to because of the following informalities: The Spec discloses (¶153) using GLS4 from Sunshine Pharma but a search reveals that the correct company name is Sunshine Lake Pharma. See IDS document Wu et al. 2013 (citation No. CW, §Materials and Methods-Drugs). The Spec. should disclose the correct name of the company that produces the drug.
Appropriate correction is required.
Claim Objections
Claim 69 is objected to because of the following informalities: Claim 69 recites …(A) 1 dose, (F) 1 dose, and (K) 1 dose. That is all the same recitation so reciting it three times is repetitive and unnecessary. The claim should be amended to recite 1 dose only a single time. Claims 113-114 depend from Claim 69 so have the same problem. Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 75-77 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a written description rejection. This rejection is maintained.
Claim 75 recites the method according to claim 56, wherein the method further comprises administering an effective amount of at least one additional therapeutic agent. Claim 76 recites the method according to claim 75, wherein the additional therapeutic agent is an antiviral agent. Claim 77 recites a method according to claim 76, wherein the antiviral agent is one or more of: interferon; ribavirin; an HBV RNA replication inhibitor; a second antisense oligomer; an HBV therapeutic vaccine; an HBV prophylactic vaccine; lamivudine (3TC); entecavir; tenofovir; telbivudine (LdT); adefovir; an HBV antibody therapy (monoclonal or polyclonal); an anti-PDL1/PD1 monoclonal antibody; an anti PD-L1 antisense oligonucleotide; a TLR7 agonist; a TLR8 agonist; and a CpAM.
Broad Claim 75 encompasses methods comprising any additional agent that has the function of being a therapeutic agent. Broad Claim 76 encompasses methods comprising any additional therapeutic agent that has the function of antiviral activity. Broad Claim 77 encompasses the large genus of antiviral agents that fall into any of the following subgenera: an interferon; an HBV RNA replication inhibitor; a second antisense oligomer; an HBV therapeutic vaccine; an HBV prophylactic vaccine; an HBV antibody therapy (monoclonal or polyclonal); an anti-PDL1/PD1 monoclonal antibody; an anti PD-L1 antisense oligonucleotide; a TLR7 agonist; a TLR8 agonist; and a CpAM.
Any kind of agent that has any therapeutic effect; any agent that has any antiviral effect; and any interferon; any HBV RNA replication inhibitor; any second antisense oligomer; any HBV therapeutic vaccine; any HBV prophylactic vaccine; any HBV antibody therapy (monoclonal or polyclonal); any anti-PDL1/PD1 monoclonal antibody; any anti PD-L1 antisense oligonucleotide; any TLR7 agonist; any TLR8 agonist; or any CpAM would be encompassed by the claims as instantly presented. The claims recite functional language (i.e., an additional therapeutic agent, an antiviral agent, and any of the broad categories specified above [interferon, etc.]) but does not disclose any structure responsible for the therapeutic, antiviral, interferon/HBV RNA replication inhibitor/antisense oligomer/HBV therapeutic vaccine/HBV prophylactic vaccine/HBV antibody therapy (monoclonal or polyclonal)/anti-PDL1/PD1 monoclonal antibody/anti PD-L1 antisense oligonucleotide/TLR7 agonist/TLR8 agonist/CpAM activity. What is disclosed in the Spec. is not sufficient to demonstrate that, at time of filing, Applicant was in possession of methods comprising any of the claimed species.
An original claim may lack written description support when a broad genus claim is presented but the disclosure only describes a narrow species with no evidence that the genus is contemplated. See Ariad Pharms., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1349-50 (Fed. Cir. 2010) (en banc). The written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406. See MPEP 2163.
The Spec. describes combination therapies in ¶148-174. Those passages discuss the kinds of therapeutic agents that can be used but does not disclose any structure shared by or common to the therapeutic, antiviral, or agents that are any of: interferon/HBV RNA replication inhibitor/antisense oligomer/HBV therapeutic vaccine/HBV prophylactic vaccine/HBV antibody therapy (monoclonal or polyclonal)/anti-PDL1/PD1 monoclonal antibody/anti PD-L1 antisense oligonucleotide/TLR7 agonist/TLR8 agonist/CpAM.
The broad genus of therapeutic agents, subgenus antiviral agents, and sub-subgenera of interferon/HBV RNA replication inhibitor/antisense oligomer/HBV therapeutic vaccine/HBV prophylactic vaccine/HBV antibody therapy (monoclonal or polyclonal)/anti-PDL1/PD1 monoclonal antibody/anti PD-L1 antisense oligonucleotide/TLR7 agonist/TLR8 agonist/CpAM comprise diverse categories of agents with different structures underlying their function(s). Regarding what structure is encompassed by the therapeutic agents, antiviral agents, or agents that are any of: interferon/HBV RNA replication inhibitor/antisense oligomer/HBV therapeutic vaccine/HBV prophylactic vaccine/HBV antibody therapy (monoclonal or polyclonal)/anti-PDL1/PD1 monoclonal antibody/anti PD-L1 antisense oligonucleotide/TLR7 agonist/TLR8 agonist/CpAM, the Spec. does not provide information describing any of their features. The claim to at least one additional therapeutic agent is particularly broad because it could encompass any method wherein a patient receives any agent that can be considered a therapeutic agent. Similarly, there are numerous compounds that can be considered to have antiviral properties or fall under the sub-subgenera of therapeutic agents, antiviral agents, or agents that are any of: interferon/HBV RNA replication inhibitor/antisense oligomer/HBV therapeutic vaccine/HBV prophylactic vaccine/HBV antibody therapy (monoclonal or polyclonal)/anti-PDL1/PD1 monoclonal antibody/anti PD-L1 antisense oligonucleotide/TLR7 agonist/TLR8 agonist/CpAM. Furthermore, antibodies are a very broad category of compounds and the Spec. merely discloses (¶157) the HBV antibody therapy is an antibody that binds to the hepatitis B surface antigen, but does not disclose any corresponding structures. The Spec. does not disclose what physical structure(s) are responsible for the claimed function(s). The Spec. does not disclose any physical structure(s) responsible for the claimed function(s) and, with the exception of the named additional therapeutic antiviral agents (i.e., specifically ribavirin, lamivudine, entecavir, tenofovir, telbivudine, and adefovir), an artisan would not immediately envision any defining characteristics of the compounds encompassed by the claims.
Applicant’s examples (¶318-372) show treatment with the claimed oligo and that (¶340) patients receiving entecavir or tenofovir were treated. However, those examples are not sufficient to provide written description support for methods comprising any kind of agent that has any therapeutic effect; any agent that has any antiviral effect; and any interferon; any HBV RNA replication inhibitor; any second antisense oligomer; any HBV therapeutic vaccine; any HBV prophylactic vaccine; any HBV antibody therapy (monoclonal or polyclonal); any anti-PDL1/PD1 monoclonal antibody; any anti PD-L1 antisense oligonucleotide; any TLR7 agonist; any TLR8 agonist; or any CpAM. Although the claims claim the functional characteristics (i.e., therapeutic agents, antiviral agents, or agents that are any of: interferon/HBV RNA replication inhibitor/antisense oligomer/HBV therapeutic vaccine/HBV prophylactic vaccine/HBV antibody therapy (monoclonal or polyclonal)/anti-PDL1/PD1 monoclonal antibody/anti PD-L1 antisense oligonucleotide/TLR7 agonist/TLR8 agonist/CpAM), none of the functional characteristics is coupled with any known or disclosed structure.
