DETAILED ACTION The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA. This application is a divisional of US application 16/607,716, filed 10/23/2019, now US Patent No. 11,572,591, which was the national stage of PCT/US2018/029666, filed 04/26/2018, claiming priority to US provisional application 62/490,460, filed 04/26/2017. As the elected species was first disclosed in the PCT application, the effective filing date of the claimed invention is 04/26/2018. Comment Regarding Application Status and Non-statutory Double Patenting While it is noted that the instant application is identified as a divisional of 16/607,716, in view of the rejoinder of species in the ‘716 application at allowance (Notice mailed 03 October 2022)) - wherein it was stated that “the species election is withdrawn as it is directed to combinations including SEQ ID NOS 58-59” , and Applicant was advised that claims presented in a continuation or divisional that are anticipated by, or include all limitations of, a claim allowable in the ‘716 application may be subject to double patenting rejections – the double patenting rejections set forth below are not barred under 35 USC 121 and are proper. Election/Restriction Applicant’s election without traverse of “methods and products directed to the single ‘CC 8 Clade’ SNP variant, corresponding to variant sequences SEQ ID Nos: 34, 35, and 3; reference sequences SEQ ID NO: 36, 37, and 4; and the primer pair SEQ ID NO: 1 and SEQ ID NO: 2” in the reply filed on 06 February 2026 is acknowledged. Claims 25-26 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected species, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 06 February 2026. Claims 1, 3-16, 21, 24, and 28 are under consideration herein as directed to the elected species identified above. Nucleotide and/or Amino Acid Sequence Disclosures Summary of Requirements for Patent Applications Filed On Or After July 1, 2022, That Have Sequence Disclosures 37 CFR 1.831(a) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.831(b) must contain a “Sequence Listing XML”, as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.831-1.835. This “Sequence Listing XML” part of the disclosure may be submitted: 1. In accordance with 37 CFR 1.831(a) using the symbols and format requirements of 37 CFR 1.832 through 1.834 via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter “Legal Framework”) in XML format, together with an incorporation by reference statement of the material in the XML file in a separate paragraph of the specification (an incorporation by reference paragraph) as required by 37 CFR 1.835(a)(2) or 1.835(b)(2) identifying: a. the name of the XML file b. the date of creation; and c. the size of the XML file in bytes; or 2. In accordance with 37 CFR 1.831(a) using the symbols and format requirements of 37 CFR 1.832 through 1.834 on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation by reference statement of the material in the XML format according to 37 CFR 1.52(e)(8) and 37 CFR 1.835(a)(2) or 1.835(b)(2) in a separate paragraph of the specification identifying: a. the name of the XML file; b. the date of creation; and c. the size of the XML file in bytes. SPECIFIC DEFICIENCIES AND THE REQUIRED RESPONSE TO THIS NOTICE ARE AS FOLLOWS: Specific deficiency - Sequences appearing in the specification are not identified by sequence identifiers (i.e., “SEQ ID NO:X” or the like) in accordance with 37 CFR 1.831(c). In particular, see Table 2 on page 44 of the specification. Required response – Applicant must provide: A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3), and 1.125 inserting the required sequence identifiers, consisting of: • A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version); • A copy of the amended specification without markings (clean version); and • A statement that the substitute specification contains no new matter. Specification The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code. Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01. Claim Interpretation Regarding independent claim 1 and claims dependent therefrom, it is noted that the recitation of the limitation “the SNP variant probe” in d) ( i.e., in the method step “detecting specific hybridization of the SNP variant probe..”) is interpreted as referring to the previously recited “SNP variant polynucleotide probe” (as this is the only reasonable interpretation of the claim language). With regard to dependent claim 4, as this claim is directed to the “microarray of claim 3” – i.e., to the second of the two alternatives of claim 3 (which recites “A polynucleotide probe or a microarray comprising a SNP variant polynucleotide probe…”) – the reference in claim 4 to “the polynucleotide probe” is interpreted as referring to the ‘SNP variant polynucleotide probe” of claim 3 (i.e., this claim limitation as recited in claim 4 is not considered indefinite because it is clear that claim 4 pertains to the “microarray” alternative of claim 3). Claim Rejection – Improper Markush Grouping Claims 1, 3-16, 21, 24, and 28 are rejected on the basis