Prosecution Insights
Last updated: August 06, 2026
Application No. 18/175,394

ENGINEERED MICROALGAE FEED TO IMPROVE HONEY BEE PATHOGEN RESISTANCE AND NUTRITION

Final Rejection §103§112
Filed
Feb 27, 2023
Priority
Feb 28, 2022 — provisional 63/314,495
Examiner
MEYERING, SHABANA SHABBEER
Art Unit
1635
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
The United States of America, AS Represented By the Secretary of Agriculture
OA Round
6 (Final)
69%
Grant Probability
Favorable
7-8
OA Rounds
0m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 69% — above average
69%
Career Allowance Rate
45 granted / 65 resolved
+9.2% vs TC avg
Strong +42% interview lift
Without
With
+41.6%
Interview Lift
resolved cases with interview
Typical timeline
2y 12m
Avg Prosecution
61 currently pending
Career history
119
Total Applications
across all art units

Statute-Specific Performance

§101
7.7%
-32.3% vs TC avg
§103
34.6%
-5.4% vs TC avg
§102
10.8%
-29.2% vs TC avg
§112
32.4%
-7.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 65 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Status of the Claims This action is in response to papers filed 2nd Jun 2026 in which claim 17 was canceled no claims were added and claims 1 and 18-20 were amended. Claims 1-3,5,9-13,15, and 18-20, are under prosecution. Amendments & Response to Arguments Applicant has amended claims 1 and 18-20: to overcome the §103 rejection; the §103 rejection is not withdrawn. A new §103 rejection in view of amendments has been presented in this office action. The amendment to claim 1 has created a new lack of antecedent basis problem discussed in the new §112b rejection below Arguments applicable to newly applied rejections to amended or newly presented claims are addressed below. Arguments that are no longer relevant are not addressed. Rejections not reiterated here are withdrawn. New Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 2-3 and 9 are newly rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claims 2-3 and 9 recite the limitation "the" in the bee. There is insufficient antecedent basis for this limitation in the claim. Claim 1 has no recitation of “bee”. Maintained Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action. Claim(s) 1-3, 5, 10-13, 15 and 18 – 20 remain rejected under 35 U.S.C. 103 as being unpatentable over Sayre (WO 2012/054919 A2) in view of Paldi (US 20090118214 A1). This is a new rejection necessitated by amendment. Claim interpretation: the metes and bounds of "wherein the dsRNA comprises SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6” reasonably embraces any nucleic acid sequence that comprises the full-length of the recited sequences including any mismatches. Regarding claims 1, 5, 10-11, 15 and 18-20, Sayre teaches RNAi in gene silencing, by delivering transgenic microalgae expressing dsRNA to pathogen / pest organisms thereby protecting the host that feeds on the transgenic microalgae (e.g., abstract, [0013], [0027]). Sayre teach that the approach of using transgenic microalgae has several advantages: 1) it does not involve expression of foreign proteins, which can be an issue 2) the RNAi elements are very specific, inhibiting expression of gene(s) of interest and 3) only a small amount of dsRNA of target gene is required as a trigger to initiate production of RNAi elements like siRNAs by the evolutionarily conserved gene silencing machinery [0013]. Sayre