Although the Specification teaches the examples discussed above, it does not identify a core structure necessary for performing the claimed function(s) of being a therapeutic agent, an antiviral agent, or an agent that is an interferon/HBV RNA replication inhibitor/antisense oligomer/HBV therapeutic vaccine/HBV prophylactic vaccine/HBV antibody therapy (monoclonal or polyclonal)/anti-PDL1/PD1 monoclonal antibody/anti PD-L1 antisense oligonucleotide/TLR7 agonist/TLR8 agonist/CpAM. The Spec. does not disclose any core structure, partial structure, physical or chemical property, or functional characteristic coupled with a known or disclosed structure/function relationship responsible for being a therapeutic agent, an antiviral agent, or an agent that is an interferon/HBV RNA replication inhibitor/antisense oligomer/HBV therapeutic vaccine/HBV prophylactic vaccine/HBV antibody therapy (monoclonal or polyclonal)/anti-PDL1/PD1 monoclonal antibody/anti PD-L1 antisense oligonucleotide/TLR7 agonist/TLR8 agonist/CpAM in such a way to demonstrate possession of the full invention as claimed at time of filing. The members of the claimed genus, subgenus, and sub-subgenera do not share a core structure.
The specification teaches only these species within the claimed genus/genera: methods wherein the patient was already receiving entecavir or tenofovir; but those are only a paltry number compared with the breadth of what is claimed. .Altogether, the number of species disclosed by complete structure is not sufficient to provide the written description support for the huge genera and subgenera that are encompassed by the claims.
While none of these elements is specifically required to demonstrate possession, in combination their absence means that one skilled in the art at the time of filing would conclude that the inventors lacked possession of the full breadth of the invention claimed. Claims 75-77 are rejected for failing to demonstrate possession of the claimed invention. Claims 76-77 are rejected because they depend from Claim(s) 75 and/or 76 and do not remedy the issues.
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 69 and 113 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
A claim may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173. In the present instance, Claim 69 recites:
A method for treating hepatitis B or hepatitis B virus (HBV) infection in a human patient, the method comprising administering to the patient an oligonucleotide… further comprising administering to the patient one or more subsequent doses of the oligonucleotide in an amount that is from 0.1 mg/kg to 12 mg/kg… wherein the oligonucleotide is administered according to any of the following treatment regimens:
(A) 1 dose;
(B) 2 doses with 4 weeks (W) between doses;
(C) 3 doses with 4W between doses;
(D) 4 doses with 4W between doses;
(E) 5 doses with 4W between doses;
(F) 1 dose;
(G) 2 doses with 8W between doses;
(H) 3 doses with 8W between doses;
(I) 4 doses with 8W between doses;
(J) 5 doses with 8W between doses;
(K) 1 dose;
(L) 2 doses with 4W, 8W, 12W, 16W, 20W, or 24W between doses;
(M) 3 doses with 4W, 8W, 12W, 16W, 20W, or 24W between doses;
(N) 4 doses with 4W, 8W, 12W, 16W, 20W, or 24W between doses; or
(O) 5 doses with 4W, 8W, 12W, 16W, 20W, or 24W between doses.
The claim(s) are considered indefinite because there is a question or doubt as to what are the metes and bounds of the claim. The metes and bounds are unclear because Claim 69 recites that the oligont is administered according to regimens (A), (F), and (K). In each of those regimens (A), (F), and (K), the oligont is administered in one dose. But Claim 69 depends from Claim 62 which recites the method according to Claim 56, further comprising administering… one or more subsequent doses of the oligont. Claim 62 depends from Claim 56 which recites a method comprising administering to the patient an oligont. Claim 62 requires, therefore, administering at least two doses: the dose of Claim 56 and one (or more) subsequent doses of Claim 62. But then Claim 69 requires the oligont is administered at one dose. Since the requirement of Claim 69 (A), (F), and (K) to administer one dose is incompatible with the requirements of the claims from which it depends, the metes and bounds of Claim 69 are indefinite.
Claim 69 is rejected for those reasons. Claim 113 is rejected because it depends from Claim 69 and does not remedy the issues. In the interest of compact prosecution, Claim 69 is interpreted as if the recited number of dose(s) are the subsequent dose(s) that administered after the initial dose of Claim 56. So Claim 69 (A), (F), and (K) is interpreted as if it requires a single subsequent dose that is administered after the initial dose of Claim 56 (no interval is required for A, F, and ). The other limitations of Claim 69 (B)-(E), (G)-(J), and (L)-(O) are interpreted as requiring 2-5 subsequent doses at the recited intervals.
Claim 113 recites:
A method … wherein the oligonucleotide is administered according to any of the following treatment regimens:
… (B) 2 doses with 4 weeks (W) between doses…
(G) 2 doses with 8W between doses…
(L) 2 doses with 4W, 8W, 12W, 16W, 20W, or 24W between doses…,
wherein any of dosing regimens A-O further includes a treatment holiday period of 1 to 18 months.
The claim(s) are considered indefinite because there is a question or doubt as to what are the metes and bounds of the claim. The metes and bounds are unclear because Claim 113 recites that the oligont is administered according to regimens wherein there are 4W, 8W, 12W, 16W, 20W, or 24W between doses but the claim also requires that the dosing regimen includes a treatment holiday period of 1 to 18 months. It is not clear where the treatment holiday period of Claim 113 occurs within the treatment regimen of Claim 69. If the treatment holiday period occurs after all the doses of Claim 69, how can the treatment holiday period be limited to 1-18 months? A treatment holiday occurs between doses, so how can there be a treatment holiday period of 1-18 months if the regimen is followed and there is no further dose? Furthermore, if the treatment holiday period occurs within doses specified by Claim 69, it is not clear how the 1-18 month treatment holiday would fit into those regimens.
Claim 113 is indefinite and rejected for those reasons. In the interest of compact prosecution, Claim 113 is interpreted as if the treatment holiday period can occur at any point within or after the regimens of Claim 69. For example, if the treatment holiday occurs within (H), one of the 8W periods would count as the treatment holiday of Claim 113. If the treatment holiday occurs after (A)-(O), Claim 113 requires another dose.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claim(s) 58, 59, 61-62, 66-69, 71, 73-77, 100, 102, 103-110, and 115 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by International Patent Publication No. WO 2019/079781 (published 25 April 2019, “WO781”, of record on IDS) as evidenced by Wikipedia (Archived 20 June 2019. “Human body weight”. Available online at Wikipedia.org. Accessed on 09 December 2025, “Wikipedia”). This rejection is maintained and updated in view of the claim amendments and to correct typographical errors. All references are of record.
WO781 (§Abstract) relates to potent oligo for reducing hepatitis B virus antigen (HBsAg) expression and treating HBV infections.
Regarding Claims 56 and 106: WO781 discloses (¶11-15; ¶23-28) methods of treating HBV in a subject by administering to the subject an oligo comprising a sense strand sequence that is SEQ ID NO 8 (GACAAAAAUCCUCACAAUAAGCAGCCGAAAGGCUGC and comprising 2’-F modified nts at positions 3, 8-10, 12, 13, and 17; 2'-O-methyl modified nucleotides at positions 1, 2, 4-7, 11, 14-16, 18-26, and 31-36, and one phosphorothioate [PS] internucleotide linkage between the nucleotides at positions 1 and 2); an antisense (AS) strand sequence that is SEQ ID NO 5.1 (UUAUUGUGAGGAUUUUUGUCGG, and comprising 2’-F modified nts at positions 2, 3, 5, 7, 8, 10, 12, 14, 16, and 19; 2'-O-methyl modified nucleotides at positions 1, 4, 6, 9, 11, 13, 15, 17, 18, and 20-22, and five phosphorothioate internucleotide linkages between nucleotides 1 and 2, 2 and 3, 3 and 4, 20 and 21, and 21 and 22), wherein the 4’-carbon sugar of the 5’ nt of the AS strand has the following structure:
PNG
media_image1.png
272
289
media_image1.png
Greyscale
; and wherein each of the nucleotides of the -GAAA- sequence on the sense strand is conjugated to a monovalent GalNac moiety, wherein the -GAAA- sequence comprises the structure:
PNG
media_image2.png
707
523
media_image2.png
Greyscale
.
