Prosecution Insights
Last updated: April 19, 2026
Application No. 18/166,782

LIVER-SPECIFIC DRUG DELIVERY CARRIER COMPRISING NUCLEIC ACID NANOPARTICLE AND CHOLESTEROL AND USE THEREOF

Non-Final OA §102§103§112
Filed
Feb 09, 2023
Examiner
SHEN, WU CHENG WINSTON
Art Unit
1682
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Korea Institute Of Science And Technology
OA Round
1 (Non-Final)
24%
Grant Probability
At Risk
1-2
OA Rounds
4y 3m
To Grant
50%
With Interview

Examiner Intelligence

Grants only 24% of cases
24%
Career Allow Rate
54 granted / 225 resolved
-36.0% vs TC avg
Strong +26% interview lift
Without
With
+25.9%
Interview Lift
resolved cases with interview
Typical timeline
4y 3m
Avg Prosecution
13 currently pending
Career history
238
Total Applications
across all art units

Statute-Specific Performance

§101
3.8%
-36.2% vs TC avg
§103
41.7%
+1.7% vs TC avg
§102
20.1%
-19.9% vs TC avg
§112
25.3%
-14.7% vs TC avg
Black line = Tech Center average estimate • Based on career data from 225 resolved cases

Office Action

§102 §103 §112
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Priority This application 18/166,782 filed on 02/09/2023 claims priority of foreign application KR 10-2022-0017065 field on 02/09/2022. A certified copy of foreign application KR 10-2022-0017065 field on 02/09/2022, which is not in English, has been submitted of the record by Applicants on 02/02/2024. In the absence of English translation of foreign application KR 10-2022-0017065, the priority date of claim set field on 06/26/2023 is determined to be 02/09/2023, the filing date of instant application. Should applicant desire to obtain the benefit of foreign priority under 35 U.S.C. 119(a) (d) prior to declaration of an interference, a certified English translation of the foreign application must be submitted in reply to this action. 37 CFR 41.154(b) and 41.202(e). Failure to provide a certified translation may result in no benefit being accorded for the non-English application. Restriction/Election Applicant’s election of Group I invention, claims 1-8 and 13, in the reply filed on 10/14/2025 is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)). For species election (I) regarding SEQ ID NOs recited in claim 6, Applicant elected SEQ ID NO:8. For species election (II) regarding pharmaceutical active ingredient recited in claim 12 which depends from claim 9, Applicant elected antisense oligonucleotide (ASO). Claims 1-16 are pending. Claims 9-12 and 14-16 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to nonelected inventions, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 10/14/2025. Claim 7 is withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to nonelected species, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 10/14/2025. Claims 1-6, 8 and 13 are currently under examination. It is noted that upon further consideration to facilitate compact prosecution, the species election requirement between SEQ ID NO:8 and SEQ ID NO:7 recited in instant claim 6 is withdrawn. Color Drawing Color photographs and color drawings are not accepted in utility applications unless a petition filed under 37 CFR 1.84(a)(2) is granted. Any such petition must be accompanied by the appropriate fee set forth in 37 CFR 1.17(h), one set of color drawings or color photographs, as appropriate, if submitted via the USPTO patent electronic filing system or three sets of color drawings or color photographs, as appropriate, if not submitted via the via USPTO patent electronic filing system, and, unless already present, an amendment to include the following language as the first paragraph of the brief description of the drawings section of the specification: The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. Color photographs will be accepted if the conditions for accepting color drawings and black and white photographs have been satisfied. See 37 CFR 1.84(b)(2). Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1-6, 8 and 13 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. (i) Claim 1 reads as follows: A liver-specific drug delivery carrier comprising a nucleic acid nanoparticle and cholesterol. The term “liver-specific” recited in claim 1 is a relative term which renders the claim indefinite. The term “liver-specific” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. Claims 2-6, 8 and 13 depend from claim 1. (ii) Claim 8 reads as follow: The drug delivery carrier according to claim 1, wherein the drug delivery carrier forms a protein layer by being bound to a serum protein. Claim 8 depends from claim 1, and claim 1 does not recite the presence of a serum protein. It is unclear whether the limitation “forms a protein layer by being bound to a serum protein” recited in claim 8 refers to the function of the drug delivery carrier of claim 1 or refers to an additional structural element of the drug delivery carrier of claim 1. The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph: Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. Claim 8 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Claim 1 reads as follows: A liver-specific drug delivery carrier comprising a nucleic acid nanoparticle and cholesterol. Claim 8 reads as follows: The drug delivery carrier according to claim 1, wherein the drug delivery carrier forms a protein layer by being bound to a serum protein. Claim 8 does not further limit the structure of “a nucleic acid nanoparticle and cholesterol” recited in claim 1. The limitation “being bound to a serum protein” as written is either the intended use or the property of the “drug delivery carrier comprising a nucleic acid nanoparticle and cholesterol” recited in claim 1. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. Claim Rejections - 35 USC § 102 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claim(s) 1-4, 8 and 13 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Lee et al. (2016) (Lee et al., Mono-arginine Cholesterol-based Small Lipid Nanoparticles as a Systemic siRNA Delivery Platform for Effective Cancer Therapy, Theranostics, 2016 Jan 1;6(2):192-203. doi: 10.7150/thno.13657. eCollection 2016). Claim interpretations: The preamble “A liver-specific drug delivery carrier” recited in the preamble claim 1 is directed to the intended use of claimed “delivery carrier comprising a nucleic acid nanoparticle and cholesterol”. The broadest and reasonable interpretation encompasses any drug delivery carrier that can deliver any drug to liver. Regarding claims 1, 4 and 13, Lee et al. (2016) teaches that “Although efforts have been made to develop a platform carrier for the delivery of RNAi therapeutics, systemic delivery of siRNA has shown only limited success in cancer therapy. Cationic lipid-based nanoparticles have been widely used for this purpose, but their toxicity and undesired liver uptake after systemic injection owing to their cationic surfaces have hampered further clinical translation. This study describes the development of neutral, small lipid nanoparticles (SLNPs) made of a nontoxic cationic cholesterol derivative, as a suitable carrier of systemic siRNA to treat cancers. The cationic cholesterol derivative, mono arginine-cholesterol (MA-Chol), was synthesized by directly attaching an arginine moiety to cholesterol via a cleavable ester bond. siRNA-loaded SLNPs (siRNA@SLNPs) were prepared using MA-Chol and a neutral helper lipid, dioleoyl phosphatidylethanolamine (DOPE), as major components and a small amount of PEGylated phospholipid mixed with siRNA. The resulting nanoparticles were less than ~50 nm in diameter with neutral zeta potential and much lower toxicity than typical cationic cholesterol (DC-Chol)-based lipid nanoparticles. SLNPs loaded with siRNA against kinesin spindle protein (siKSP@SLNPs) exhibited a high level of target gene knockdown in various cancer cell lines, as shown by measurement of KSP mRNA and cell death assays. Furthermore, systemic injection of siKSP@SLNPs into prostate tumor-bearing mice resulted in preferential accumulation of the delivered siRNA at the tumor site and significant inhibition of tumor growth, with little apparent toxicity, as shown by body weight measurements. These results suggest that these SLNPs may provide a systemic delivery platform for RNAi-based cancer therapy (See Abstract). Regarding the preamble “A liver-specific drug