that it contains an improper Markush grouping of alternatives. See In re Harnisch , 631 F.2d 716, 721-22 (CCPA 1980) and Ex parte Hozumi , 3 USPQ2d 1059, 1060 (Bd. Pat. App. & Int. 1984). A Markush grouping is proper if the alternatives defined by the Markush group (i.e., alternatives from which a selection is to be made in the context of a combination or process, or alternative chemical compounds as a whole) share a “single structural similarity” and a common use. A Markush grouping meets these requirements in two situations. First, a Markush grouping is proper if the alternatives are all members of the same recognized physical or chemical class or the same art-recognized class, and are disclosed in the specification or known in the art to be functionally equivalent and have a common use. Second, where a Markush grouping describes alternative chemical compounds, whether by words or chemical formulas, and the alternatives do not belong to a recognized class as set forth above, the members of the Markush grouping may be considered to share a “single structural similarity” and common use where the alternatives share both a substantial structural feature and a common use that flows from the substantial structural feature. See MPEP § 2117. The Markush grouping s of methods directed to detection of one of a group of 8 different CC8 clades/strains of S. aureus (including the elected species of “CC8 Clade” and 7 others, as recited in, e.g., independent claim 1), as well as of products targeting each of these different clades/strains (as are set forth in the product claims 3-5 and 9) is improper because the alternatives defined by the Markush grouping do not share both a single structural similarity and a common use for the following reasons . Each alternative method embraced by the claims involves the detection of a different bacterial strain/clade characterized by a different recited target sequence/sequences, and detection using corresponding probes/primers targeting this sequence to achieve detection of the particular target bacteria. The methods are characterized by their targeting of differences among the different potential target microorganisms, not by a shared common structure, function or property. A single structural similarity and corresponding function are lacking, as is functional equivalence or a common use (rather, each method has a different use, achieving detection of a different target strain/clade of interest). Similarly, the different groupings of primers/probes targeting these different clades/strains are characterized by the different sequences/structures that allow them to function as reagents in specific detection. A single structural similarity and corresponding function are lacking, as is functional equivalence or a common use . Thus, the invention as presently claimed recites an improper Markush grouping. To overcome this rejection, Applicant may set forth each alternative (or grouping of patentably indistinct alternatives) within an improper Markush grouping in a series of independent or dependent claims and/or present convincing arguments that the group members recited in the alternative within a single claim in fact share a single structural similarity as well as a common use. Claim Rejections - 35 USC § 112(b)/second paragraph The following is a quotation of 35 U.S.C. 112(b): (b ) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the appl icant regards as his invention. Claims 3-4, 8-9, 11-16, 24, and 28 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claims 3-4 and 9 are indefinite over the recitation in independent claim 3 of the limitation “the polynucleotide probe” (see the last line of the claim), as clear antecedent basis is lacking. Claim 3 previously recites both a “polynucleotide probe” and a “SNP variant polynucleotide probe”, and it is not clear whether the subsequent reference to “the polynucleotide probe” refers to only one of these (and if so which one) or potentially to both types of “polynucleotide probe”. Clarification is therefore required to ensure that the boundaries of the claims are clear. Claims 8 and claims dependent therefrom (claims 11-13 and 28) are indefinite because it is unclear how the claims are further limiting of claim 1, from which claim 8 depends. Independent claim 1 as directed to the elected invention requires “detecting specific hybridization of the SNP variant probe…thereby detecting” CC8 Clade (i.e., the elected CC8 strain); however, dependent claim 8 as directed to the elected species requires “detect i ng specific hybridization of the reference probe….thereby detecting the absence of CC8 Clade”, i.e., the opposite result from what is required by the method of the independent claim. While one of ordinary skill could clearly envision various methods as recited in independent claim 1 in which reference probes, additional/different samples, etc., are also employed, the current wording of the claim suggests that the same nucleic acid/amplicon may product both a positive and negative result, which is confusing ; further, the language of claim 