Those structures are the same as the structures shown in Claim 106. WO781 SEQ ID NO 8 is 100% identical to claimed SEQ ID NO1 and WO781 SEQ ID NO 5.1 is 100% to claimed SEQ ID NO 2. That is demonstrated by the following alignments. Note that WO781 SEQ ID NO 8 is called SEQ ID NO 9 in the search results and WO781 SEQ ID NO 5.1 is called SEQ ID NO 6 in the search results but regardless of how those sequences are numbered, they are 100% identical to, respectively, claimed SEQ ID NOs 1 and 2:
RESULT 2
BGF86935
(NOTE: this sequence has 10 duplicates in the database searched.
See complete list at the end of this report)
ID BGF86935 standard; RNA; 36 BP.
XX
AC BGF86935;
XX
DT 13-JUN-2019 (first entry)
XX
DE Hepatitis B virus surface antigen mRNA targeted oligo, SEQ:9.
XX
KW antiinflammatory; antimicrobial-gen.; antisense oligonucleotide;
KW antisense therapy; gastrointestinal-gen.; gene silencing;
KW hepatitis b virus infection; hepatotropic; rna interference; ss;
KW surface antigen; therapeutic; virucide.
XX
OS Hepatitis B virus.
XX
CC PN WO2019079781-A2.
XX
CC PD 25-APR-2019.
XX
CC PF 19-OCT-2018; 2018WO-US056801.
XX
PR 20-OCT-2017; 2017US-0575358P.
XX
CC PA (DICE-) DICERNA PHARM INC.
XX
CC PI Koser M, Abrams M;
XX
DR WPI; 2019-37008R/34.
XX
CC PT New oligonucleotide comprises antisense strand comprising region of
CC PT complementarity to sequence of hepatitis B virus surface antigen (HBsAg)
CC PT mRNA for reducing expression of HBsAg mRNA and for treating hepatitis B
CC PT virus infection in subject.
XX
CC PS Claim 12; SEQ ID NO 9; 99pp; English.
XX
CC The present invention relates to a novel oligonucleotide for reducing
CC expression of hepatitis B virus surface antigen (HBsAg) mRNA. The
CC invention further discloses: (1) a composition comprising the
CC oligonucleotide and a counterion; (2) a method for reducing expression of
CC the HBsAg in a cell, which involves delivering to the cell the
CC oligonucleotide; and (3) a method for treating hepatitis B virus (HBV)
CC infection in a subject, which involves administering to the subject the
CC oligonucleotide or the composition. The novel oligonucleotide of the
CC invention is useful for treating HBV infection. The present sequence
CC represents a Hepatitis B virus surface antigen mRNA targeted oligo, which
CC is useful for treating HBV infection. Note: The present sequence is
CC described as SEQ ID NO:9 in the sequence listing, but it differs from the
CC sequence given as SEQ ID NO:9 on page 25 (see BGF86937) and the present
CC sequence is also described as SEQ ID NO:8 on page 22.
XX
SQ Sequence 36 BP; 15 A; 10 C; 7 G; 0 T; 4 U; 0 Other;
Query Match 100.0%; Score 36; Length 36;
Best Local Similarity 88.9%;
Matches 32; Conservative 4; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GACAAAAATCCTCACAATAAGCAGCCGAAAGGCTGC 36
||||||||:||:|||||:|||||||||||||||:||
Db 1 GACAAAAAUCCUCACAAUAAGCAGCCGAAAGGCUGC 36
RESULT 1
BGF86932
(NOTE: this sequence has 11 duplicates in the database searched.
See complete list at the end of this report)
ID BGF86932 standard; RNA; 22 BP.
XX
[same information as in alignment above; truncated to save space]
XX
DE Hepatitis B virus surface antigen mRNA targeted oligo, SEQ:6.
XX
[same information as in alignment above; truncated to save space]
XX
OS Hepatitis B virus.
XX
CC PN WO2019079781-A2.
XX
[same information as in alignment above; truncated to save space]
XX
CC PS Claim 12; SEQ ID NO 6; 99pp; English.
XX
[same information as in alignment above; truncated to save space]
XX
SQ Sequence 22 BP; 3 A; 1 C; 7 G; 0 T; 11 U; 0 Other;
Query Match 100.0%; Score 22; Length 22;
Best Local Similarity 50.0%;
Matches 11; Conservative 11; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TTATTGTGAGGATTTTTGTCGG 22
::|::|:|||||:::::|:|||
Db 1 UUAUUGUGAGGAUUUUUGUCGG 22
WO781 refers to compounds “HBV(s)-219” and “HBV(s)-219P2 throughout. Note that WO781 discloses (¶175, Table 4) that HBV(s)-219 and HBV(s)-219P2 comprise the same structure as what is claimed.
Regarding the human subject of Claims 56 and 109, WO781 defines (¶80) “subject” as including human subjects.
Regarding the pharmaceutically acceptable salt of the oligo of Claims 56, 106, 107, 109, the sodium salt of Claim 115, and the oligo shown in instant Fig. 2a or 2b (i.e., Claim 108), WO781 discloses (¶26) the composition further comprises Na+ counterions and shows (Fig. 19AB) the very same oligo in sodium salt form.
Regarding the subcutaneous administration route and initial dose of from 0.1 mg/kg to 12 mg/kg of oligo (i.e., Claims 56 and 109) and the pharmaceutically acceptable solvent/carrier/excipient/diluent/adjuvant that is phosphate buffered saline (i.e., “PBS”) of Claim 110, WO781 discloses (¶45) mice who were administered 3 mg/kg of HBV(s)219P1 in PBS, administered subcutaneously and (¶185) discloses mice who were administered a single 1 mg/kg or 3 mg/kg subcutaneous (SC) dose of HBV(s)-219P2 and exhibited benefits vs. PBS-treated control mice, which indicates the compound was administered in PBS. 3 mg/kg falls within the claimed range of 0.1 mg/kg to 12 mg/kg. WO781 discloses (¶161) the exact range of 0.1 mg/kg to 12 mg/kg.
Altogether, WO781 discloses all the limitations of, and therefore anticipates, Claims 56, 106-110, and 115.
Regarding Claim 58, WO781 discloses (¶234-241) their treatment method is for adults with hepatitis B that is chronic hepatitis B. Therefore WO781 anticipates Claim 58.
Regarding the variety of dosages and treatment regimens that may be used to administer the oligo (i.e., Claims 59, 61-62, 66-71, and 103-105), WO781 discloses (¶150) various factors contribute to and are contemplated by a person skilled in the art and preparing pharmaceutical formulations, and as such, a variety of dosages and treatment regimens may be desirable.
Regarding the dosages of Claims 59, 62, and 103-105, WO781 discloses (¶161-163):
The appropriate dosage for any one subject will depend on certain factors, including the subject’s size, body surface area, age, the particular composition to be administered, the active ingredient(s) in the composition, time and route of administration, general health, and other drugs being administered concurrently. For example, the dosage can be in the range of 0.1 mg/kg to 12 mg/kg. The dosage could also be in the range of 0.5 to 10 mg/kg. Alternatively, the dosage can be in the range of 1.0 to 6.0 mg/kg. The dosage could also be in the range of 3.0 to 5.0 mg/kg.
Those passages indicate that exact dosage depends on various factors but their invention encompasses the specific ranges stated. Those ranges encompass the claimed dose ranges of 1.5-3 mg/kg, 3 mg/kg, 6 mg/kg, 0.1-12 mg/kg, and 1.5 mg/kg. In addition, WO781 discloses (¶49, Fig. 18) doses that are exactly 1, 1.5, 3, 6, and 12 mg/kg. Therefore WO781 anticipates Claim 59 and the dose limitations of Claims 62 and 103-105.
Regarding the single dose of Claim 61, WO781 discloses (¶85) in some embodiments the reduction in HBsAg expression persists for an extended period of time following a single dose or treatment regimen. WO781 discloses (¶37, ¶173, and Fig. 8) a single dose of the oligo was administered to mice and was effective. Therefore WO781 anticipates Claim 61.