teach, feeding transgenic microalgae is suitable for use in hosts that naturally feed on microalgae and thus presents a novel approach for protecting the host from the pathogens / pests [0017]. The pest may be a virus [00186]. The dsRNA may be directed to an essential gene of the insect [00186] which is distinct from that of the host cell (e.g., section “II. Target Genes”). Microalga suitable for the generation of transgenic microalga are for e.g.,: Spirulina platensis, .., Synechococcus sp., [00177]. Spirulina platensis, is aka Arthrospira platensis, as previously evidenced. See pertinent recitations from Sayre: [0039] In another embodiment, the present invention includes a method for selecting a nucleotide sequence for use in a silencing RNA for use in protecting host organisms that feed on microalgae from infection by parasites and pathogens, comprising the steps of; i) transforming a microalgae host cell with an expression vector comprising the nucleotide sequence, wherein the transformed microalgae produces a sense RNA strand and an antisense RNA strand from the expression vector, and wherein the sense and antisense RNA strands form an RNA duplex; ii) feeding the transformed microalgae to the host organism; iii) selecting a nucleotide sequence that protects the host organisms from the parasite or pathogen, and / or inhibits the functioning, growth, development, infectivity or reproduction of the parasite or pathogen. [0040] In one aspect of any of these claims the plant is a microalgae. Sayre do not teach wherein the host is a bee (claim 11) or dsRNA comprises SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6 (claim 1). However, before the effective filing date, Paldi disclose making and feeding honeybees, long dsRNA wherein the dsRNA targets a gene expressed by a bee pathogen and wherein the dsRNA results in knockdown or silencing of the pathogenic gene target within the bee (abstract, and [0080]). Paldi disclose that the bee pathogen is a honey bee pathogen, particularly a virus (Table 1). Paldi disclose SEQ ID NO: 24 and 33-34 as exemplary multiple bee-pathogen dsRNA (described in detail in Example IV; also shown in Fig. 13) and IAPV targeting dsRNAs respectively. Paldi’s sequence listing discloses SEQ ID NO: 24 sequence to be 614bp long. Paldi suggest that the sequence construct (SEQ ID NO: 24) can be processed (in the cell, by dsRNA processing enzymes) to RNAi effective against many bee viruses, including bee-viruses not yet identified and/or sequenced ([0205]). Such dsRNA sequence can vary in size as described further by Paldi in [0109]: PNG media_image1.png 200 400 media_image1.png Greyscale Paldi’s disclosed other dsRNA sequences (SEQ ID NOs: 33 and 34; [0097]) are ~430bp in size. Thus, we learn from Paldi that the exact length of the dsRNA is not a consideration in implementing an inhibitory RNA method via the feeding of dsRNA. Paldi also disclose the sequences of viruses used to make the multi-virus targeting dsRNA, which includes DWV (SEQ ID NO: 10, Table II) and Kashmir Bee Virus (KV) that has high homology to DWV (SEQ ID NO: 4, [0203]) amongst others. As seen by alignment, SEQ ID NO: 10 and SEQ ID NO: 14 comprise instant SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6. See alignment of Paldi’s sequences with instant: Alignment with SEQ ID NO:4: SEQ ID NO 10 LENGTH: 10140 TYPE: DNA ORGANISM: Deformed wing virus Query Match 97.8%; Score 972.4; Length 