delivery carrier” recited in claim 1, Lee et al teaches in Fig. 6 “Biodistribution and in vivo antitumor activity of siKSP@SLNPs. (A) In vivo fluorescence imaging of PC-3 tumor-bearing nude mice after a single intravenous injection of 30 μg of Cy5.5-labeled free siRNA or an equivalent amount of Cy5.5-siRNA@SLNPs. (B) Ex vivo fluorescence imaging of the tumor and major vital organs (liver, heart, kidney, spleen, and lung) harvested from euthanized mice 24 h after injection (See Page 201). Regarding claim 2 and 3, Lee et al. (2016) teaches “Preparation and characterization of small lipid nanoparticles (SLNPs)” as follows: “Dioleoyl phosphatidylethanolamine (DOPE) is a neutral helper lipid that is frequently used for the preparation of cationic lipid nanoparticles, as it can destabilize the endosomal membrane upon endocytosis. Thus, DOPE was chosen as another key lipid component in preparation of SLNPs. siRNA-loaded SLNPs (siRNA@SLNPs) were prepared by a thin lipid film-rehydration method, at a MA-Chol:DOPE molar ratio of 1:1 [which reads on 1 cholesterol molecule recited in claim 3] and 2.5 mol% PEGylated 1,2-distearoyl-sn-glycero-3-phosphoethanolamine (PEG1000-DSPE) as an essential component for in vivo applications, in which MA-Chol functions as both a liposomal stabilizer and complexation agent of siRNA (Figure 1B) [which reads on the limitation “the cholesterol is linked to the nucleic acid nanoparticle recited in claim 2] . Transmission electron microscopy (TEM) showed that the size of siRNA@SLNPs was ~45 ± 8.2 nm (mean ± s.d.; n = 30 particles) (Figure 1C), with a magnified image (Figure 1C, inset) showing that these particles have a spherical morphology with an empty inner core, similar to liposomes. The hydrodynamic size of siRNA@SLNPs, as measured by dynamic light scattering (DLS), was 52 ± 2 nm, far smaller than conventional lipid nanoparticles (~100-150 nm) (Figure 1D). (See bridging paragraph, pages 196-197). PNG media_image1.png 318 984 media_image1.png Greyscale PNG media_image2.png 340 986 media_image2.png Greyscale Figure 1. Synthesis of MA-Chol and formation of a small lipid nanoparticle (SLNP). (A) Synthetic scheme for the synthesis of MA-Chol. Cholesterol was conjugated to an arginine by esterification using DMAP and DCC. After purification on a silica gel column and subsequent deprotection using TFA, pure MA-Chol was obtained. (B) Schematic illustration of a siRNA@SLNP prepared using MA-Chol:DOPE (1:1) and 2.5 mol% PEG1000-DSPE. (C) Representative TEM image of siRNA@SLNPs and a magnified image of a nanoparticle (inset). (D) DLS measurement of the hydrodynamic size of siRNA@SLNPs, showing a narrow size distribution. Regarding claim 8, claim 8 depends from claim 1, and claim 1 dees not recite the presence of a serum protein. The limitation “forms a protein layer by being bound to a serum protein” recited in claim 8 is interpreted as either the intended use or the property of the “drug delivery carrier comprising a nucleic acid nanoparticle and cholesterol” recited in claim 1, not a structural element of the drug delivery carrier of claim 1. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1-5, 8, and 13 are rejected under 35 U.S.C. 103 as being unpatentable over Lee et al. (2012) (Lee et al., Molecularly self-assembled nucleic acid nanoparticles for targeted in vivo siRNA delivery, Nat Nanotechnol., 2012 Jun 3;7(6):389-93.doi: 10.1038/nnano.2012.73) in view of Kim et al. (2020) (Kim et al., A self-assembled DNA tetrahedron as a carrier for in vivo liver-specific delivery of siRNA, Biomater Sci., 2020 Jan 21;8(2):586-590.doi: 10.1039/c9bm01769k), and Ohmann et al. (2019) (Ohmann et al. Controlling aggregation of cholesterol-modified DNA nanostructures, Nucleic Acids Res. 2019 Dec 2;47(21):11441-11451.doi: 10.1093/nar /gkz914). Regarding claims 1, 4, 5, and 13, Lee et al. (2012) teaches that “Nanoparticles are used for delivering therapeutics into cells. However, size, shape, surface chemistry and the presentation of targeting ligands on the surface of nanoparticles can affect circulation half-life and biodistribution, cell-specific internalization, excretion, toxicity and efficacy. A variety