Prosecution Insights
Last updated: April 19, 2026
Application No. 18/175,394

ENGINEERED MICROALGAE FEED TO IMPROVE HONEY BEE PATHOGEN RESISTANCE AND NUTRITION

Non-Final OA §103
Filed
Feb 27, 2023
Examiner
MEYERING, SHABANA SHABBEER
Art Unit
1635
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
The United States Of America AS Represented By The Secretary Of Agriculture
OA Round
5 (Non-Final)
70%
Grant Probability
Favorable
5-6
OA Rounds
2y 3m
To Grant
99%
With Interview

Examiner Intelligence

Grants 70% — above average
70%
Career Allow Rate
39 granted / 56 resolved
+9.6% vs TC avg
Strong +40% interview lift
Without
With
+40.5%
Interview Lift
resolved cases with interview
Typical timeline
2y 3m
Avg Prosecution
50 currently pending
Career history
106
Total Applications
across all art units

Statute-Specific Performance

§101
5.8%
-34.2% vs TC avg
§103
34.0%
-6.0% vs TC avg
§102
10.4%
-29.6% vs TC avg
§112
33.1%
-6.9% vs TC avg
Black line = Tech Center average estimate • Based on career data from 56 resolved cases

Office Action

§103
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Continued Examination Under 37 CFR 1.114 A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 12/05/2025 has been entered. Status of Claims Claims 1-3, 5, 9-13, 15, and 17-20 are under consideration. Priority Instant application has an effective filing date of 2/28/2022, which is the instant filing date of the provisional application 63314495. Oath/Declaration and Arguments The declaration has been thoroughly reviewed and entered. The declaration is persuasive; previous rejections have been withdrawn. Applicant's arguments are directed to the previous rejections of the previous claims. The declaration and amendments made to the claims have overcome these previous rejections. However, the current rejections are applicable to the current claims. Applicant's remarks have been fully considered but are moot because they do not specifically address the current rejections of the current claims. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action. Claim(s) 1-3, 5, 10-13, 15 and 17 – 20 are rejected under 35 U.S.C. 103 as being unpatentable over Sayre (WO 2012/054919 A2) in view of Sela (US 2012/0258646 A1) and Evans (US 2016/0032252 A1). Regarding claims 1, 5, 10-11, 15 and 17-20, Sayre teaches RNAi in gene silencing, by delivering transgenic microalgae expressing dsRNA to pathogen / pest organisms thereby protecting the host that feeds on the transgenic microalgae (e.g., abstract, [0013], [0027]). Sayre teach that he approach of using transgenic microalgae has several advantages: 1) it does not involve expression of foreign proteins, which can be an issue 2) the RNAi elements are very specific, inhibiting expression of gene(s) of interest and 3) only a small amount of dsRNA of target gene is required as a trigger to initiate production of RNAi elements like siRNAs by the evolutionarily conserved gene silencing machinery [0013]. Sayre further teach, feeding transgenic microalgae is suitable for use in hosts that naturally feed on microalgae and thus presents a novel approach for protecting the host from the pathogens / pests [0017]. The