8 suggests that the claim may embrace methods not requiring all limitations of claim 1 (as methods of detecting “absence of CC8 Clade” are not embraced by the present wording of claim 1 as it is directed to the elected species) . Further clarification is therefore required. Claim 9 is indefinite because it is unclear how the claim further limits claim 3, from which it depends. First, it is reiterated that claim 3 recites more than one type of “polynucleotide probe”, such that the recitation of “The polynucleotide probe” in claim 9 is ambiguous/unclear rather than definite; it is not clear which probe or probes of claim 3 is/are being further limited. Second, this language is confusing with regard to what is being limited, specifically regarding whether claim 9 is a further limitation on the structure/sequence of a single particular “polynucleotide probe”, or whether the claim is setting forth a requirement for an additional, separate “reference polynucleotide probe” (for example, requiring a composition that includes both a “polynucleotide probe” and a “reference polynucleotide probe”). Accordingly, further clarification is required. Claims 14-16 are indefinite because it is unclear how the claims further limit claim 1, from which they depend. Claim 14 recites the “method of claim 1, wherein the amplification step comprises…”; however, claim 1 does not recite an “amplification step”, but rather only the activity of “optionally amplifying” a nucleic acid. It is not clear from the language of claim 14 whether the claim is referring to the “optionally amplifying” of claim 14, and if so, whether the language of claim 14 is intended to impart a requirement that this “optionally amplifying” is required by claim 14, or whether, e.g., the claim is meant to refer to/require an “amplification step” for which clear antecedent basis in claim 1 is lacking. Accordingly, there are a variety of possible interpretations of claim 14, and clarification is needed. Claim 16 is indefinite over the recitation in the claim (line 1) of the “method or the kit of claim 15”. As claim 15 (and the claims from which it depends) are directed to method, antecedent basis is lacking for the limitation “the kit of claim 15”, and it is unclear how/whether claim 16 actually relates to a “kit”. Claim 24 is indefinite because it is unclear how the claim further limits claim 1, from which it depends. The claim recites “further comprising the step of administering an effective amount of” one of a list of alternatives; however, it is not indicated with respect to whom/what such “administering” is to be performed (and it is noted that claim 1 recites use of a ‘biological sample”, but provides no indication as to the source of this sample, i.e., the claim does not refer to a subject, a patient, etc., such that is could be considered reasonably clear with respect to whom such an “administering” would be performed). Additionally, the limitation “the step of administering an effective amount” lacks antecedent basis in claim 1 (i.e., the claim cannot be interpreted as referring back to and further limiting a previously recited “step of administering”, as no such “step” is previously referenced). Clarification is therefore required with regard to how claim 24 further limits claim 1. Claim Rejections - 35 USC § 112(d )/fourth paragraph The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph: Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. Claim 8 and claims dependent therefrom (claims 11-13 and 28) are rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. As noted above, claim 8 is indefinite with regard to how it further limits claim 1, and the claim as presently written appears to potentially encompass methods that are broadening of claim 1 in some aspects (specifically, it appears that claim 8 does not necessarily require detection of a specific hybridization that achieves “detecting CC8 Clade”, which is a requirement of claim 1 as directed to the elected species) . Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis ( i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale , or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claim(s) 3-5 and 9 are rejected under 35 U.S.C. 102 (a)(1 ) and 35 U.S.C. 102(a)(2) as being anticipated by Reeve et al (WO9947706A1 [Sept 1999 ]; cited herein). Reeve et al teach compositions, including arrays, comprising all possible “N mer” oligonucleotides or subsets thereof “where N is preferably from 5 to 10, particularly 8 or 9” (see entire reference, particularly pages 4-5; quotation from page 5, lines 10-11). As the instant claims (see text of independent claims 3 and 5) broadly embrace probes including , e.g., “a reverse complement” (i.e., any reverse complement) of a sequence “at least 85% identical to” 13 contiguous nucleotides of elected SEQ ID NO: 35, the population of Nmers disclosed by Reeve et al includes oligonucleotides meeting the structural requirements of the claims. With further regard to claim 3 and its dependent claims (claims 4 and 9), Reeve et al teach embodiments of their invention in which