of materials have been explored for delivering small interfering RNAs (siRNAs) -- a therapeutic agent that suppresses the expression of targeted genes. However, conventional delivery nanoparticles such as liposomes and polymeric systems are heterogeneous in size, composition and surface chemistry, and this can lead to suboptimal performance, a lack of tissue specificity and potential toxicity. Here, we show that self-assembled DNA tetrahedral nanoparticles with a well-defined size can deliver siRNAs into cells and silence target genes in tumors. Monodisperse nanoparticles are prepared through the self-assembly of complementary DNA strands. Because the DNA strands are easily programmable, the size of the nanoparticles and the spatial orientation and density of cancer-targeting ligands (such as peptides and folate) on the nanoparticle surface can be controlled precisely. We show that at least three folate molecules per nanoparticle are required for optimal delivery of the siRNAs into cells and, gene silencing occurs only when the ligands are in the appropriate spatial orientation. In vivo, these nanoparticles showed a longer blood circulation time (t(1/2) ≈ 24.2 min) than the parent siRNA (t(1/2) ≈ 6 min) (See Abstract). Lee et al. (2012) further teaches that “Self-assembled three-dimensional structures of short oligonucleotides have already been explored for imaging and delivery applications. In this study we prepared oligonucleotide nanoparticles (ONPs) through programmable self-assembly of short DNA fragments and therapeutic siRNAs to develop a population of molecularly identical nanoparticles with controllable particle size and target ligand location and density. As shown in Fig. 1a, six DNA strands with complementary overhangs at the 3′ ends can self-assemble into a tetrahedron consisting of 186 Watson-Crick base pairs. The six edges are each 30 base pairs long, and the theoretical tetrahedron height is ~8 nm with edges of 10 nm. Each edge contains a nick in the middle where the 5′ and 3′ ends of an oligonucleotide meet. The overhang at this nick is complementary to the overhang of siRNA strands. Thus, six siRNAs are bound per nanoparticle (one per edge). Chemically modified siRNA with 2-OMe modifications (shown to significantly enhance serum stability as well as reduce the potential of immune stimulation) was used in our experiments. Native polyacrylamide gel electrophoresis (PAGE) analysis was performed to demonstrate the stepwise assembly of DNA tetrahedron particles as each strand was added. A distinct band shift was observed, indicating DNA assembly, and yields of > 95 and 98% were observed for tetrahedron formation and siRNA hybridization, respectively (Fig. 1b). The tetrahedron structure was imaged by atomic force microscopy (AFM) in aqueous buffer, and high-resolution images confirmed the presence of the three upper edges of an individual tetrahedron as well as a height of ~7.5 nm (Fig. 1c) (See bridging paragraph, left to right column, Page 389) PNG media_image3.png 264 810 media_image3.png Greyscale PNG media_image4.png 330 790 media_image4.png Greyscale Figure 1 | Programmable self-assembly of ONPs. a, Schematic of DNA strands for tetrahedron formation (arrow head represents 5′ end of the nucleic acid strand; each color corresponds to one of the six edges of the tetrahedron) and representation showing site-specific hybridization of siRNA to the self-assembled nanoparticles. b, Native PAGE analysis to verify self-assembly of the DNA tetrahedron and hybridization of siRNAs to the DNA core, with the presumed structures schematically drawn on the right (Lane 1, strand 1; Lane 2, strands 1 and 2; Lane 3, strands 1–3; Lane 4, strands 1–4; Lane 5, strands 1–5; Lane 6, strands 1–6; Lane 7, strands 1–6 and siRNAs; Lane L, low-molecular-weight DNA ladder (see Supplementary Information for labelling)). c, AFM image showing monodisperse tetrahedron nanoparticles on mica. Color bar indicates height in large image only. Inset: AFM image recorded in the amplitude channel with an ultrasharp tip, resolving the three upper edges of the tetrahedron. Regarding the preamble “A liver-specific drug delivery