Regarding the subsequent doses of Claim 62, WO781 discloses (¶178-179, Fig. 12AB) mice were treated with three once-weekly doses of 3 mg/kg of oligo. Therefore WO781 anticipates Claim 62.
Regarding the treatment timing of Claims 66-69 and 103, WO781 discloses (¶163) nonlimiting examples wherein the compounds can be administered quarterly (once every three months), bi-monthly (once every two months), monthly, or weekly. For example, the oligonucleotides may be administered every one, two, or three weeks. The oligonucleotides may be administered daily. WO781’s timing of “monthly” encompasses doses separated in time by at least 4 weeks (i.e., therefore anticipating Claim 66). WO781’s timings of “quarterly”, bimonthly, and “monthly” encompass doses separated in time by 1 month, 2 months, and 3 months (i.e., therefore anticipating Claim 68).
Further regarding Claim 67: WO781 discloses (¶156-157) the detectable reduction in HBsAg expression obtained with the oligo can persist for anywhere from 10-70 days or 2 to 21 weeks. Therefore a person of ordinary skill in the art would have administered the oligos at any of those intervals, including once every 4 weeks for 12 weeks. Therefore WO781 anticipates Claim 67.
Regarding Claim 69: As discussed above in §112(b), Claim 69 isn’t clear but is interpreted as requiring the specified number of subsequent doses at any interval (i.e., A, F, and K) or at the specified intervals (i.e., B-E, G-J, and L-O). Any dosing interval that comprises 4, 8, or 12 weeks between doses reads on Claim 69. As discussed in the preceding two ¶s, WO781 discloses dosing intervals of once every 3 months (i.e., “quarterly”), 2 months, or once every month. Those timeframes encompass 4 weeks, 8 weeks, or 12 weeks. Therefore WO781 anticipates Claim 69.
Regarding the patient who has not previously been treated with an antiviral therapy of Claims 71 and 103-105, WO781 discloses (¶249) inclusion criteria for their study on the efficacy of using their oligo to treat adult patients with HBV. That ¶ discloses that patients who are treatment-naïve for HBV and have received no previous antiviral therapy for HBV may be included in their study. A patient who is treatment naïve for antiviral treatment has never received such treatment, including for a period of at least 6 months. Therefore WO781 anticipates Claim 71. Regarding the dosages of oligo, that has been addressed above: as discussed, WO781 discloses (Fig. 18) Cohort A (adults without HBV) who receive a dose of 0.1, 1.5, 3, 6, or 12 mg/kg; Cohort B (adults with HBV) who receive a dose of 3 mg/kg; and Cohort C who receive 4 doses at 1.5, 3, or 6 mg/kg. As discussed, WO781 discloses (¶160-163) patients can receive a dose once a month which is the same as doses being separated by 4 weeks. Those doses and timeframes are what are recited in the claims. Therefore WO781 anticipates Claims 103-105.
Regarding the patient who is HB3Ag positive or negative of Claim 73: WO781 discloses (¶65) in individual having HBV infection can be identified by detecting HBeAg. That patient would then be HBeAg positive. WO781 discloses (¶234-239) inclusion criteria for adults with HBV and those include patients who are either positive or negative for HBeAg. Therefore WO781 anticipates Claim 73.
Regarding the monotherapy of Claim 74, WO781 discloses (¶45) the mice received only the single therapeutic agent HBV(s)-219P1 and discusses (¶183-187; Figs. 8, 12, 14-15) using the oligo as a monotherapy. Therefore WO781 anticipates Claim 74.
Regarding the additional therapeutic/antiviral agent that can be entecavir of Claims 75-77, WO781 discloses (¶24, Fig. 15) their methods can further comprise administering to the subject an effective amount of Entecavir. Therefore WO781 anticipates Claims 75-77.
Regarding the concomitant or sequential administration of the oligo and the additional therapeutic agent of Claim 100 and the initial administration of the oligo followed by administration of the additional agent of Claim 102, a combination therapy would inherently require either concomitant or sequential administration of two drugs. Furthermore, WO781 discloses (¶46, Fig. 15) the oligo was administered followed by dosing of entecavir. Therefore WO781 anticipates Claims 100 and 102.
Regarding dosages in mg instead of mg/kg (recited in Claims 56, 59, and 62): As discussed,WO781 discloses dosages of 0.1 to 12 mg/kg but does not clarify what a 0.1 mg/kg to 12 mg/kg dose comes to in mg for an average human. However, Wikipedia provides evidence (§Average weight around the world-By region) that average human body weight is 62 kg or 80 kg in North America. That means a dose for an individual could range from 6.2 mg to 744 mg (based on world average) or from 8 mg to 960 mg (based on North American average). Therefore WO781 discloses all the dosages in mg recited in Claims 56, 59, and 62.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 56, 58-59, 61-62, 66-71, 73-77, 100, 102-110, and 113-115 are rejected under 35 U.S.C. 103 as being unpatentable over International Patent Publication No. WO 2019/079781 (published 25 April 2019, “WO781”, of record on IDS) as applied to Claim(s) 58, 59, 61-62, 66-69, 71, 73-77, 100, 102, 103-110, and 115 in the 102 rejection above, and further in view of US Patent Application Publication No. US 2013/0251673 (published 26 September 2013, “App673”) and Tenold (et al. April 2020. Current Approaches to the Treatment of Advanced or Metastatic Renal Cell Carcinoma. ASCO Edu. Book 40:187-196, “Tenold”). This rejection is maintained and updated in view of the claim amendments. All references are of record.
The teachings of WO781 as applicable to Claim(s) 58, 59, 61-62, 66-69, 71, 73-77, 100, 102, 103-110, and 115 have been described above.
WO781 teaches the claimed compounds and methods of using them. As discussed in the 102 rejection, WO781 teaches (¶161, Fig. 18) the dosages of 0.1-12 mg/kg including 1 mg/kg, 1.5 mg/kg, 3 mg/kg, 6 mg/kg, and 12 mg/kg, including (Fig. 18) dosing 4 times. WO781 teaches (¶150, ¶160-163, ¶298-300) using amounts capable of producing a desirable therapeutic result, various dosages, dosing intervals, treatment regimens, and that skilled artisans take into account a variety of factors when choosing a dose and treatment regimen. WO781 teaches (¶156-157) reduction in HBV antigen can persist for long periods of time (10 weeks or up to 21 weeks) after a treatment—(¶85, ¶166, ¶173, Fig. 8) even after a single treatment. WO781 teaches (¶188) their clinical trial seeks to evaluate the safety and tolerability of their oligo in human patients. That indicates that tolerability of the oligos was a concern.
WO781 does not explicitly teach the method of treating: wherein the doses are separated in time from each other by exactly 4 weeks and administered over a period of exactly 48, 24, or 12 weeks (Claim 67); wherein a patient is dosed 2-5 times and the period of time between doses is exactly 4 weeks, 8 weeks, 12 weeks, 16 weeks, 20 weeks, or 24 weeks (Claims 69 and 113); comprises a treatment holiday (Claim 70) or that the treatment holiday can be exactly 3-6 months (Claim 114); or wherein the patient is administered an initial dose of oligo followed by 3 subsequent doses of oligo, wherein the doses are separated in time from each other by a period of exactly 4 weeks (Claim 103).
However, App673, drawn to methods of treating HBV using a different compound, teaches (¶429) dosing regimens can include but are not limited to… once a week and once every two weeks [emphasis added] and those skilled in the art use a various criteria to decide on a dosage regimen. App673 teaches (¶457-460) various treatment regimens and that treatment can incorporate a period of time wherein administration of the drug is temporarily suspended for any period of time between 2 days and 1 year, including the specific periods of time 28 days (i.e., exactly 4 weeks), 100 days (i.e., exactly 3 months), and 180 days (i.e., exactly 6 months). Note that 2-365 days also encompasses 56 days (i.e., exactly 8 weeks), 84 days (i.e., exactly 12 weeks), 112 days (i.e., exactly 16 weeks), 140 days (i.e., exactly 20 weeks), or 168 days (i.e., exactly 24 weeks) or exactly 1-12 months. Those are limitations of Claims 67, 69-70, 103, and 113-114.