10140; Best Local Similarity 97.9%; Matches 973; Conservative 10; Mismatches 11; Indels 0; Gaps 0; Qy 1 GAAGTTTGCAAGATGCTGTATGTGGTGTGCCTGGATTAGATGGGTTTGATTCGATATCGT 60 |||||||||||||||||:|||||||||||||||| ||||||||||||||||||||||| | Db 8562 GAAGTTTGCAAGATGCTRTATGTGGTGTGCCTGGTTTAGATGGGTTTGATTCGATATCTT 8621 Qy 61 GGAATACTAGTGCTGGTTTTCCTTTGTCTCCATTAAAGCCACCTGGAACATCAGGTAAGC 120 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||:|||| Db 8622 GGAATACTAGTGCTGGTTTTCCTTTGTCTTCATTAAAGCCACCTGGAACATCAGGYAAGC 8681 Qy 121 GATGGTTGTTTGATATTGAGCTACAAGACTCGGGATGTTATCTCCTGCGTGGAATGCGTC 180 |||||||||||||:||||||||||||||:|||||||||||||||:||||||||||||||| Db 8682 GATGGTTGTTTGAYATTGAGCTACAAGAYTCGGGATGTTATCTCYTGCGTGGAATGCGTC 8741 Qy 181 CCGAACTTGAGATTCAATTATCAACGACACAGTTAATGAGGAAAAAGGGAATAAAACCTC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 8742 CCGAACTTGAGATTCAATTATCAACGACACAGTTAATGAGGAAAAAGGGAATAAAACCTC 8801 Qy 241 ACACTATATTCACGGATTGTTTGAAAGATACTTGTTTGCCTGTTGAAAAATGTAGAATAC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 8802 ACACTATATTCACGGATTGTTTGAAAGATACTTGTTTGCCTGTTGAAAAATGTAGAATAC 8861 Qy 301 CTGGTAAGACTAGAATATTTAGTATAAGTCCGGTACAGTTTACCATACCGTTTCGACAGT 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 8862 CTGGTAAGACTAGAATATTTAGTATAAGTCCGGTACAGTTTACCATACCGTTTCGACAGT 8921 Qy 361 ATTACCTAGACTTTATGGCATCCTATCGAGCTGCACGACTTAATGCTGAGCATGGTATTG 420 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 8922 ATTACTTAGACTTTATGGCATCCTATCGAGCTGCACGACTTAATGCTGAGCATGGTATTG 8981 Qy 421 GTATTGATGTTAACAGCTTAGAGTGGACAAATTTGGCAACAAGGTTGTCTAAGTATGGCA 480 ||||||||||||||||||||||||||||||||||||||||||||||||||||||:||||| Db 8982 GTATTGATGTTAACAGCTTAGAGTGGACAAATTTGGCAACAAGGTTGTCTAAGTWTGGCA 9041 Qy 481 CTCACATCGTGACAGGAGACTATAAGAATTTTGGTCCTGGGTTAGATTCCGATGTTGCAG 540 ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| Db 9042 CTCACATCGTGACAGGAGATTATAAGAATTTTGGTCCTGGGTTAGATTCCGATGTTGCAG 9101 Qy 541 CTTCAGCGTTTGAAATTATTATCGACTGGGTATTACATTACACCGAAGAAGATAATAAAG 600 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| Db 9102 CTTCAGCGTTCGAAATTATTATCGACTGGGTATTACATTACACCGAAGAAGATAATAAAG 9161 Qy 601 ACGAAATGAAGCGAGTAATGTGGACCATGGCGCAAGAGATCTTAGCGCCTAGTCATCTAT 660 |:|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 9162 AYGAAATGAAGCGAGTAATGTGGACCATGGCGCAAGAGATCTTAGCGCCTAGTCATCTAT 9221 Qy 661 ATCGCGATTTAGTGTACCGAGTACCTTGCGGAATTCCATCAGGTTCTCCAATAACGGACA 720 ||||||| :| ||||||||||||||||| ||||||||||||||||||||||||||||||| Db 9222 ATCGCGACYTGGTGTACCGAGTACCTTGTGGAATTCCATCAGGTTCTCCAATAACGGACA 9281 Qy 721 TATTGAATACAATTTCAAATTGTTTGTTAATTAGGTTAGCTTGGTTAGGTATTACTGATT 780 |||||||:|||||||||||||||||||||||||||||||||||||||||||||||||| | Db 9282 TATTGAAYACAATTTCAAATTGTTTGTTAATTAGGTTAGCTTGGTTAGGTATTACTGACT 9341 Qy 781 TGCCTTTGTCCGAGTTCTCTCAAAATGTTGTTCTTGTCTGTTATGGCGACGATCTTATCA 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 9342 TGCCTTTGTCCGAGTTCTCTCAAAATGTTGTTCTTGTCTGTTATGGCGACGATCTTATCA 9401 Qy 841 TGAATGTTAGCGATAACATGATTGATAAGTTTAACGCCGTGACGATAGGAAAATTCTTTT 900 ||||||||||:||||||||||||||||||||||| ||||||||||||||||||||||||| Db 9402 TGAATGTTAGYGATAACATGATTGATAAGTTTAATGCCGTGACGATAGGAAAATTCTTTT 9461 Qy 901 CACAATATAAGATGGAATTTACGGATCAGGATAAATCAGGAAATACTGTAAAGTGGCGGA 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 9462 CACAATATAAGATGGAATTTACGGATCAGGATAAATCAGGAAATACTGTAAAGTGGCGGA 9521 Qy 961 CGTTACAGACTGCTACTTTCTTAAAACATGGGTT 994 |||||||||||||||||||||||||||||||||| Db 9522 CGTTACAGACTGCTACTTTCTTAAAACATGGGTT 