carrier” recited in claim 1, Lee et al. (2012) teaches in “Figure 3 | In vivo pharmacokinetic profile and gene silencing in tumor xenograft mouse model. a, Pharmacokinetic profile of ONPs in KB tumor-bearing mice and ex vivo fluorescence image of five major organs and tumor 12 h post-injection (T, tumor; Lv, liver; S, spleen; K, kidney; Lu, lung; H, heart). A high level of siRNA accumulation occurs in tumor tissue (See page 391). Consistent with and similar to the teachings of Lee et al. (2012), Kim et al. (2020) teaches “A self-assembled DNA tetrahedron as a carrier for in vivo liver-specific delivery of siRNA” (See Tile). Moreover, Kim et al. (2020) teaches that “While siRNA is a potent therapeutic tool that can silence disease causing mRNA, its in vivo potency can be compromised due to the lack of target tissue specificity. Here, we report a wireframe tetrahedral DNA nanostructure having a 20-mer duplex on each side that can be specifically distributed into the liver upon systemic administration. This liver-targeted DNA tetrahedron is employed as the carrier for liver-specific delivery of siRNA targeting ApoB1 mRNA, which is overexpressed in hypercholesterolemia. When delivered by a DNA tetrahedron, the siRNA can preferentially be accumulated in the liver and down-regulate the ApoB1 protein. As a result, the blood cholesterol level is also decreased by the siRNA. These results successfully demonstrate that the DNA tetrahedron is a promising carrier for liver-targeted delivery of therapeutic nucleic acids (See Abstract). Kim et al. (2020) further teaches that “In an effort to develop DNA nanostructures capable of tissue-specific delivery of nucleic acids, we attempted to use a DNA Td as a carrier for liver-specific delivery of siRNA. Previously, we and others found high accumulation of Td assembled by four DNA strands in the liver. To harness this liver-targeting property of Td for in vivo drug delivery, we employed Td with 20 base-pairs (bp) on each side (Fig. 1a, left) as a carrier for liver-specific delivery of siRNA. In addition to the liver-targeting ability, we also expected that the negatively charged surface of Td would be advantageous to avoid entrapment in the lung, which occurs with the conventional cationic lipid nanoparticle-based siRNA carriers upon agglutination (See right column, page 586, and Fig. 1). PNG media_image5.png 468 634 media_image5.png Greyscale Fig. 1 (a) Schematic presentation of Td and Td-siApoB1. (b) Native PAGE showing assembly of Td and Td-siApoB1. (c) Dynamic light scattering of Td and Td-siApoB showing their hydrodynamic sizes. (d) Atomic force microscopy images of Td (left) and Td-siApoB1 (right). The height of the three representative particles from each construct is shown (bottom). Regarding claim 8, claim 8 depends from claim 1, and claim 1 dees not recite the presence of a serum protein. The limitation “forms a protein layer by being bound to a serum protein” recited in claim 8 is interpreted as either the intended use or the property of the “drug delivery carrier comprising a nucleic acid nanoparticle and cholesterol” recited in claim 1, not a structural element of the “drug delivery carrier” of instant claim 1. This interpretation is further supported by the teachings of Ohmann et al. (2019), discussed in more details below, regarding “hydrophobic modifications, covalently linked to the DNA, are essential for targeted interfacing of DNA nanostructures with lipid membranes”, and “cholesterol-mediated aggregation allows for increased control and a closer structure– function relationship of membrane-interfacing DNA constructs –– a fundamental prerequisite for employing DNA nanodevices in research and biomedicine” (See Abstract of Ohmann et al. 2019). Regarding the limitation “by being bound to a serum protein” recited in claim 8, it is worth noting that cholesterol molecule is not only a component of membrane structure of mammalian cells but also a component of lipoproteins, including LDL (low-density lipoprotein) and HDL (high-density lipoprotein), present in mammalian serum. Lee et al. (2012) does not explicitly teach the limitation regarding the presence of cholesterol