Although App673 uses the term “drug holiday” and the claims recite “treatment holiday” a person of ordinary skill in the art would recognize those are merely different terms for the same thing. An artisan may not know the benefit of a “drug holiday” or “treatment holiday” but they would turn to what else is known in the art to determine whether there are benefits to employing one.
Tenold, drawn to approaches for treating cancer, teaches (§Principles Underlying Decision-Making in the Previously Treated Setting-Intolerance ¶3) such treatment holiday can give patients a chance to recover from side effects. Tenold teaches (same §) the treatment holiday can be 1-2 weeks but if a disease has been stable or in ongoing response for a prolonged period, longer treatment breaks can be considered.
Although Tenold is directed to treating cancer, an artisan would readily recognize, particularly in light of the teachings of App673, treatment drug holidays can be applied to any condition wherein a drug is administered because a drug can produce side effects.
Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the methods for treating HBV of WO781 with the teachings about a treatment holiday of App673 and Tenold for the benefit of allowing patients to recover from side effects. One would have been motivated to do so with a reasonable expectation of success because App673 teaches (¶460) a “drug holiday” may be incorporated into methods of treating HBV, because Tenold teaches (§Principles Underlying Decision-Making in the Previously Treated Setting-Intolerance ¶3) such holiday can give patients a chance to recover from side effects, and because WO781 teaches (¶156-157) their oligos result in detectable reduction in HBsAg expression that can persist for various time periods. WO781 also teaches (¶150) dosing and treatment regimens can be determined by skilled artisans and demonstrates (¶188) the inventors were concerned with patient tolerability of the oligos. Those concerns would have led an artisan to employ different dosages and treatment regimens, including regimens comprising treatment holidays of various lengths. Therefore the limitations of Claims 70, and 114 would have been obvious in view of WO781, App673, and Tenold.
Regarding the doses separated by exact intervals including 4 weeks and a total duration of treatment that is 48 weeks, 24 weeks, 3 months, or 12 weeks (i.e., limitations recited in Claim 67); wherein the oligont is administered at various dosing schedules A-O (Claims 69 and 113); and wherein the patient is administered an initial dose of the oligont followed by three subsequent doses of the oligont, wherein the doses are separated in time from each other by 4 weeks (Claim 103), WO781 teaches (¶2) HBV is a chronic infection, (¶156-157) the oligo’s effects can persist for varying amounts of time including 10 to 70 days (and periods in between) or periods that include 4 weeks, 8 weeks, 12 weeks, and 16 weeks. WO781 (¶150, ¶160-163, ¶298-300) and App673 (as cited above) teach artisans determine treatment regimens and variations thereof as appropriate based on various factors. App673 and Tenold teach benefits of a treatment or drug holiday.
It would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the methods of WO781, App673, and Tenold based on those teachings and in doing so they would have changed the dosage interval, number of doses, total duration of treatment, and/or length of treatment holiday. That would have led them to various treatment regimens including administering the doses every four weeks for a total period of time of 48 weeks, 24 weeks, 3 months, or 12 weeks (Claim 67); 2-5 doses with 4 weeks, 8 weeks, 12 weeks, 16 weeks, or 20 weeks between doses (Claim 69); or an initial dose (at known concentrations of 1.5, 3, or 6 mg/kg) followed by three subsequent doses (also at known concentrations) separated in time from one another by 4 weeks (Claim 103). They would have done so for the benefit of balancing persistence of oligo effects, treatment of a chronic condition, and tolerability of the drug. They would have been motivated to do so with a reasonable expectation of success because WO781 teaches various treatment regimens and describes that artisans take different factors into account when determining such regimens. WO781 explicitly teaches monthly administration, teaches HBV is a chronic condition, and demonstrates that tolerability was a concern. That would have led an artisan to give (WO781 ¶163) monthly doses or doses every 4 weeks, 8 weeks, 12 weeks, 16 weeks, or 20 weeks, and (App673 ¶460) a treatment holiday after periods of treatment including 12 weeks, 3 months, 24 weeks, or 48 weeks. They would have further incorporated any duration of treatment holiday from 2-365 days, which includes treatment holidays of 1-12 months. Therefore the limitations of Claims 67, 69, 103, and 113 would have been obvious in view of WO781, App673, and Tenold.
“[C]onducting clinical trials to test for an optimal dose for a drug ‘is generally a routine process[‘].” Eli Lilly and Co. v. Teva Pharmaceuticals USA, Inc., 619 F.3d 1329, 1342 (Fed. Cir. 2010). “In Mayo, the application of the natural law was merely routine optimization of drug dosage to maximize therapeutic effect.” Ariosa Dignostics, Inc. v. Sequenom, Inc., 809 F.3d 1282, 1293 (Fed. Cir. 2015) (Dyk, J., concurring).
As noted in In re Aller, 105 USPQ 233 at 235, more particularly, where the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation. MPEP 2144.05 provides: It is a settled principle of law that a mere carrying forward of an original patented conception involving only change of form, proportions, or degree, or the substitution of equivalents doing the same thing as the original invention, by substantially the same means, is not such an invention as will sustain a patent, even though the changes of the kind may produce better results than prior inventions (In re Williams, 36 F.2d 436, 438 (CCPA 1929).
Here, the focus is that general conditions are known in the prior art and changes in dosage amount, dosage interval, or dosage number, within known parameters and as documented in the prior art, is not patentable. Here, the prior art teaches how long the exact claimed compound persists in the body. The prior art teaches dosing compounds over a wide range of times and teaches setting or changing a dosing regimen based on various known parameters was routine and conventional in the art of treating HBV. Substitution of known variables in terms of altering dosing frequency and treatment holiday duration in pursuit of optimal or better results is known in the prior art.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 56, 58-59, 61-62, 66-71, 73-77, 100, 102-110, and 113-115 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-21 of U.S. Patent No. 10799524 (“US524”) in view of International Patent Publication No. WO 2019/079781 (published 25 April 2019, “WO781”, of record on IDS), US Patent Application Publication No. US 2013/0251673 (published 26 September 2013, “App673”), and Tenold (et al. April 2020. Current Approaches to the Treatment of Advanced or Metastatic Renal Cell Carcinoma. ASCO Edu. Book 40:187-196, “Tenold”). This rejection is maintained. All references are of record.
Although the claims at issue are not identical, they are not patentably distinct from each other because the instant claims are directed to methods of treating HBV using specific compounds at specific dosages and at specific intervals. The claimed methods can include an additional agent that can be entecavir.
The patented US524 claims are directed to the same compounds and methods of using them.
Both claim sets are directed to the same compounds comprising the same sequences and modifications. It would not be possible to use the claimed methods without the invention of the US524 claims.
The patented US524 claims don’t recite all of the dosages or treatment regimens of the claimed compounds but those would have been obvious in view of WO781 (§Abstract, ¶11-15, ¶24, ¶25-28, ¶37, ¶45, ¶46, ¶49, ¶65, ¶80, ¶85, ¶150, ¶156-157, ¶160-163, ¶161, ¶166, ¶173, ¶175, ¶178-179, ¶183-187, ¶185, ¶188, ¶234-241, ¶249, ¶298-300; Figs. 8, 12AB, 14-15, 18, 19AB; Table 4), App673 (¶429, ¶457-460), and Tenold (§Principles Underlying Decision-Making in the Previously Treated Setting-Intolerance ¶3). Those references teach (cited passages) various dosages, treatment regimens including treatment holiday, the additional compound entecavir, and all the other claim limitations that aren’t in the US524 claims. An artisan would have applied the teachings of WO781, App673, and Tenold to the invention of the US524 claims for the benefits of balancing treatment and tolerability because WO781 indicates (¶188) tolerability was a concern.