pest may be a virus [00186]. The dsRNA may be directed to an essential gene of the insect [00186] which is distinct from that of the host cell (e.g., section “II. Target Genes”). Microalga suitable for the generation of transgenic microalga are for e.g.,: Spirulina platensis, .., Synechococcus sp., [00177]. Spirulina platensis, is aka Arthrospira platensis, as previously evidenced. See pertinent recitations from Sayre: [0039] In another embodiment, the present invention includes a method for selecting a nucleotide sequence for use in a silencing RNA for use in protecting host organisms that feed on microalgae from infection by parasites and pathogens, comprising the steps of; i) transforming a microalgae host cell with an expression vector comprising the nucleotide sequence, wherein the transformed microalgae produces a sense RNA strand and an antisense RNA strand from the expression vector, and wherein the sense and antisense RNA strands form an RNA duplex; ii) feeding the transformed microalgae to the host organism; iii) selecting a nucleotide sequence that protects the host organisms from the parasite or pathogen, and / or inhibits the functioning, growth, development, infectivity or reproduction of the parasite or pathogen. [0040] In one aspect of any of these claims the plant is a microalgae. Sayre do not teach the virus that the dsRNA targets is Deformed Wing Virus (DWV), or wherein the host to be protected is a bee. However, before the effective filing date of instant invention, Sela had taught a method of preventing or treating bees from CCD by feeding inhibitory RNAi molecules to the bee, which in turn induces RNAi in Varroa destructor mites, which are vectors for honey bee pathogens including deformed wing virus (DWV) (abstract, [0006], Fig. 8). Sela’s example 5 shows silencing of Varroa gene expression mediated by bees that have ingested dsRNA resulting in maintaining the viability of bees. Varroa destructor mites are well known in the art as bee parasites and are vectors for a number of honey bee pathogens, including deformed wing virus (DWV) [00150]. See pertinent recitations: [0148] Thus, by killing the mites ( or preventing reproduction thereof), the agents of the present invention may be used to prevent and/or treat ….viral infections. [0228] These results clearly point to a surprising additional means for transmission, from dsRNA-fed bees to mites and back to "naive" bees, of RNAi sequences derived from the dsRNA. Such bi-directional transmission can be effective in further disseminating the silencing effect of ectoparasite (e.g. mite)-specific dsRNA fed to bees. Regarding claims 2 and 12, Sela disclose that the bee is a honeybee [0035]. Regarding claims 3 and 13, Sela disclose that the honeybee is of the species Apis mellifera [0065]. Neither Sayre nor Sela teach dsRNA that targets a DWV gene and knocks down or silences the DWV gene with a bee, as recited in claim 1. Evans teaches dsRNA inhibitors of DWV (abstract, [0008] - [0010]). Evans further teaches a method of treating or preventing in a bee or bee colony an infection with a particular strain of DWV, comprising contacting the bee or bee colony with an