9555 Alignment with SEQ ID NO:5: SEQ ID NO 4 LENGTH: 10152 TYPE: DNA ORGANISM: Kakugo virus Query Match 95.8%; Score 479.2; Length 10152; Best Local Similarity 97.4%; Matches 487; Conservative 0; Mismatches 13; Indels 0; Gaps 0; Qy 1 CCTGAGTGTAAGAGCATTATTAAATTTATAGCGTCACATAATGAGCATATACGTGCTCAG 60 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Db 7868 CCTGAGTGTAAGAGCATTATTAAATTTATAGCGTCACATAATGAACATATACGTGCTCAG 7927 Qy 61 AATGATGGAGTGTTAGTAACTGGCGACCATACTCAGCTATTGGCTTTCGAGAATAATAAT 120 |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Db 7928 AATGATGGAGTGTTAGTAACTGGCGACCATACTCAGCTGTTGGCTTTCGAGAATAATAAT 7987 Qy 121 AAAACTCCAATAAGTATTAACGCTGATGGTTTGTATGAGGTTATACTTCAAGGAGTATAT 180 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Db 7988 AAAACTCCAATAAGTATCAACGCTGATGGTTTGTATGAGGTTATACTTCAAGGAGTATAT 8047 Qy 181 ACTTATCCATACCACGGCGATGGTGTTTGTGGTTCGATATTGTTATCTCGGAATTTACAA 240 |||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||| Db 8048 ACTTATCCATACCATGGCGATGGTGTTTGTGGTTCGATATTGTTGTCTCGGAATTTACAA 8107 Qy 241 CGGCCAATTATAGGTATCCATGTTGCTGGTACTGAGGGATTGCATGGTTTTGGAGTCGCT 300 ||||| ||||||||||||||||||||||||||||| ||||||||||| |||||||| ||| Db 8108 CGGCCGATTATAGGTATCCATGTTGCTGGTACTGAAGGATTGCATGGCTTTGGAGTTGCT 8167 Qy 301 GAACCACTTGTACATGAAATGTTCACCGGTAAAGCGATCGAGAGTGAAAGAGAGCCGTAT 360 |||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| Db 8168 GAACCACTTGTACATGAAATGTTCACTGGTAAAGCAATCGAGAGTGAAAGAGAGCCGTAT 8227 Qy 361 GATCGTGTGTATGAACTTCCGTTGCGTGAATTAGATGAATCTGATATTGGTTTAGATACC 420 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 8228 GATCGTGTGTATGAACTTCCGTTGCGTGAATTAGATGAATCTGATATTGGTTTAGATACT 8287 Qy 421 GATTTATATCCGATTGGTAGAGTGGATGCAAAGCTAGCTCATGCTCAAAGCCCTTCTACT 480 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Db 8288 GATTTATATCCAATTGGTAGAGTGGATGCAAAGCTAGCTCATGCTCAAAGCCCTTCTACT 8347 Qy 481 GGGATTAAAAAGACGCTTAT 500 |||||||||||||||||||| Db 8348 GGGATTAAAAAGACGCTTAT 8367 Alignment with SEQ ID NO:6 SEQ ID NO 10 LENGTH: 10140 TYPE: DNA ORGANISM: Deformed wing virus Query Match 97.8%; Score 978.4; Length 10140; Best Local Similarity 98.2%; Matches 982; Conservative 6; Mismatches 12; Indels 0; Gaps 0; Qy 1 ATACAGGGCTAAGACAGGTTATGCACCATATTATGCTGGAGTGTGGCATAGCTTTAATAA 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| Db 3382 ATACAGGGCTAAGACAGGTTATGCACCATATTATGCTGGAGTGTGGCATAGCTTCAATAA 3441 Qy 61 TAGTAATTCTCTTGTTTTTAGGTGGGGATCTGCTTCTGACCAAATTGCTCAGTGGCCGAC 120 ||||||||||||||||||||||||||||||||:||| ||:|||||||||||||||||||| Db 3442 TAGTAATTCTCTTGTTTTTAGGTGGGGATCTGYTTCCGAYCAAATTGCTCAGTGGCCGAC 3501 Qy 121 AATTTCAGTACCAAGAGGTGAGTTAGCTTTCTTACGAATTAAGGATGGAAAGCAAGCTGC 180 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Db 3502 AATTTCAGTACCAAGAGGTGAGCTAGCTTTCTTACGAATTAAGGATGGAAAGCAAGCTGC 3561 Qy 181 TGTAGGAACTCAACCTTGGCGTACGATGGTTGTTTGGCCTTCTGGTCACGGCTATAATAT 240 |||||||||:|||||||||||||||||||||||||||||||||||:|| || |||||||| Db 3562 TGTAGGAACYCAACCTTGGCGTACGATGGTTGTTTGGCCTTCTGGYCATGGTTATAATAT 3621 Qy 241 TGGTATACCCACGTATAATGCTGAACGAGCTCGCCAGCTTGCACAACACTTATATGGTGG 300 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Db 3622 TGGTATACCTACGTATAATGCTGAACGAGCTCGCCAGCTTGCACAACACTTATATGGTGG 3681 Qy 301 TGGATCATTAACTGATGAGAAGGCCAAACAATTATTTGTTCCTGCTAATCAACAAGGACC 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3682 TGGATCATTAACTGATGAGAAGGCCAAACAATTATTTGTTCCTGCTAATCAACAAGGACC 3741 Qy 361 TGGTAAGGTAAGTAATGGAAATCCGGTATGGGAAGTCATGCGTGCACCATTGTCAACACA 420 