recited in claims 1-3. Regarding the limitation regarding the presence of cholesterol recited in claims 1-3, Ohmann et al. (2019) teaches that “DNA nanotechnology allows for the design of programmable DNA-built nanodevices which controllably interact with biological membranes and even mimic the function of natural membrane proteins. Hydrophobic modifications, covalently linked to the DNA, are essential for targeted interfacing of DNA nanostructures with lipid membranes. However, these hydrophobic tags typically induce undesired aggregation eliminating structural control, the primary advantage of DNA nanotechnology. Here, we study the aggregation of cholesterol-modified DNA nanostructures using a combined approach of non-denaturing polyacrylamide gel electrophoresis, dynamic light scattering, confocal microscopy and atomistic molecular dynamics simulations. We show that the aggregation of cholesterol-tagged ssDNA is sequence-dependent, while for assembled DNA constructs, the number and position of the cholesterol tags are the dominating factors. Molecular dynamics simulations of cholesterol-modified ssDNA reveal that the nucleotides wrap around the hydrophobic moiety, shielding it from the environment. Utilizing this behavior, we demonstrate experimentally that the aggregation of cholesterol-modified DNA nanostructures can be controlled by the length of ssDNA overhangs positioned adjacent to the cholesterol. Our easy-to-implement method for tuning cholesterol-mediated aggregation allows for increased control and a closer structure-function relationship of membrane-interfacing DNA constructs - a fundamental prerequisite for employing DNA nanodevices in research and biomedicine (See Abstract). PNG media_image6.png 736 1216 media_image6.png Greyscale Figure 1. Sequence-dependent aggregation of cholesterol-modified ssDNA. (A) Chemical structure of cholesterol (green ellipsoid) covalently bound to the 3’ terminal nucleotide of ssDNA via a TEG linker. Its length was determined from the chemical structure in ChemBio3D Ultra (PerkinElmer). (B) Non-denaturing 10% PAGE of chol-DNA demonstrating different aggregation behaviors of three exemplary DNA sequences (seq. a: AAAACGCTAA GCCACCTTTAGATCCAAA, seq. b: AAACTCCCGGAGTCCGCTGCTGATCAAA, seq. c: GGATCTAAAGGACTTCTATCAAAGACGGGACGACTCCGGGAG; for further details see Supplementary Table S1). Numbers refer to different production batches and L to a DNA ladder. (C) Complex size (monomer / dimer) predicted by NUPACK shows reduced multimerization accompanied by reduced aggregation in PAGE if a specific base is changed from guanine to adenine in seq. b. (D) PAGE showing no aggregation of cholesterol-modified poly-thymine (poly-T) oligonucleotides of various lengths. (E) Instantaneous snapshots of an all-atom MD simulation of cholesterol-modified 30 thymidine ssDNA (30T) at the beginning (0 _s) and end (0.5 _s) of the simulation. The ssDNA wraps around the cholesterol group throughout the simulation. Water and ions are not shown for clarity. (F) Comparison of poly-T chol-DNA containing different terminal bases. Terminal guanines induce interactions between chol-DNA strands, visible as a smear in the gel. (G) Comparison of a mixed DNA sequence (seq. d: ACTGTCGAACATTTTTTGCCATAATA) showing significantly different aggregation behaviors if the three terminal bases are changed (+ TAT or GCG or AAA). It would have been prima facia obvious for a skilled artisan to combine the teachings of Lee et al. (2012). Kim et al. (2020), and Ohmann et al. (2019) to reach claimed liver-specific drug delivery carrier comprising a nucleic acid nanoparticle and cholesterol with reasonable expectation of success because (i) Lee et al. (2012) teaches that “Nanoparticles are used for delivering therapeutics into cells. However, size, shape, surface chemistry and the presentation of targeting ligands on the surface of nanoparticles can affect circulation half-life and biodistribution, cell-specific internalization, excretion, toxicity and efficacy” (See Abstract), (ii) Kim et al. (2020) teaches “a wireframe tetrahedral DNA nanostructure having a 20-mer duplex on each side that can be specifically distributed into