inhibitor of the isolated strain ([0018] - [0019], section on Inhibition of Deformed Wing Virus, [0200] – [0207]). dsRNA molecules are then generated in the bee cells (0229]. See pertinent recitations from Evans: [0008] Accordingly, the present invention provides a polynucleotide comprising (a) the sequence shown in SEQ ID NO: 1, 2, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 or 62, (b) a variant sequence having at least 98% homology to SEQ ID NO: 1, 2, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61 or 62 based on nucleotide identity over its entire length or (c) a sequence that is complementary to the sequence in (a) or (b). [0010] The invention also provides an oligonucleotide which comprises 50 or fewer consecutive nucleotides from a polynucleotide of the invention. [0016] The invention further provides a vector comprising a polynucleotide of the invention or an oligonucleotide of the invention, wherein said polynucleotide or oligonucleotide is operably linked to a promoter. [0052] SEQ ID NOs: 1 and 2 are the genomic sequences of the DWV strain of the invention. [0115] …The polynucleotide of the invention is preferably RNA. [0137] The invention also provides a polynucleotide which comprise two or more oligonucleotides of the invention. The polynucleotide may be used to generate multiple oligonucleotides of the invention within a bee cell. Typically the polynucleotide is processed by the bee cell to produce two or more oligonucleotides of the invention. The polynucleotide may be processed by the bee cell to produce two or more oligonucleotides of the invention without maintenance of the polynucleotide within the bee cell. These resultant oligonucleotides may then generate a small interfering RNA (siRNA or RNAi) effect. Regarding claims 17-20, SEQ ID NO: 1 taught by Evans comprises at least 19 nucleotides of the recited sequences. See alignment of Evans SEQ ID NO: 1 with instant SEQ ID NO: 4 - 6. Alignment with SEQ ID NO: 4: US-18-175-394-4 Query Match 9.1%; Score 918.8; DB 1; Length 994; Best Local Similarity 95.3%; Matches 947; Conservative 0; Mismatches 47; Indels 0; Gaps 0; Qy 8535 GAAGTTTGCAAGATGCTGTATGTGGTGTGCCTGGTGTAGATGGGTTTGATTCGATATCTT 8594 |||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | Db 1 GAAGTTTGCAAGATGCTGTATGTGGTGTGCCTGGATTAGATGGGTTTGATTCGATATCGT 60 Qy 8595 GGAATACTAGTGCTGGTTTTCCTTTGTCTTCATTAAAGCCACCTGGAACATCAGGTAAGC 8654 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Db 61 GGAATACTAGTGCTGGTTTTCCTTTGTCTCCATTAAAGCCACCTGGAACATCAGGTAAGC 120 Qy 8655 GATGGTTGTTTGACATTGAGCTACAAGACTCGGGATGTTATCTCTTGCGTGGAATGCGTC 8714 ||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||| Db 121 GATGGTTGTTTGATATTGAGCTACAAGACTCGGGATGTTATCTCCTGCGTGGAATGCGTC 180 Qy 8715 CCGAACTTGAGATTCAATTATCAACGACACAGTTAATGAGGAAAAAGGGAATAAAACCTC 8774 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 CCGAACTTGAGATTCAATTATCAACGACACAGTTAATGAGGAAAAAGGGAATAAAACCTC 240 Qy 8775 ACACTATATTCACGGATTGTTTGAAAGATACCTGTTTGCCTGTGGAAAAATGTAGAATAC 8834 ||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| Db 241 ACACTATATTCACGGATTGTTTGAAAGATACTTGTTTGCCTGTTGAAAAATGTAGAATAC 300 Qy 8835 CTGGTAAGACTAGAATATTTAGTATAAGTCCGGTACAGTTTACTATACCTTTTAGACAGT 