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| Db 3742 TGGTAAGGTAAGTAATGGAAATCCGGTATGGGAAGTCATGCGTGCACCATTGGCAACACA 3801 Qy 421 GCGTGCGCATATGCAAGATTTTGAATTTATTGAGGCTATTCCAGAAGGAGAGGAGTCTCG 480 |||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| Db 3802 GCGTGCGCATATTCAAGATTTTGAATTTATTGAAGCTATTCCAGAAGGAGAGGAGTCTCG 3861 Qy 481 TAATACTACAGTCTTGGATACGACCACTACTTTACAGTCGAGTGGGTTTGGTCGCGCCTT 540 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||:|| Db 3862 TAATACTACAGTCTTGGATACGACCACTACTTTACAGTCGAGTGGATTTGGTCGCGCYTT 3921 Qy 541 CTTTGGAGAAGCTTTTAATGATCTTAAAACGTTAATGCGGCGATATCAATTATATGGTCA 600 |||||||||||||||||||||:||||||||||||||||| |||||||||||||||||||| Db 3922 CTTTGGAGAAGCTTTTAATGAYCTTAAAACGTTAATGCGACGATATCAATTATATGGTCA 3981 Qy 601 ATTATTATTGTCCGTTACTACGGATAAGGATATTGATCATTGTATGTTTACCTTCCCTTG 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3982 ATTATTATTGTCCGTTACTACGGATAAGGATATTGATCATTGTATGTTTACCTTCCCTTG 4041 Qy 661 TTTACCACAAGGGTTAGCGTTAGACATTGGTTCTGCTGGCTCTCCACATGAAATCTTTAA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4042 TTTACCACAAGGGTTAGCGTTAGACATTGGTTCTGCTGGCTCTCCACATGAAATCTTTAA 4101 Qy 721 TAGATGTCGTGATGGTATTATACCATTAATTGCATCTGGATATAGATTTTATAGAGGAGA 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4102 TAGATGTCGTGATGGTATTATACCATTAATTGCATCTGGATATAGATTTTATAGAGGAGA 4161 Qy 781 TTTGCGTTATAAGATTGTTTTTCCAAGTAATGTTAATAGCAACATTTGGGTACAACATCG 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4162 TTTGCGTTATAAGATTGTTTTTCCAAGTAATGTTAATAGCAACATTTGGGTACAACATCG 4221 Qy 841 ACCGGATCGTAGACTGGAAGGATGGTCCGCGGCTAAGATTGTAAATTGTGATGCTGTGTC 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4222 ACCGGATCGTAGACTGGAAGGATGGTCCGCGGCTAAGATTGTAAATTGTGATGCTGTGTC 4281 Qy 901 TACTGGTCAAGGAGTGTATAATCATGGTTATGCTAGTCACATTCAAATCACGCGTGTAAA 960 |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Db 4282 TACTGGTCAAGGGGTGTATAATCATGGTTATGCTAGTCACATTCAAATCACGCGTGTAAA 4341 Qy 961 TAATGTTATAGAATTGGAAGTTCCATTTTATAATGCTACT 1000 |||||||||||||||||||||||||||||||||||||||| Db 4342 TAATGTTATAGAATTGGAAGTTCCATTTTATAATGCTACT 4381 Regarding claims 2 and 12, Paldi disclose that the bee is a honeybee [abstract]. Regarding claims 3 and 13, Paldi disclose that the honeybee is of the species Apis mellifera [0080]. Regarding claims 18-20, SEQ ID NO: 10 and 4 taught by Paldi comprise the recited sequences with at least 97% similarity. See alignment of Paldi’s sequences with instant SEQ ID NO: 4 – 6 shown above. It would have been obvious to one with ordinary skill in the art at the time of the invention to use significant portions of viral genomes taught by Paldi as dsRNAs in the transgenic microalga in the method of Sayre, for the advantage of protecting bees from a known pathogen of the bees and because, as taught by Paldi, killing viral parasites via feeding dsRNAs, will protect the bees from dying. One of skill in the art looking to target just DWV, not multiple viruses as Paldi disclose in an embodiment with SEQ ID NO: 24, or IAPV as Paldi disclose in an embodiment with SEQ ID NO: 33-34, would take the genome sequences of DWV and KV; i.e, Paldi’s SEQ ID NO: 10 and SEQ ID NO: 4, and create long dsRNA sequences from these to include in the microalgae of Sayre. The Artisan would have specifically utilized the dsRNA provided by Paldi because Paldi had provided the sequence of the polynucleotide and disclosed that similarly derived sequences of varying lengths are effective in targeting viral parasites