their Nmers are labeled (see, e.g., page 4, lines 13-19), meeting the requirements of the embodiment of a labeled probe, and Reeve et al also teach an embodiment in which each Nmer “is immobilized at a spaced location” on a support/array, meeting the requirements of the embodiment of dependent claim 4. With further regard to dependent claim 9, the population of Nmers of Reeve et al also include Nmers meeting the structural requirements of the probes of this claim, as the claim again broadly recites, e.g., “a reverse complement” (i.e., any reverse complement) of a sequence “at least 85% identical” to a 13mer of elected SEQ ID NO: 37. With further regard to independent claim 5, Reeve et al also teach kits comprising their arrays and/or combinations of all possible N-mers (see, e.g., claim 11 of Reeve et al). Reeve et al thus anticipate claims 3-5 and 9. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim (s ) 1, 8, 10, 13-16, 21, 24, and 28 are rejected under 35 U.S.C. 103 as being unpatentable over Keller et al (WO 2017/020967 A1 [09 February 2017 ]; cited herein) in view of Reeve et al (WO 99 / 47706A1 [Sept 1999 ]; cited herein). Keller et al disclose performing whole genome sequencing of numerous S. aureus clinical isolates (see entire reference, particularly, e.g., the first paragraph on page 8). Keller et al disclose obtaining nucleic acids from biological samples (which nucleic acids may also be amplified), and sequencing those nucleic acids teaching that “any sequencing method” is appropriate for their processes ( see, e.g., pages 27-28, and Example 1 at pages 82-84 ) . Keller disclose the use in their methods of S. aureus USA300_TCH1516 (see, e.g., pages 34-37 and 51, and Example 1 at pages 82-84) , and Keller et al disclose the complete genome sequence of S. aureus USA300_TCH1516 as their SEQ ID NO: 2. Keller et al’s SEQ ID NO: 2 is disclosed as comprising the reverse complement of instant SEQ ID NO s : 34 -35 and 3 (i.e., the “variant” sequences of the elected species) , as illustrated below: Alignment of instant SEQ ID NO: 34 with SEQ ID NO: 2 of Keller et al : Query Match 100.0%; Score 35; Length 2872915; Best Local Similarity 100.0%; Matches 35; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ACTGCACCTATACCTGAACGTCAAAATTTATTTGG 35 ||||||||||||||||||||||||||||||||||| Db 853466 ACTGCACCTATACCTGAACGTCAAAATTTATTTGG 853432 Alignment of instant SEQ ID NO: 3 5 with SEQ ID NO: 2 of Keller et al : Query Match 100.0%; Score 25; Length 2872915; Best Local Similarity 100.0%; Matches 25; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ACCTATACCTGAACGTCAAAATTTA 25 ||||||||||||||||||||||||| Db 853461 ACCTATACCTGAACGTCAAAATTTA 853437 Alignment of instant SEQ ID NO: 3 with SEQ ID NO: 2 of Keller et al : Query Match 100.0%; Score 19; Length 2872915; Best Local Similarity 100.0%; Matches 19; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ACCTATACCTGAACGTCAA 19 ||||||||||||||||||| Db 853461 ACCTATACCTGAACGTCAA 853443 Keller et al’s teachings thus include methods in which specific detection of an S. aureus genome comprising 100% sequence identity to each of SEQ ID NO: 34-35 and 3 is achieved (and it is noted that SEQ ID NO: 2 is exemplary of multiple genome sequences disclosed by Keller et al that exhibit this characteristic). It is further noted that Keller et al teach that benefits of their methods include “determining” a bacterial infection, particularly an infection with a microbe resistant to antimicrobial drug treatment, as well as selected an appropriate treatment/antibiotic for a patient (see, e.g., the Abstract, page 1, and pages 8-11 ). Among the methods of sequencing taught by Keller et al as being usable in their methods is sequencing by hybridization; see page 24 bridging to page 25, particularly page 25 at lines 11-12. However, Keller et al do not actually disclose performing sequencing by hybridization, and thus do not teach a “contacting” of c) and a “detecting specific hybridization” of d) as required by independent claim 1. Reeve et al teach compositions ( including arrays ) comprising all possible “N mer” oligonucleotides or subsets thereof “where N is preferably from 5 to 10, particularly 8 or 9” (see entire reference, particularly pages 4-5; quotation from page 5, lines 10-11). Reeve et al teach that their N mers may be DNA, RNA, PNA or “mimetics or mixtures thereof” (see page 5, lines 12-13), and state that the molecules may be in solution (page 4) or "immobilised at a spaced location on a surface of a support” (page 5). Reeve et al disclose the use of their reagents in sequencing by hybridization, and particularly in determining difference between target and reference sequences (see entire reference, particularly, e.g., pages 2-3). As the instant claims (see text of independent claim 1) broadly embrace probes including, e.g., “a reverse complement” (i.e., any reverse complement) of a sequence “at least 85% identical to” 13 contiguous nucleotides of elected SEQ ID NO: 35, the population of Nmers disclosed by Reeve et al includes a subpopulation of oligonucleotides inherently meeting