Therefore the instant claims would have been obvious in view of the US524 claims, WO781, App673, and Tenold.
Claims 56, 58-59, 61-62, 66-71, 73-77, 100, 102-110, and 113-115 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-2 of U.S. Patent No. 11052104 (“US104”) in view of WO781, App673, and Tenold. This rejection is maintained. All references are of record.
Although the claims at issue are not identical, they are not patentably distinct from each other because the instant claims are directed to methods of treating HBV using specific compounds at specific dosages and at specific intervals. The claimed methods can include an additional agent that can be entecavir.
The patented US104 claims are directed to the same compounds.
Both claim sets are directed to the same compounds comprising the same sequences and modifications. It would not be possible to use the claimed methods without the invention of the US104 claims.
The patented US104 claims don’t recite methods of treating HBV or all of the dosages or treatment regimens of the claimed compounds, but those would have been obvious in view of WO781 (§Abstract, ¶11-15, ¶24, ¶25-28, ¶37, ¶45, ¶46, ¶49, ¶65, ¶80, ¶85, ¶150, ¶156-157, ¶160-163, ¶161, ¶166, ¶173, ¶175, ¶178-179, ¶183-187, ¶185, ¶188, ¶234-241, ¶249, ¶298-300; Figs. 8, 12AB, 14-15, 18, 19AB; Table 4), App673 (¶429, ¶457-460), and Tenold (§Principles Underlying Decision-Making in the Previously Treated Setting-Intolerance ¶3). Those references teach (cited passages) various dosages, treatment regimens including treatment holiday, the additional compound entecavir, and all the other claim limitations that aren’t in the US104 claims. An artisan would have applied the teachings of WO781, App673, and Tenold to the invention of the US104 claims for the benefits of balancing treatment and tolerability because WO781 indicates (¶188) tolerability was a concern.
Therefore the instant claims would have been obvious in view of the US104 claims, WO781, App673, and Tenold.
Claims 56, 58-59, 61-62, 66-71, 73-77, 100, 102-110, and 113-115 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-27 of U.S. Patent No. 11052105 (“US105”) in view of WO781, App673, and Tenold. This rejection is maintained. All references are of record.
Although the claims at issue are not identical, they are not patentably distinct from each other because the instant claims are directed to methods of treating HBV using specific compounds at specific dosages and at specific intervals. The claimed methods can include an additional agent that can be entecavir.
The patented US105 claims are directed to the same compounds and methods of using them.
Both claim sets are directed to the same compounds comprising the same sequences and modifications. It would not be possible to use the claimed methods without the invention of the US105 claims.
The patented US105 claims don’t recite all of the dosages or treatment regimens of the claimed compounds but those would have been obvious in view of WO781 (§Abstract, ¶11-15, ¶24, ¶25-28, ¶37, ¶45, ¶46, ¶49, ¶65, ¶80, ¶85, ¶150, ¶156-157, ¶160-163, ¶161, ¶166, ¶173, ¶175, ¶178-179, ¶183-187, ¶185, ¶188, ¶234-241, ¶249, ¶298-300; Figs. 8, 12AB, 14-15, 18, 19AB; Table 4), App673 (¶429, ¶457-460), and Tenold (§Principles Underlying Decision-Making in the Previously Treated Setting-Intolerance ¶3). Those references teach (cited passages) various dosages, treatment regimens including treatment holiday, the additional compound entecavir, and all the other claim limitations that aren’t in the US105 claims. An artisan would have applied the teachings of WO781, App673, and Tenold to the invention of the US105 claims for the benefits of balancing treatment and tolerability because WO781 indicates (¶188) tolerability was a concern.
Therefore the instant claims would have been obvious in view of the US105 claims, WO781, App673, and Tenold.
Claims 56, 58-59, 61-62, 66-71, 73-77, 100, 102-110, and 113-115 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-21 of U.S. Patent No. 11273173 (“US173”) in view of WO781, App673, and Tenold. This rejection is maintained. All references are of record.
Although the claims at issue are not identical, they are not patentably distinct from each other because the instant claims are directed to methods of treating HBV using specific compounds at specific dosages and at specific intervals. The claimed methods can include an additional agent that can be entecavir.
The patented US173 claims are directed to the same compounds and methods of using them.
Both claim sets are directed to the same compounds comprising the same sequences and modifications. It would not be possible to use the claimed methods without the invention of the US173 claims.
The patented US173 claims don’t recite all of the dosages or treatment regimens of the claimed compounds but those would have been obvious in view of WO781 (§Abstract, ¶11-15, ¶24, ¶25-28, ¶37, ¶45, ¶46, ¶49, ¶65, ¶80, ¶85, ¶150, ¶156-157, ¶160-163, ¶161, ¶166, ¶173, ¶175, ¶178-179, ¶183-187, ¶185, ¶188, ¶234-241, ¶249, ¶298-300; Figs. 8, 12AB, 14-15, 18, 19AB; Table 4), App673 (¶429, ¶457-460), and Tenold (§Principles Underlying Decision-Making in the Previously Treated Setting-Intolerance ¶3). Those references teach (cited passages) various dosages, treatment regimens including treatment holiday, the additional compound entecavir, and all the other claim limitations that aren’t in the US173 claims. An artisan would have applied the teachings of WO781, App673, and Tenold to the invention of the US173 claims for the benefits of balancing treatment and tolerability because WO781 indicates (¶188) tolerability was a concern.
Therefore the instant claims would have been obvious in view of the US173 claims, WO781, App673, and Tenold.
Claims 56, 58-59, 61-62, 66-71, 73-77, 100, 102-110, and 113-115 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-23 of US Patent No. 12564601 (previously copending Application No. 17649781, “App781”) in view of WO781, App673, and Tenold.
Note: This rejection was previously provisional but the patent has now issued. A nonprovisional NSDP rejection over the issued patents is not a new grounds of rejection. This rejection is maintained. All references are of record.
Although the claims at issue are not identical, they are not patentably distinct from each other because the instant claims are directed to methods of treating HBV using specific compounds at specific dosages and at specific intervals. The claimed methods can include an additional agent that can be entecavir.
The copending/allowed App781 claims are directed to the same compounds and methods of using them.
Both claim sets are directed to the same compounds comprising the same sequences and modifications. It would not be possible to use the claimed methods without the invention of the App781 claims.
The copending/allowed App781 claims don’t recite all of the dosages or treatment regimens of the claimed compounds but those would have been obvious in view of WO781 (§Abstract, ¶11-15, ¶24, ¶25-28, ¶37, ¶45, ¶46, ¶49, ¶65, ¶80, ¶85, ¶150, ¶156-157, ¶160-163, ¶161, ¶166, ¶173, ¶175, ¶178-179, ¶183-187, ¶185, ¶188, ¶234-241, ¶249, ¶298-300; Figs. 8, 12AB, 14-15, 18, 19AB; Table 4), App673 (¶429, ¶457-460), and Tenold (§Principles Underlying Decision-Making in the Previously Treated Setting-Intolerance ¶3). Those references teach (cited passages) various dosages, treatment regimens including treatment holiday, the additional compound entecavir, and all the other claim limitations that aren’t in the App781 claims. An artisan would have applied the teachings of WO781, App673, and Tenold to the invention of the App781 claims for the benefits of balancing treatment and tolerability because WO781 indicates (¶188) tolerability was a concern.
Therefore the instant claims would have been obvious in view of the App781 claims, WO781, App673, and Tenold.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Claims 56, 58-59, 61-62, 66-71, 73-77, 100, 102-110, and 113-115 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 3, 5-6, 8-9, 11, 18-19, 23, 29, 34, 38, 43-44, 46-48, 71, 75-76, 87, 90-92, 140-141, 154 of copending Application No. 17843740 (reference application, “App740”) in view of WO781, App673, and Tenold. This rejection is maintained. All references are of record.