the liver upon systemic administration. This liver-targeted DNA tetrahedron is employed as the carrier for liver-specific delivery of siRNA targeting ApoB1 mRNA, which is overexpressed in hypercholesterolemia” (See Abstract), and (iii) Ohmann et al. (2019) teaches that “DNA nanotechnology allows for the design of programmable DNA-built nanodevices which controllably interact with biological membranes and even mimic the function of natural membrane proteins” (See Abstract). A skilled artisan would have been motivated to combine the teachings of Lee et al. (2012) and Ohmann et al. (2019) because (i) Lee et al. (2012) teaches that “conventional delivery nanoparticles such as liposomes and polymeric systems are heterogeneous in size, composition and surface chemistry, and this can lead to suboptimal performance, a lack of tissue specificity and potential toxicity” (See Abstract), (ii) Kim et al. (2020) successfully demonstrate that the DNA tetrahedron is a promising carrier for liver-targeted delivery of therapeutic nucleic acids (See Abstract), and (iii) Ohmann et al. (2019) teaches that an “easy-to-implement method for tuning cholesterol-mediated aggregation allows for increased control and a closer structure-function relationship of membrane-interfacing DNA constructs - a fundamental prerequisite for employing DNA nanodevices in research and biomedicine” (See Abstract). Claim 6 is rejected under 35 U.S.C. 103 as being unpatentable over Lee et al. (2012) (Lee et al., Molecularly self-assembled nucleic acid nanoparticles for targeted in vivo siRNA delivery, Nat Nanotechnol., 2012 Jun 3;7(6):389-93.doi: 10.1038/nnano.2012.73.) in view of Kim et al. (2020) (Kim et al., A self-assembled DNA tetrahedron as a carrier for in vivo liver-specific delivery of siRNA, Biomater Sci., 2020 Jan 21;8(2):586-590.doi: 10.1039/c9bm01769k), and Ohmann et al. (2019) (Ohmann et al. Controlling aggregation of cholesterol-modified DNA nanostructures, Nucleic Acids Res. 2019 Dec 2;47(21):11441-11451.doi: 10.1093/nar /gkz914) as applied to claims 1-5, 8 and 13 above, and further in view of Turberfield et al. (US 2009/0227774 A1, Pub. Date 09/10/2009; US Application number 12/297,762). The teachings of Lee et al. (2012), Kim et al. (2020), and Ohmann et al. (2019) have been documented in the preceding 103 rejection. The combined the teachings of Lee et al. (2012) and Ohmann et al. (2019) do not explicitly teach the limitation “any one or more oligonucleotides selected from the group consisting of nucleotide sequences of SEQ ID NOs: 1 to 8.” recited in instant claim 6. Turberfield et al. (US 2009/0227774 A1) teaches that “a nucleic acid polyhedron having a moiety associated therewith together with methods of making the nucleic acid polyhedron” (See Abstract), Turberfield et al. teaches that “A polyhedron is a three dimensional shape that is made up of a finite number of polygonal faces. A nucleic acid polyhedron is a polyhedron in which strands of a nucleic acid, such as DNA, form at least some of or part of the edges where the faces meet. The edges of the polyhedron meet at vertices. DNA polyhedra that have been produced include a cube, a truncated octahedron using a solid support strategy that relies on repeated enzymatic treatments and purification, and a regular octahedron incorporating paranemic crossovers. The single step synthesis of a DNA tetrahedron has also been described (Goodman et al Chem. Comun. 2004 12, 1372- 1373 and Goodman et al Science 2005 310, 1661-1665). (See [0003]), Turberfield et al. teaches the tedrahedron structure (See Figure 28, for example). More specifically, SEQ ID NO:7 of instant application is SEQ ID NO:17 disclosed by Turberfield et al. (US 2009/0227774) (See alignment below). SEQ ID NO:7 of instant application (1 cctcgcatgactcaactgcc..........tcttcccgacggtattggac 63). RESULT 1 US-12-297-762-17 (NOTE: this sequence has 8 duplicates in the database searched. See complete list at the end of this report) Sequence 17, US/12297762 GENERAL INFORMATION APPLICANT: Andrew Jonathan Turberfield APPLICANT: Christoph Erben APPLICANT: Russell Goodman TITLE OF INVENTION: Polyhedral Nanostructures Formed from Nucleic Acids