8894 ||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |||||| Db 301 CTGGTAAGACTAGAATATTTAGTATAAGTCCGGTACAGTTTACCATACCGTTTCGACAGT 360 Qy 8895 ATTACTTAGATTTTATGGCATCCTATCGAGCTGCACGACTTAATGCTGAGCATGGTATTG 8954 ||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 ATTACCTAGACTTTATGGCATCCTATCGAGCTGCACGACTTAATGCTGAGCATGGTATTG 420 Qy 8955 GTATTGATGTTAACAGCTTAGAATGGACAAATTTGGCAACAAGTCTGTCAAAGTATGGCA 9014 |||||||||||||||||||||| |||||||||||||||||||| |||| |||||||||| Db 421 GTATTGATGTTAACAGCTTAGAGTGGACAAATTTGGCAACAAGGTTGTCTAAGTATGGCA 480 Qy 9015 CTCATATCGTGACGGGTGACTATAAGAATTTTGGTCCTGGGTTAGATTCCGATGTTGCAG 9074 |||| |||||||| || ||||||||||||||||||||||||||||||||||||||||||| Db 481 CTCACATCGTGACAGGAGACTATAAGAATTTTGGTCCTGGGTTAGATTCCGATGTTGCAG 540 Qy 9075 CTTCAGCGTTTGAAATTATTATCGACTGGGTATTACATTATACTGAAGAAGATAATAAAG 9134 |||||||||||||||||||||||||||||||||||||||| || |||||||||||||||| Db 541 CTTCAGCGTTTGAAATTATTATCGACTGGGTATTACATTACACCGAAGAAGATAATAAAG 600 Qy 9135 ACGAAATGAAGCGAGTAATGTGGACCATGGCGCAGGAGATTTTAGCGCCTAGTCATTTAT 9194 |||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| ||| Db 601 ACGAAATGAAGCGAGTAATGTGGACCATGGCGCAAGAGATCTTAGCGCCTAGTCATCTAT 660 Qy 9195 GTCGTGATTTAGTGTACCGAGTACCTTGTGGAATTCCATCAGGTTCTCCGATAACGGACA 9254 ||| ||||||||||||||||||||||| |||||||||||||||||||| |||||||||| Db 661 ATCGCGATTTAGTGTACCGAGTACCTTGCGGAATTCCATCAGGTTCTCCAATAACGGACA 720 Qy 9255 TTTTGAATACAATTTCGAATTGTCTGTTGATTAGGTTAGCTTGGTTAGGTATTACTGATT 9314 | |||||||||||||| |||||| |||| ||||||||||||||||||||||||||||||| Db 721 TATTGAATACAATTTCAAATTGTTTGTTAATTAGGTTAGCTTGGTTAGGTATTACTGATT 780 Qy 9315 TGCCTTTATCCGAGTTCTCTCAAAATGTTGTTCTTGTTTGTTATGGTGATGATCTTATCA 9374 ||||||| ||||||||||||||||||||||||||||| |||||||| || |||||||||| Db 781 TGCCTTTGTCCGAGTTCTCTCAAAATGTTGTTCTTGTCTGTTATGGCGACGATCTTATCA 840 Qy 9375 TGAATGTTAGTGATAACATGATTGATAAATTTAATGCTGTGACAATAGGGAAATTCTTTT 9434 |||||||||| ||||||||||||||||| ||||| || ||||| ||||| |||||||||| Db 841 TGAATGTTAGCGATAACATGATTGATAAGTTTAACGCCGTGACGATAGGAAAATTCTTTT 900 Qy 9435 CACAATATAAGATGGAATTTACGGATCAGGACAAATCAGGAAATACTGTGAAGTGGCGGA 9494 ||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||| Db 901 CACAATATAAGATGGAATTTACGGATCAGGATAAATCAGGAAATACTGTAAAGTGGCGGA 960 Qy 9495 CGTTACAGACTGCTACTTTCTTGAAGCATGGGTT 9528 |||||||||||||||||||||| || |||||||| Db 961 CGTTACAGACTGCTACTTTCTTAAAACATGGGTT 994 Alignment with SEQ ID NO: 5: US-18-175-394-5 Query Match 4.6%; Score 469.6; DB 1; Length 500; Best Local Similarity 96.2%; Matches 481; Conservative 0; Mismatches 19; Indels 0; Gaps 0; Qy 7829 CCTGAGTGTAAGAGCATTGTTAAATTTATAGCGTCACATAATGAACATATACGTGCTCAG 7888 |||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| Db 1 CCTGAGTGTAAGAGCATTATTAAATTTATAGCGTCACATAATGAGCATATACGTGCTCAG 60 Qy 7889 AATGATGGAGTGTTAGTAACTGGCGACCATACTCAGCTGTTGGCTTTCGAGAATAATAAT 7948 |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Db 61 AATGATGGAGTGTTAGTAACTGGCGACCATACTCAGCTATTGGCTTTCGAGAATAATAAT 120 Qy 7949 AAGACTCCAATAAGTATCAACGCTGATGGTTTGTATGAGGTTATACTTCAAGGAGTATAT 8008 || |||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Db 121 AAAACTCCAATAAGTATTAACGCTGATGGTTTGTATGAGGTTATACTTCAAGGAGTATAT 180 Qy 8009 ACTTATCCATACCATGGCGACGGTGTTTGTGGTTCGATATTGCTGTCTCGGGATTTACAA 