Although the claims at issue are not identical, they are not patentably distinct from each other because the instant claims are directed to methods of treating HBV using specific compounds at specific dosages and at specific intervals. The claimed methods can include an additional agent that can be entecavir or a TLR7 agonist.
The copending App740 claims are directed to a pharmaceutical combination that comprises a TLR7 agonist and RNAi oligos that are the same compounds as the claimed invention. The copending App740 claims are also direct to methods of using the combination.
Both claim sets are directed to the same compounds comprising the same sequences and modifications. It would not be possible to use the claimed methods without the RNAi invention recited in the App740 claims. Specifically, App740 Claim 9 recites SEQ ID NO 41 which is identical to claimed SEQ ID NO 1 and App740 Claim 11 recites SEQ ID NO 38 which is identical to claimed SEQ ID NO 2.
The copending App740 claims don’t recite all of the dosages or treatment regimens of the claimed compounds but those would have been obvious in view of WO781 (§Abstract, ¶11-15, ¶24, ¶25-28, ¶37, ¶45, ¶46, ¶49, ¶65, ¶80, ¶85, ¶150, ¶156-157, ¶160-163, ¶161, ¶166, ¶173, ¶175, ¶178-179, ¶183-187, ¶185, ¶188, ¶234-241, ¶249, ¶298-300; Figs. 8, 12AB, 14-15, 18, 19AB; Table 4), App673 (¶429, ¶457-460), and Tenold (§Principles Underlying Decision-Making in the Previously Treated Setting-Intolerance ¶3). Those references teach (cited passages) various dosages, treatment regimens including treatment holiday, the additional compound entecavir, and all the other claim limitations that aren’t in the App740 claims. An artisan would have applied the teachings of WO781, App673, and Tenold to the invention of the App740 claims for the benefits of balancing treatment and tolerability because WO781 indicates (¶188) tolerability was a concern.
Therefore the instant claims would have been obvious in view of the App740 claims, WO781, App673, and Tenold.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Claims 56, 58-59, 61-62, 66-71, 73-77, 100, 102-110, and 113-115 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 3, 5-6, 8, 12, 16-17, 25, 31-32, 37, 115-116, 119, 122, 124, 130, 139 of copending Application No. 18659831 (reference application, “App831”) in view of WO781, App673, and Tenold. This rejection is maintained. All references are of record.
Although the claims at issue are not identical, they are not patentably distinct from each other because the instant claims are directed to methods of treating HBV using specific compounds at specific dosages and at specific intervals. The claimed methods can include an additional agent that can be entecavir or an anti-PDL1 antisense oligo.
The copending App831 claims are directed to a pharmaceutical combination that comprises an anti-PDL1 antisense oligo and RNAi oligos that are the same compounds as the claimed invention. The copending App831 claims are also direct to methods of using the combination.
Both claim sets are directed to the same compounds comprising the same sequences and modifications. It would not be possible to use the claimed methods without the RNAi invention recited in the App831 claims. Specifically, App831 Claim 8 recites SEQ ID NO 9 which is identical to claimed SEQ ID NO 1 and App740 Claim 8 also recites SEQ ID NO 6 which is identical to claimed SEQ ID NO 2.
The copending App831 claims don’t recite all of the dosages or treatment regimens of the claimed compounds but those would have been obvious in view of WO781 (§Abstract, ¶11-15, ¶24, ¶25-28, ¶37, ¶45, ¶46, ¶49, ¶65, ¶80, ¶85, ¶150, ¶156-157, ¶160-163, ¶161, ¶166, ¶173, ¶175, ¶178-179, ¶183-187, ¶185, ¶188, ¶234-241, ¶249, ¶298-300; Figs. 8, 12AB, 14-15, 18, 19AB; Table 4), App673 (¶429, ¶457-460), and Tenold (§Principles Underlying Decision-Making in the Previously Treated Setting-Intolerance ¶3). Those references teach (cited passages) various dosages, treatment regimens including treatment holiday, the additional compound entecavir, and all the other claim limitations that aren’t in the App831 claims. An artisan would have applied the teachings of WO781, App673, and Tenold to the invention of the App831 claims for the benefits of balancing treatment and tolerability because WO781 indicates (¶188) tolerability was a concern.
Therefore the instant claims would have been obvious in view of the App831 claims, WO781, App673, and Tenold.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Response to Arguments
Applicant's arguments filed 12 March 2026 have been fully considered but they are not persuasive. Arguments that are no longer relevant are not addressed. Arguments are addressed below.
Claim objection
Claim 69 recites …(A) 1 dose, (F) 1 dose, and (K) 1 dose. That is all the same recitation so reciting it three times is repetitive and unnecessary. The claim should be amended to recite 1 dose only a single time. Claims 113-114 depend from Claim 69 so they have the same problem.
112a Written Description
Applicant’s arguments against the WD rejection are not persuasive. Applicant argues that information that is well known need not be described, that an artisan would recognize that Applicants were in possession of their invention, and that there is no need to provide examples or demonstrate reduction to practice or to divulge a known structure, and that “other identifying characteristics or combinations may demonstrate the requisite possession”. Applicant argues that their Examples show combination therapy involving the claimed oligont and entecavir or tenofovir and that an artisan would recognize that the claimed oligont could be used with additional therapeutic agents.
Those arguments aren’t found persuasive because the WD rejection doesn’t assert that an artisan wouldn’t recognize that the claimed oligont could be used with additional agents. It asserts that the claim recites classes of compounds defined solely by their function. The claims recite more than just entecavir, tenofovir, or other compounds with known structures. The claims encompass the following broad genera: any therapeutic agent, any antiviral agent, any interferon, any antisense oligomer, any HBV therapeutic or prophylactic vaccine, any HBV antibody therapy (including any monoclonal or any polyclonal HBV antibody therapy), any anti-PDL1/PD1 monoclonal antibody, any anti PD-L1 antisense oligont, any TLR7 agonist, any TLR8 agonist, and any CpAM. Those are all broad categories of compounds defined solely by their function. A person of ordinary skill understands that each of those genera contains a vast number of species.
The statute requires that claimed subject matter is described in such a way as to reasonably convey to one skilled in the relevant art that the inventor(s), at the time the application was filed, had possession of the claimed invention. But the Spec. doesn’t describe any defining structure(s) that is common to the claimed genera of therapeutic agents, antiviral agents, interferons, antisense oligomers, HBV therapeutic or prophylactic vaccines, HBV antibody therapies (including monoclonal or polyclonal HBV antibody therapies), anti-PDL1/PD1 monoclonal antibodies, anti PD-L1 antisense oligonts, TLR7 agonists, TLR8 agonists, or CpAMs. The genus “antisense oligomers” alone has a huge number of members. The number and structures of antibodies against any antigen (i.e., PDL1, PD1) are vast and diverse because each individual produces their own antibodies. Similarly, antibodies against HBV encompasses a huge number of molecules, including because such antibodies can bind to HBV or to proteins that HBV codes for. Besides for the fact that it defies credulity that Applicant was in possession of methods comprising any of the claimed species and Applicant hasn’t demonstrated possession of a representative number of claimed species, Applicant hasn’t disclosed any structure common to each genus, subgenus, or sub-subgenus of claimed compounds. Therefore the WD rejection is maintained.
112(b)
Claims 69 and 113 are rejected because the wording of the claim makes unclear exactly how many doses are to be administered and the timing of the treatment holiday relative to the doses and intervals.
102
Applicant traverses the 102 rejection because they assert that WO781 discloses no single embodiment that teaches all the limitation in the claimed invention. They particularly argue with respect to treatment of humans with the claimed oligont via subcutaneous administration and dosage regimens and levels.