within a bee. Moreover, the Artisan would have had a reasonable expectation of success in doing so because Sayre had already taught the use of transgenic microalga as a carrier of the dsRNA that targets a pathogen that afflicts a host, and wherein such use is a method of protecting the host from its natural pathogen, and wherein the pathogen can be a virus and Paldi had provided the sequences to do so. The substitution of a bee for the host and viruses as the pathogen, as taught by Paldi, in the method taught by Sayre, would be a simple substitution of known prior art elements by known methods and would result in a dsRNA comprising instant SEQ ID NO:s 4, 5, and 6, and would obtain predictable results by doing so. See MPEP 2144 II and 2143 I B. Thus, Sayre in view of Paldi make obvious instant claims 1-3, 5, 10-13, 15, and 18-20. Claim(s) 9 remain rejected under 35 U.S.C. 103 as being unpatentable over Sayre (WO 2012/054919 A2) in view of Paldi (US 20090118214 A1) as applied to claims 1-3, 5, 10-13, 15, and 18-20 above, and further in view of RICIGLIANO (Apidologie, Volume 51, pages 898–910, (2020)). This is a new rejection necessitated by amendment. Regarding claim 9, the prokaryotic microalga of claim 1 is taught above. Specifically, Sayre taught Spirulina platensis, is a microalga that is amenable to genetic modification to create a transgenic microalga and feeding the same to a host to protect and Paldi teach that bees are potential hosts. Neither Sayre nor Paldi teach that the microalga comprises a lipid that is an essential nutrient for the bee. RICIGLIANO teaches that Arthrospira platensis is a microalga that comprises a lipid that is an essential nutrient for the bee (abstract). Therefore, at the time of invention, it would have been obvious to use Arthrospira platensis as the microalga of choice for the advantage of providing the bee an essential lipid. The Artisan would have done so with reasonable expectation of success, as the components are utilized for art-recognized purposes. See MPEP 2144 II. Thus, Sayre and Paldi in view of RICIGLIANO make obvious instant claim 9. Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Response to Arguments Applicant's arguments filed 2nd June 2026 to claim rejections under 35 USC § 103 have been fully considered but they are not persuasive for the reasons discussed below. Briefly, Applicant’s arguments are directed to the withdrawn rejections and are therefore moot. However, to the extent the arguments could be applied to the new rejections, which are necessitated by amendment, they are addressed below. Claims 1-3, 5, 10-13, 15 and 17-20: Applicant’s argue that Sayre and Sela do not teach SEQ ID NO: 4-6 and Evans was cited as disclosing a portion of these sequences. This is persuasive. Therefore, a new reference of Paldi is applied that does teach the amended recitation of SEQ ID NO: 4-6, and teaches it in the context of a dsRNA meant to target a bee pathogenic virus via feed. Applicants argue that SEQ ID NO: 4-6 are distinct DWV-targeting dsRNA and then discuss the results obtained with them with specific reference to certain Figures in the disclosure. This is not persuasive. It is noted that claim 1 as amended has no recitations of bee or of DWV. Claim 11 is not amended and retains the recitation of “a bee”. No recitation of DWV occurs in any of the claims. Keeping the new claim interpretation in mind, a new reference of