8068 |||||||||||||| ||||| ||||||||||||||||||||| | |||||| |||||||| Db 181 ACTTATCCATACCACGGCGATGGTGTTTGTGGTTCGATATTGTTATCTCGGAATTTACAA 240 Qy 8069 CGGCCAATTATAGGTATCCATGTTGCTGGTACTGAAGGATTGCATGGCTTTGGAGTTGCT 8128 ||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| ||| Db 241 CGGCCAATTATAGGTATCCATGTTGCTGGTACTGAGGGATTGCATGGTTTTGGAGTCGCT 300 Qy 8129 GAACCACTGGTACATGAAATGTTCACTGGTAAAGCAATCGAGAGTGAAAGAGAGCCGTAT 8188 |||||||| ||||||||||||||||| |||||||| |||||||||||||||||||||||| Db 301 GAACCACTTGTACATGAAATGTTCACCGGTAAAGCGATCGAGAGTGAAAGAGAGCCGTAT 360 Qy 8189 GATCGTGTGTATGAACTTCCATTGCGTGAATTAGATGAATCTGATATTGGTTTAGATACC 8248 |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| Db 361 GATCGTGTGTATGAACTTCCGTTGCGTGAATTAGATGAATCTGATATTGGTTTAGATACC 420 Qy 8249 GATTTATATCCGATTGGTAGAGTGGATGCAAAGTTAGCTCATGCTCAAAGCCCTTCTACT 8308 ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Db 421 GATTTATATCCGATTGGTAGAGTGGATGCAAAGCTAGCTCATGCTCAAAGCCCTTCTACT 480 Qy 8309 GGGATCAAAAAGACGCTTAT 8328 ||||| |||||||||||||| Db 481 GGGATTAAAAAGACGCTTAT 500 Alignment with SEQ ID NO: 6: US-18-175-394-6 Query Match 7.3%; Score 743.6; DB 1; Length 1000; Best Local Similarity 84.1%; Matches 839; Conservative 0; Mismatches 159; Indels 0; Gaps 0; Qy 3356 TACCGCGCAAAGAATGGATATGCACCATATTATGCTGGTGTGTGGCATAGCTTCAATAAT 3415 ||| | || |||| || |||||||||||||||||||| |||||||||||||| |||||| Db 2 TACAGGGCTAAGACAGGTTATGCACCATATTATGCTGGAGTGTGGCATAGCTTTAATAAT 61 Qy 3416 AGTAATTCGCTTGTTTTTAGATGGGGTTCGGCTTCAGATCAAATTGCTCAATGGCCAACA 3475 |||||||| ||||||||||| ||||| || ||||| || ||||||||||| ||||| ||| Db 62 AGTAATTCTCTTGTTTTTAGGTGGGGATCTGCTTCTGACCAAATTGCTCAGTGGCCGACA 121 Qy 3476 ATAACAGTGCCTCGAGGAGAGTTGGCATTCTTGCGTATCCGCGATGCTAAGCAAGCTGCT 3535 || |||| || |||| ||||| || ||||| || || |||| |||||||||||| Db 122 ATTTCAGTACCAAGAGGTGAGTTAGCTTTCTTACGAATTAAGGATGGAAAGCAAGCTGCT 181 Qy 3536 GTAGGAACGCAACCTTGGCGTACTATGGTCGTTTGGCCTTCAGGTCATGGATATAATATT 3595 |||||||| |||||||||||||| ||||| ||||||||||| ||||| || ||||||||| Db 182 GTAGGAACTCAACCTTGGCGTACGATGGTTGTTTGGCCTTCTGGTCACGGCTATAATATT 241 Qy 3596 GGAATACCAACTTATAATGCTGAACGAGCAAGACAACTTGCTCAGCATTTGTATGGTGGT 3655 || ||||| || ||||||||||||||||| | || ||||| || || || ||||||||| Db 242 GGTATACCCACGTATAATGCTGAACGAGCTCGCCAGCTTGCACAACACTTATATGGTGGT 301 Qy 3656 GGGTCTTTGACAGATGAAAAGGCTAAGCAATTATTTGTGCCTGCTAACCAGCAAGGACCC 3715 || || || || ||||| ||||| || ||||||||||| |||||||| || |||||||| Db 302 GGATCATTAACTGATGAGAAGGCCAAACAATTATTTGTTCCTGCTAATCAACAAGGACCT 361 Qy 3716 GGCAAAGTAAGTAATGGTAACCCTGTCTGGGAAGTAATGCGCGCGCCTCTTGCAACTCAG 3775 || || ||||||||||| || || || |||||||| ||||| || || | |||| ||| Db 362 GGTAAGGTAAGTAATGGAAATCCGGTATGGGAAGTCATGCGTGCACCATTGTCAACACAG 421 Qy 3776 CAAGCGCATATACAAGATTTTGAATTTGTTGAAGCTGTTCCAGAAGGCGAAGAATCACGC 3835 | |||||||| ||||||||||||||| |||| ||| |||||||||| || || || || Db 422 CGTGCGCATATGCAAGATTTTGAATTTATTGAGGCTATTCCAGAAGGAGAGGAGTCTCGT 481 Qy 3836 AACACTACGGTGCTAGATACGACAACAACGTTACAGTCTAGCGGATTTGGTCGCGCTTTC 3895 || ||||| || | |||||||| || || |||||||| || || ||||||||||| ||| Db 482 AATACTACAGTCTTGGATACGACCACTACTTTACAGTCGAGTGGGTTTGGTCGCGCCTTC 541 Qy 3896 TTCGGTGAGGCATTTAACGATCTTAAGACGTTAATGCGCCGATACCAATTATATGGTCAA 3955 || || || || ||||| |||||||| ||||||||||| ||||| ||||||||||||||| Db 542 TTTGGAGAAGCTTTTAATGATCTTAAAACGTTAATGCGGCGATATCAATTATATGGTCAA 601 Qy 3956 TTATTGTTATCCGTTACTACGGATAAGGATATTGATCATTGTATGTTTACCTTCCCTTGT 4015 ||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||| Db 602 TTATTATTGTCCGTTACTACGGATAAGGATATTGATCATTGTATGTTTACCTTCCCTTGT 661 Qy 4016 TTACCTCAAGGGTTAGCGTTAGATATAGGTTCGGCTGGATCTCCTCATGAAATATTCAAT 4075 ||||| ||||||||||||||||| || ||||| ||||| ||||| |||||||| || ||| Db 662 TTACCACAAGGGTTAGCGTTAGACATTGGTTCTGCTGGCTCTCCACATGAAATCTTTAAT 721 Qy 4076 CGCTGCCGTGATGGTATCATTCCACTGATAGCGTCAGGGTATCGGTTTTATCGAGGCGAT 4135 | || ||||||||||| || ||| | || || || || ||| | |||||| |||| ||| Db 722 AGATGTCGTGATGGTATTATACCATTAATTGCATCTGGATATAGATTTTATAGAGGAGAT 781 Qy 4136 TTACGGTTCAAAATTGTTTTCCCAAGTAACGTTAATAGCAATATTTGGGTACAACACCGA 4195 || || | || |||||||| |||||||| ||||||||||| |||||||||||||| ||| Db 782 TTGCGTTATAAGATTGTTTTTCCAAGTAATGTTAATAGCAACATTTGGGTACAACATCGA 841 Qy 4196 CCAGATCGTAGACTGAAAGGATGGTCTGAAGCGAAAATAGTAAACTGTGATGCTGTATCT 4255 || |||||||||||| |||||||||| | || || || ||||| ||||||||||| ||| Db 842 CCGGATCGTAGACTGGAAGGATGGTCCGCGGCTAAGATTGTAAATTGTGATGCTGTGTCT 901 Qy 4256 ACTGGACAAGGCGTTTATAATCATGGATATGCTAGTCATATTCAGATTACGCGTGTAAAT 4315 ||||| ||||| || ||||||||||| ||||||||||| ||||| || |||||||||||| Db 902 ACTGGTCAAGGAGTGTATAATCATGGTTATGCTAGTCACATTCAAATCACGCGTGTAAAT 961 Qy 4316 AATGTTATAGAATTGGAAGTCCCGTTTTATAACGCTAC 4353 |||||||||||||||||||| || |||||||| ||||| Db 962 AATGTTATAGAATTGGAAGTTCCATTTTATAATGCTAC 999 Thus, Evans recitation of 50 or fewer consecutive nucleotides from a polynucleotide of the invention, for e.g., SEQ ID NO: 1 as discussed above and used in alignments, reads on at least 19 consecutive nucleotides of instant SEQ ID NO: 4 – 6. It would have been obvious to one with ordinary skill in the art at the time of the invention to use DWV gene as the target as taught by Sela for targeting dsRNAs of the transgenic microalga in the method of Sayre, for the advantage of protecting bees from a known pathogen of the bees and because, as taught by Sela, killing of Varroa, which are vectors of DWV, protected the bees from dying. The Artisan would have specifically utilized the dsRNA that targets a DWV gene and knocks down or silences the DWV gene within a bee as taught by Evans because had provided the sequence of the polynucleotide that taught that such sequence was effective in targeting a DWV gene and knocking down and silencing the DWV gene within a bee. Moreover, the Artisan would have had a reasonable expectation of success in doing so because Sayre had already taught the use of transgenic microalga as a carrier of the dsRNA that targets a pathogen that afflicts a host, and wherein such use is a method of protecting the host from its natural pathogen, and wherein the pathogen can be a virus and Evans had provided the sequences to do so. The substitution of a bee for the host and DWV as the pathogen, as taught by Sela, in the method taught by Sayre, would be a simple substitution of known prior art elements by known methods to obtain predictable results. See MPEP 2144 II and 2143 I B. Thus, Sayre in view of Sela and Evans make obvious instant claims 1-3, 5, 