the structural requirements of the claims. The method disclosed by Reeve et al comprises incubating together "under hybridisation conditions" target nucleic acid obtained from a sample and an oligomer composition of Reeve et al to determine the nucleic acid sequence of a target (see pages 2-7) , encompassing both a “contacting” (as in c) of claim 1) and a “detecting specific hybridization” (as in d) of claim) sufficient to establish the entire target sequence present. The sequencing method of Reeve et al thus includes the use of oligonucleotides meeting the requirements of applicant’s claims, and the sequencing methodology of Reeve et al achieves “sequencing by hybridization” of a target sequence, i.e., an alternative embodiment taught by Keller et al as functioning in detection of their disclosed target S. aureus sequences. In view of the teachings of Reeve et al, it would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the method of Keller so as to have substituted the sequencing method of Reeve et al for that taught by Keller et al with regard to any target S. aureus sequence of interest – including target sequences meeting the requirements of the claims, as disclosed by Keller et al - and thereby to have performed a method meeting the requirements of the claims. As both the sequencing methodology of Keller et al and that of Reeve et al were sequencing methods known to those of ordinary skill in the art before Applicant’s effective filing date , an ordinary artisan would have recognized such a modification as the simple substitution of one known sequencing technique for another to achieve the predictable result of sequencing (and thereby identifying and detecting) a target sequence and organism of interest. With regard to the recitation in claim 1 of the intended use of detecting a S. aureus CC8 strain and of “detecting” specific hybridization “thereby detecting” one of a recited group of target strains, as Keller et al disclose detecting entire genome sequences, as well as, e.g., the performance of sequence analysis/comparisons to establish the identity of the strain present, antibiotic resistance, etc. (see, e.g., pages 8-21), the method suggested by Keller et al in view of Reeve et al is sufficient to achieve what is required by the claims (and it is noted that neither the preamble language of claim 1 nor the “thereby detecting” language of d) of claim 1 result in a manipulative difference between the claimed invention and what is suggested by the cited art). Furthermore, given the detailed guidance and information provided by Keller et al and Reeve et al, an ordinary artisan would have had a reasonable expectation of success in substituting the sequencing method of Reeve et al for that of Keller et al (particularly given that Keller et al suggest that sequencing by hybridization is a known/usable alternative sequencing methodology). With further regard to claim 8 and claims de pendent therefrom, the methods suggested by Keller et al in view of Reeve et al also comprise the use of oligonucleotides meeting the requirements of these claims, given Applicant’s claim language (again, embracing any “reverse complement” of a sequence “which is at least 85% identical” to a recited 13mer). (Furthermore, while not necessary to suggest what is claimed, it is also noted that Keller et al disclose multiple S. aureus target sequences sharing 100% identity with instant SEQ ID NOS 36-37, such that methods embracing sequencing of such targets is also suggested by Keller et al in view of Reeve et al, to the extent that the claims [which are indefinite] may be intended to embrace such methods). With further regard to claims 10 and 13, these claims each recite that a Clade is “detectable if” a particular sequence is present, i.e., the claims recite contingent/ conditional language rather than a further concrete limitation. “The broadest reasonable interpretation of a method (or process) claim having contingent limitations requires only those steps that must be performed and does not include steps that are not required to be performed because the condition(s) precedent are not met” ( MPEP 2111.04(II)) ; accordingly, the methods of claims 10 and 13 are suggested for the reasons given above regarding claims 1 and 8. With further regard to claim 28 (which also depends from claims 1 and 8), Reeve et al disclose embodiments of their invention in which compositions of labeled Nmers are employed (see, e.g., pages 3-4) , which is sufficient to suggest what is claimed. Regarding claims 14-16, these claims (as discussed above) are indefinite, reciting further limitations on “the amplification step”; as the claims do not clearly require any such step (and as the only “amplifying” of claim 1 is optional), the methods of these claims are also prima facie obvious for the reasons given above regarding claim 1 (and it is also noted that embodiments involving amplification are in fact taught by both Keller et al and Reeve et al). Regarding claim 21, as Keller et al disclose the culturing of microbes and the use of resulting grown