Paldi that teaches SEQ ID NO: 4-6 has been applied. Since the Patent Office does not have the facilities for examining and comparing applicants' compounds with the compounds of the prior art reference, the burden is upon applicants to show a distinction between the material structural and functional characteristics of the claimed compounds and the compounds of the prior art. See In re Best, 562 F.2d 1252, 195 USPQ 430 (CCPA 1977) and In re Fitzgerald et al., 205 USPQ 594. Absent evidence to the contrary, the sequences of Paldi are considered functional sequences that will work in a method of inducing RNAi in a bee. Further, if Applicants intent in discussing instant SEQ ID NO: 4-6 was to persuasively argue unexpected results, Applicant is reminded of the following: "To be particularly probative, evidence of unexpected results must establish that there is a difference between the results obtained and those of the closest prior art, and that the difference would not have been expected by one of ordinary skill in the art at the time of the invention." Bristol-Myers Squibb Co. v. Teva Pharm. USA, Inc., 752 F.3d 967, 977 (Fed. Cir. 2014). Claim 9: Regarding claim 9, Applicants argue, “Applicants traverse this rejection because none of Sayre, Sela and Ricigliano disclose SEQ ID NOs: 4-6 as recited in claim 9 via dependency from claim 1”. This is not persuasive. Examiner’s discussion addressing comprises SEQ ID NO:4, SEQ ID NO:5, or SEQ ID NO:6 in the section concerning Claims 1-3, 5, 10-13, 15 and 17-20 is incorporated herein. Applicants arguments are not dispositive. The §103 rejection is maintained. Conclusion No claims are allowed. Correspondence Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to SHABANA MEYERING, Ph.D. whose telephone number is (703)756-4603. The examiner can normally be reached M - F: 9am to 5pm EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571) 272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. SHABANA S. MEYERING, Ph.D. Examiner Art Unit 1635 /SHABANA S MEYERING/ Examiner, Art Unit 1635 /RAM R SHUKLA/ Supervisory Patent Examiner, Art Unit 1635
Read full office action

Prosecution Timeline

Show 9 earlier events
Sep 05, 2025
Notice of Allowance
Sep 05, 2025
Response after Non-Final Action
Oct 31, 2025
Response after Non-Final Action
Dec 05, 2025
Request for Continued Examination
Dec 10, 2025
Response after Non-Final Action
Mar 04, 2026
Non-Final Rejection mailed — §103, §112
Jun 02, 2026
Response Filed
Jun 25, 2026
Final Rejection mailed — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12686868
METHODS AND COMPOSITIONS FOR REJUVENATING CNS GLIAL POPULATIONS BY SUPPRESION OF TRANSCRIPTION FACTORS
3y 9m to grant Granted Jul 21, 2026
Patent 12680103
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
12m to grant Granted Jul 14, 2026
Patent 12644124
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
12m to grant Granted Jun 02, 2026
Patent 12605398
CRISPR-BASED METHODS AND NOVEL COMPOSITIONS FOR TREATING VASCULAR DISORDERS
4y 9m to grant Granted Apr 21, 2026
Patent 12571038
DIGITAL COUNTING OF INDIVIDUAL MOLECULES BY STOCHASTIC ATTACHMENT OF DIVERSE LABELS
1y 10m to grant Granted Mar 10, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

7-8
Expected OA Rounds
69%
Grant Probability
99%
With Interview (+41.6%)
2y 12m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 65 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month