FILE REFERENCE: 50318/026001 CURRENT APPLICATION NUMBER: US/12/297,762 CURRENT FILING DATE: 2008-10-20 PRIOR APPLICATION NUMBER: PCT/GB2007/001457 PRIOR FILING DATE: 2007-04-20 PRIOR APPLICATION NUMBER: GB 0607866.1 PRIOR FILING DATE: 2006-04-20 NUMBER OF SEQ ID NOS: 36 SEQ ID NO 17 LENGTH: 63 TYPE: DNA ORGANISM: Artificial sequence FEATURE: OTHER INFORMATION: Oligonucleotide used to make a polyhedron Query Match 100.0%; Score 63; Length 63; Best Local Similarity 100.0%; Matches 63; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 CCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCGACGGTATTG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 CCTCGCATGACTCAACTGCCTGGTGATACGAGGATGGGCATGCTCTTCCCGACGGTATTG 60 Qy 61 GAC 63 ||| Db 61 GAC 63 It would have been prima facia obvious for a skilled artisan to incorporate the teachings of Turberfield et al. (US 2009/0227774 A1) into the combined teachings of Lee et al. (2012), Kim et al. (2020) and Ohmann et al. (2019) to reach instant claim 6 with reasonable expectation of success because the teachings “Reconfigurable tetrahedra are thus ideal components for larger, multi-jointed nanostructures, and may also find applications as reconfigurable drug delivery vehicle (See [0188]) taught by Turberfield et al. (US 2009/0227774 A1) are analogous design for generating a liver-specific drug delivery carrier comprising a tetrahedral nucleic acid nanoparticle and cholesterol, taught by the combined teachings of Lee et al. (2012), Kim et al. (2020) and Ohmann et al. (2019). A skilled artisan would have been motivated to incorporate the teachings of Turberfield et al. (US 2009/0227774 A1) into the combined teachings of Lee et al. (2012), Kim et al. (2020) and Ohmann et al. (2019) because (i) Lee et al. (2012) teaches that “Native polyacrylamide gel electrophoresis (PAGE) analysis was performed to demonstrate the stepwise assembly of DNA tetrahedron particles as each strand was added. A distinct band shift was observed, indicating DNA assembly, and yields of > 95 and 98% were observed for tetrahedron formation and siRNA hybridization, respectively (Fig. 1b). The tetrahedron structure was imaged by atomic force microscopy (AFM) in aqueous buffer, and high-resolution images confirmed the presence of the three upper edges of an individual tetrahedron as well as a height of ~7.5 nm (Fig. 1c) (See bridging paragraph, left to right column, Page 389), (ii) Kim et al. (2020) successfully demonstrate that the DNA tetrahedron is a promising carrier for liver-targeted delivery of therapeutic nucleic acids (See Abstract), and (iii) Turberfield et al. (US 2009/0227774 A1) teaches that “The single step synthesis of a DNA tetrahedron has also been described (Goodman et al Chem. Comun. 2004 12, 1372-1373 and Goodman et al Science 2005 310, 1661-1665). (See [0003]), and the tedrahedron structure (See Figure 28, for example). Conclusion Any inquiry concerning this communication or earlier communications from the examiner should be directed to Wu-Cheng Winston Shen whose telephone number is (571)272-3157. The examiner can normally be reached Mon.-Fri. 8:00 AM-5:00 PM. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /WU CHENG W SHEN/Supervisory Patent Examiner, Art Unit 1682
Read full office action

Prosecution Timeline

Feb 09, 2023
Application Filed
Jan 26, 2026
Non-Final Rejection — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 11420953
CO-CRYSTAL AND/OR EUTECTIC CRYSTAL OF KOJIC ACID, COMPOSITIONS COMPRISING THE SAME, PROCESS OF PRODUCING THE SAME, AND USES THEREOF
2y 5m to grant Granted Aug 23, 2022
Patent 8501982
NOVEL GLP-1 RECEPTOR STABILIZERS AND MODULATORS
2y 5m to grant Granted Aug 06, 2013
Patent 8409836
TREATMENT OF CELLULOSIC MATERIAL AND ENZYMES USEFUL THEREIN
2y 5m to grant Granted Apr 02, 2013
Patent 8372966
OLIGONUCLEOTIDE DECOYS AND METHODS OF USE
2y 5m to grant Granted Feb 12, 2013
Patent 8357788
THYMIDINE KINASE
2y 5m to grant Granted Jan 22, 2013
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
24%
Grant Probability
50%
With Interview (+25.9%)
4y 3m
Median Time to Grant
Low
PTA Risk
Based on 225 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month