Applicant acknowledges (p. 17, full ¶1) WO781 discloses that subjects includes human subjects, but argues that the Examples are directed to studies on mice, not people. Applicant argues that Example 7 is prophetic.
Those arguments aren’t found persuasive. First of all, the 102 rejection is appropriate because WO781 teaches every aspect of the claimed invention.
In other words, for anticipation under 35 U.S.C. 102, the reference must teach every aspect of the claimed invention either explicitly or impliedly. Any feature not directly taught must be inherently present. Whereas, in a rejection based on 35 U.S.C. 103, the reference teachings must somehow be modified in order to meet the claims.
MPEP §2120(III)
In this case, WO781 discloses each aspect of the claims rejected under USC 102. Most notably, WO781 discloses (¶11-15, ¶25-28, ¶175, Table 4) the exact claimed compounds. Applicant hasn’t argued against that. Then, WO781 discloses (¶23) treating a subject which is defined (¶80) to include a human. The rejection also explains that mouse subjects were administered, subcutaneously, doses of 1 mg/kg or 3 mg/kg. WO781 teaches (¶161-164) dosages for subjects (defined at ¶80 to include humans) that are in the range of 0.1 mg/kg to 12 mg/kg and can be subcutaneous. Therefore, and in contrast to Applicant’s arguments, it is clear that WO781 discloses the very same dosages of the very same compound, and administration by the very same route as presently claimed, including to the very same organism, a human.
There is no requirement that a 102 rejection be based on a single embodiment. All the claimed limitations are taught in WO781, and WO781 discloses the exact subject matter (without modification) as the instant claims. Therefore the 102 rejection is maintained.
103
Applicant traverses the 103 rejection because they assert that the cited references are directed to small molecule therapeutics for a different disease than what is instantly claimed. Applicant argues that App673 and Tenold are directed to therapies other than oligont therapies. Applicant argues that the treatments in the cited references are entirely different therapeutic agents with completely different structure and mechanism of action than the claimed invention.
Applicant’s argument is based on the assertion that, despite the fact that Tenold describes a general mechanism by which treatment holidays work (i.e., by providing patients a chance to recover from side effects) and despite the fact that the authors of WO781 were clearly concerned about a patient’s ability to tolerate the drug (see Office action p. 20, full ¶2), a person of ordinary skill would not have found it obvious to apply the known technique (i.e., treatment holiday) for a known purpose (i.e., providing patients a chance to recover from side effects which, an artisan would recognize, are related to tolerability), simply because the App673 and Tenold references discuss a treatment holiday in the context of a different genus of drug.
That is not found persuasive because a person of ordinary skill understands the mechanism by which a treatment holiday benefits a patient is not specific to the kind of medication a patient is taking; a treatment holiday is of benefit to a patient because it that allows a patient to recover from drug side effects. In addition, WO781 teaches that a person of ordinary skill takes into account various pharmacological considerations (including biological half-life) when determining dosage and treatment regimen (see WO781 ¶150, cited below). As discussed in the rejection, WO781 was concerned with tolerability and designed Example 7 to study it in patients (see heading before ¶188). Then, it would have been obvious to use results from evaluating tolerability in conjunction with pharmacological considerations (e.g., biological half-life, among others) and teachings of Tenold about benefits of treatment holiday to determine an appropriate treatment holiday for a patient.
Furthermore, even teachings in WO781 (i.e., “quarterly” administration) inherently encompass a treatment holiday.
Applicant also argues that testing different dose amounts and dosing regimens is not routine. That is not persuasive because WO781 teachings are in conflict with that assertion:
(¶150) [Regarding formulations, f]actors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, as well as other pharmacological considerations will be contemplated by one skilled in the art of preparing such pharmaceutical formulations, and as such, a variety of dosages and treatment regimens may be desirable.
(¶161) [Regarding treatment methods,] …therapeutically acceptable amount may be an amount that is capable of treating a disease or disorder. The appropriate dosage for any one subject will depend on certain factors, including the subject’s size, body surface area, age, the particular composition to be administered, the active ingredient(s) in the composition, time and route of administration, general health, and other drugs being administered concurrently.
(¶298) Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments, optional features, modification and variation of the concepts herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention as defined by the description and the appended claims. [all emphases added.]
Furthermore, App673 teaches (¶429) dosing regimens vary and.
…the compositions of the invention are administered to the patient in range of dosages that include, but are not limited to, once every day, every two, days, every three days to once a week, and once every two weeks. It will be readily apparent to one skilled in the art that the frequency of administration of the various combination compositions of the invention will vary from individual to individual depending on many factors including, but not limited to, age, disease or disorder to be treated, gender, overall health, and other factors. Thus, the invention should not be construed to be limited to any particular dosage regime and the precise dosage and composition to be administered to any patient will be determined by the attending physical taking all other factors about the patient into account.
Those teachings indicate that determining dose amounts and regimens was well within the purview of an artisan of ordinary skill. A person of ordinary skill in the art of treating diseases would have been well aware of treatment holidays and their benefits to patients.
A person of ordinary skill is a person of ordinary competence and creativity and therefore would have been motivated to modify the teachings of WO781 with the teachings of App673 and Tenold for benefits as discussed.
"A person of ordinary skill in the art is also a person of ordinary creativity, not an automaton." KSR, 550 U.S. at 421, 82 USPQ2d at 1397. "[I]n many cases a person of ordinary skill will be able to fit the teachings of multiple patents together like pieces of a puzzle." Id. at 420, 82 USPQ2d at 1397. Office personnel may also take into account "the inferences and creative steps that a person of ordinary skill in the art would employ." Id. at 418, 82 USPQ2d at 1396.
In addition to the factors above, Office personnel may rely on their own technical expertise to describe the knowledge and skills of a person of ordinary skill in the art. The Federal Circuit has stated that examiners and administrative patent judges on the Board are "persons of scientific competence in the fields in which they work" and that their findings are "informed by their scientific knowledge, as to the meaning of prior art references to persons of ordinary skill in the art." In re Berg, 320 F.3d 1310, 1315, 65 USPQ2d 2003, 2007 (Fed. Cir. 2003). In addition, examiners "are assumed to have some expertise in interpreting the references and to be familiar from their work with the level of skill in the art ." PowerOasis, Inc. v. T-Mobile USA, Inc., 522 F.3d 1299, 86 USPQ2d 1385 (Fed. Cir. 2008) (quoting Am. Hoist & Derrick Co. v. Sowa & Sons, 725 F.2d 1350, 1360, 220 USPQ 763, 770 (Fed. Cir. 1984). See MPEP § 2141.03 for a discussion of the level of ordinary skill.
MPEP §2141(II)(c)
The rejection is maintained for those reasons.
NSDP
The arguments against the NSDP rejections and provisional NSDP rejections are not persuasive because the arguments against the 102 and 103 rejections are not persuasive.
Conclusion
Claims 56, 58-59, 61-62, 66-71, 73-77, 100, 102-110, and 113-115 are rejected.
The prior art made of record and not relied upon is considered pertinent to applicant's disclosure. International Publication No. WO 2020/132346 (“WO346”, published on 25 June 2020). WO346 discloses combination therapy including a nucleic acid inhibitor of HBV gene expression. WO346 discloses (p. 130, full ¶4-5) dosing regimens of 1-5 doses wherein the dose or doses may be administered once every four weeks.
This prior art is cited in view of Applicant’s amendments that change the claimed time periods from approximate (e.g., about 4 weeks, etc.) to exact intervals.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to RUTHIE S ARIETI whose telephone number is (571)272-1293. The examiner can normally be reached M-Th 8:30AM-4PM, alternate Fridays 8:30AM-4PM (ET).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram R Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
RUTHIE S ARIETI
Examiner (Ruth.Arieti@uspto.gov)
Art Unit 1635
/RUTH SOPHIA ARIETI/Examiner, Art Unit 1635
/NANCY J LEITH/Primary Examiner, Art Unit 1636