colonies as elements of their methods (see, e.g., page 31 , as well as pages 83-84), the use of bacterial colonies of any preferred number as sources of bacterial nucleic acids would have been prima facie obvious to one of ordinary skill in the art before Applicant’s effective filing date . Regarding claim 24, as Keller et al disclose that one of the primary benefits of their methods is determination of antibiotic resistance (see above), it also would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have performed a step of administering an effective amount of an appropriate antibiotic to, e.g., a subject from whom a tested sample was originally provided, for the purpose of providing that subject with an antibiotic likely to successfully treat that subject. It is noted that preferred such antibiotics as are set forth in the claim are disclosed by Keller et al; see, e.g., the disclosure of linezolid, rifampicin, trimethoprim/sulfamethoxazole, and vancomycin at pages 64, 72, and 75. Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claims 3-5 and 9 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a natural phenomenon/law of nature without significantly more. Independent claim 3 (from which claims 4 and 9 depend) recites a “polynucleotide probe” or a “microarray comprising a SNP variant polynucleotide probe” correspond to portions of various alternative recited nucleotide sequences (with the elected species corresponding to fragments/RNA equivalents/reverse complements of SEQ ID NOS 34-35), “wherein the polynucleotide probe comprises a label”. It is noted that the term “label” is defined in the specification as referring to “a detectable compound or composition that is conjugated directly or indirectly to another molecule to facilitate detection of that molecule” (see page 13 of the specification); thus, the claims broadly encompass embodiments in which nucleic acids/portions thereof function as labels. Further, the microarray embodiment of claim 3 recites a microarray “comprising” a probe, which does not impart a requirement for any type of fixed/permanent attachment of a probe to the microarray. The polynucleotide and SNP variant polynucleotide probes of the claims encompass fragments of naturally occurring nucleic acids, and are thus products of nature that fall under the law of nature/natural phenomenon judicial exception. Regarding the “polynucleotide probe” that “comprises a label” embodiment, t he additional element of “comprising a label” does not impart a requirement for anything markedly different that a nucleic acid fragment/polynucleotide, given the manner in which “label” is defined in the specification, and the claim requires nothing more that might amount to a practical application or something “significantly more” than a JE (such that the claim is directed to patent ineligible subject matter). Further, the alternative embodiment of a “microarray comprising” a SNP variant polynucleotide probe is also patent ineligible, as: a) such a relationship does not render the probe markedly different from a naturally occurring nucleic acid; b) the placing of such a probe in contact with a microarray does not add a meaningful limitation as it is merely a nominal or extra-solution component of the claim, and is nothing more than an attempt to generally link the product of nature to a particular technological environment ; and c) such products as claimed – i.e., a microarray comprising a SNP probe – were clearly well-understood, routine, and conventional as of Applicant’s effective filing date. It is further noted that even if the claims were to recite fragments of naturally occurring nucleic acids that were not known in the art (which is not currently the case), such fragments are natural products, and thus do not amount to something “more” than a judicial exception. An inventive concept cannot be furnished by a judicial exception (i.e., a law of nature/natural phenomenon/abstract idea) itself (see MPEP 2106.05(I)). With further regard to dependent claim 4, as this claim is only further limiting of one embodiment of claim 4 and is also indefinite, the analysis applied above with regard to claim 3 also applies to claim 4. It is also noted that a probe may be temporarily “immobilized” on a support without being permanent fixed/attached thereto, and without requiring any permanent modification of the nucleic acid structure that might constitute a requirement for a “marked” difference. Regarding dependent claim 9, this claim is also indefinite and appears to simply require further polynucleotides corresponding to fragments of naturally occurring nucleic acids, such that the claim recites a further judicial exception (rather than something “more” than a JE); the analysis applied above to the polynucleotides of claim 3 also applies to the additional polynucleotides of claim 9. Regarding independent claim 5 , this claim is drawn to a kit comprising various possible “SNP variant polynucleotide” probes, as well as a “SNP variant forward primer” and a “SNP variant reverse primer”. Nothing in the language of the claim requires any modifications relative to naturally occurring counterpart nucleic acids that might render these claimed probes/primers markedly different from naturally occurring nucleic acid fragments. The recitation of a “kit” comprising such nucleic acids does not add a meaningful limitation as it is merely a nominal or extra-solution component of the claim, and is nothing more than an attempt to generally link the product of nature to a particular technological environment. Further, t he claim(s) does/do not include additional elements that are sufficient to amount to significantly more than the judicial exception because the packaging together into kits of reagents for use together in nucleic acid detection was clearly well-known, routine, and conventional as of the effective filing date of applicant’s invention. ( see, e.g., Mothershed et al (Clinica Chimica Acta 363:206-220 [2006 ]); Reeve et al (WO 99/47706A1 [Sept 1999 ]; cited herein) ) . Claims 3-5 and 9 are thus not directed to patent eligible subject matter. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg , 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman , 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi , 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum , 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel , 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington , 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA. A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA/25, or PTO/AIA/26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer . Claims 1, 6-8, 10,12-16 , and 21 are rejected on the ground of nonstatutory double patenting a s being unpatentable over claims 1-20 of U.S. Patent No. 11,572,591 . Although the claims at issue are not identical, they are not patentably distinct from each other for the following reasons. Initially, it is noted that the species elected for consideration herein includes SEQ ID NOS 34-37 and 1-4; however, the claims under consideration recite additional alternatives that may potentially be eligible for later rejoinder, and the ‘591 claims are directed to methods employing combinations of SEQ ID NOS that include sequences of the instant elected species. As already noted above, species including SEQ ID NOS elected herein were rejoined when the application issuing as the ‘591 patent was allowed, such that the instant rejection is not barred . Instant claim 1 and claims dependent therefrom are directed to methods of detecting an S. aureus CC8 strain in which probes/primers corresponding to SEQ ID NOS recited in the claims (and structurally related sequences) are employed, with the instant claims recited the elected species of SEQ ID NOS 34-37 and 1-4, but also additional alternative sequences (including SEQ ID NOS 58-59 and other sequences recited in the ‘591 claims). The ‘591 claims are similarly directed to methods of detecting an S. aureus CC8 strain, reciting the use of combinations of sequences including the instantly elected SEQ ID NOS 34-37. As the methods of the instant claims and those of the ‘591 patent recite analogous steps of obtaining nucleic acids, optionally amplifying the nucleic acids, contacting the nucleic acids or an amplicon with probes as set forth in the claims, and detecting specific hybridization to achieve detection, the instantly rejected claims are either anticipated by the ‘591 claims (in the cases in which SEQ ID NOS 34-37 are recited/used in probe combinations set forth in the ‘591 claims, such as in ‘591 claims 4-5 and 20), or obvious over the ‘591 claims (in view of the recitation in both sets of claims of the use of corresponding probes in analogous method steps). With further regard to dependent claim 6, while it is noted that the elected probe of SEQ ID NO: 3 is not recited in the ‘591 claim, the claim is rejected herein in the interest of compact prosecution, as other alternative probes set forth in instant claim 6 are recited as alternatives in the ‘591 cl ai ms (see, e.g., ‘591 claims 3, 11, 14, 17). Regarding claims 14-16, while the ‘591 claims do not recite the use of primers, these claims are indefinite and further limiting of an optional activity of the instant claims, such that the claims are obvious over the ‘591 cl ai ms at least for the reasons that apply to instant claim 1. Regarding claim 21, while the ‘591 cla i ms do not reference the use of bacterial colonies, as the claims are drawn to method of detection of bacteria ( S. aureus ), i.e., a type of target that is typically grown/propagated in a manner known to produce bacterial colonies, the testing of such a target sample type would have been prima facie obvious to one of ordinary skill in the art as of Applicant’s effective filing date over the ‘591 claims. Accordingly, none of claims 1, 6-8, 10,12-16, and 21 is patentably distinct from the ‘591 claims. Claims 3-5, 9, 24, and 28 are rejected on the ground of nonstatutory double patenting a s being unpatentable over claims 1-20 of U.S. Patent No. 11,572,591 in view of Mothershed et al (Clinica Chimica Acta 363:206-220 [2006 ]; cited herein). Regard ing claims 24 and 28, which are method claims dependent from independent claim 1 , it is reiterated that instant claim 1 is directed to methods of detecting an S. aureus CC8 strain in which probes/primers corresponding to SEQ ID NOS recited in the claims (and structurally related sequences) are employed, with the instant claims recited the elected species of SEQ ID NOS 34-37 and 1-4, but also additional alternative sequences (including SEQ ID NOS 58-59 and other sequences recited in the ‘591 claims). The ‘591 claims are similarly directed to methods of detecting an S. aureus CC8 strain, reciting the use of combinations of sequences including the instantly elected SEQ ID NOS 34-37. As the methods of the instant claims and those of the ‘591 patent recite analogous steps of obtaining nucleic acids, optionally amplifying the nucleic acids, contacting the nucleic acids or an amplicon with probes as set forth in the claims, and detecting specific hybridization to achieve detection, the instantly rejected claims 24 and 28 lack obviousness over the ‘591 claims alone only because claim 24 recites the further activity of “administering an effective amount” of one of the antibiotics recited in the claim , while claim 28 requires a reference polynucleotide probe that is labeled. Regarding the product claims 3-5 and 9, while probes as set forth in these claims are clearly taught and/or suggested by the ’591 claims (as discussed above), these claims lack obviousness over the ‘591 claims alone because the ‘591 claims do not recite kits containing probes/primers (as required by claim 5), and do not require either a labeled probe or a microarray comprising a probe, as required by claims 3-4 and 9. Mothershed et al provide an overview of recent advances (as of the publication date of 2006) “in nucleic acid-based methods to detect bacteria” (see entire reference, particularly the Abstract). Mothershed et al teach that “hundreds of nucleic acid-based bacterial detection tests have been published in the literature” (Abstract) and that several “PCR and hybridization tests are commercially available for specific organism detection” (Abstract); among the products disclosed by Mothershed et al are multiple types of kits for S. aureus detection (see, e.g., Table 1 and page 213, right column) . Mothershed et al teach that such assays and products have advantages including facilitating rapid and reliable specific pathogen detection with low detection limits, which may further facilitate “faster and improved patient treatment and potentially shorter hospital stays”, as well as better control of outbreaks and nosocomial infections (page 207, both columns). Among the types of PCR and hybridization based tests taught by Mothershed et al are those in which probes are labeled to facilitate detection (see page 207 right column, page 209 both columns, page 211, right column bridging to page 212 left column), and Mothershed et al also teach assays in which probes are attached to microarrays are employed (page 211, right column bridging to page 212, left column). In view of the teachings of Mothershed et al, it would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the methods of the ‘591 claims so as to have prepared and employed labeled probes (as set forth in instant claims 3 and 28), and/or microarrays having probes attached thereto (as set forth in instant claim 4), and to have packaged such materials into kits (as set forth in instant claim 5). An ordinary artisan would have been motivated to have made such modifications for the benefits of facilitating more rapid detection of S. aureus by a practitioner, as well as for the potential additional benefits of improved improvin g patient treatment and infection/outbreak control, as suggested by Mothershed et al. With further regard to claim 24, as Mothershed et al teach that a benefit of rapid bacterial detection is improved patient treatment (as discussed above) as well as detection of antibiotic resistance and subtyping (see page 207, right column), an ordinary artisan would have been further motivated to have followed testing as suggested by the ‘591 claims in view of Mothershed et with a step of administering a well-known, appropriately selected antibiotic treatment (inclusive of an antibiotic as set forth in claim 24). Accordingly, claims 3-5, 9, 24, and 28 are not patentably distinct from the ‘591 claims in view of Mothershed et al. Conclusion Any inquiry concerning this communication or earlier communications from the examiner should be directed to FILLIN "Examiner name" \* MERGEFORMAT DIANA B JOHANNSEN whose telephone number is FILLIN "Phone number" \* MERGEFORMAT (571)272-0744 . The examiner can normally be reached FILLIN "Work Schedule?" \* MERGEFORMAT Monday-Friday, 7:30 am-3:30 pm EST . Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, FILLIN "SPE Name?" \* MERGEFORMAT Wu-Cheng Winston Shen can be reached at FILLIN "SPE Phone?" \* MERGEFORMAT (571) 272-3157 . The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /DIANA B JOHANNSEN/ Primary Examiner