10-13, 15, and 17-20. Claim(s) 9 is rejected under 35 U.S.C. 103 as being unpatentable over Sayre (WO 2012/054919 A2) in view of Sela (US 2012/0258646 A1) as applied to claims 1-3, 5, 10-13, 15, and 17-20 above, and further in view of RICIGLIANO (Apidologie, Volume 51, pages 898–910, (2020)). Regarding claim 9, the prokaryotic microalga of claim 1 is taught above. Specifically, Sayre taught Spirulina platensis, is a microalga that is amenable to genetic modification to create a transgenic microalga and feeding the same to a host to protect and Sela teach that bees are potential hosts. Neither Sayre nor Sela teach that the microalga comprises a lipid that is an essential nutrient for the bee. RICIGLIANO teaches that Arthrospira platensis is a microalga that comprises a lipid that is an essential nutrient for the bee (abstract). Therefore, at the time of invention, it would have been obvious to use Arthrospira platensis as the microalga of choice for the advantage of providing the bee an essential lipid. The Artisan would have done so with reasonable expectation of success, as the components are utilized for art-recognized purposes. See MPEP 2144 II. Thus, Sayre, Sela, and Evans in view of RICIGLIANO make obvious instant claim 9. Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Citation of Pertinent Prior Art The prior art made of record and not relied upon is considered pertinent to applicant's disclosure. The following prior art essentially teach the same invention as the art used above: Chen (US 20210032625) disclose strategies to control insect disease vector populations, utilizing RNAi gene targeting via transgenic microalgae as vectors (title). One strategy comprises making and using transgenic microalga comprising at least one heterologous RNAi molecule that targets and silences the expression of a polynucleotide present within any xenogeneic organism comprising the administration of an edible dry form of a transgenic microalga, which RNAi silences the expression of the polynucleotide present within the xenogeneic organism upon consumption of the microalga by the xenogeneic organism. The transgenic microalga comprising at least one heterologous RNAi molecule, wherein the RNAi molecule is targeted to a polynucleotide present within a xenogeneic organism and wherein said RNAi molecule silences the expression of the polynucleotide present within the xenogeneic organism when the microalga is consumed by said xenogeneic organism or by a host of said xenogeneic organism (claim 1), wherein the host is selected from the group consisting of a fish, a crustacean, a domestic farm animal and a pet and wherein the organism is a pathogen of said host (claim 19). See pertinent recitations: [0045] According to other embodiments, the polynucleotide present within the xenogeneic organism is heterologous gene to said organism. According to certain exemplary embodiments, the heterologous polynucleotide is of a virus infecting the xenogeneic organism and the RNAi molecule is targeted to silence a viral gene. [0038] According to certain embodiments, the xenogeneic organism is a pest. [0084] ..the organism is a pathogen which invades into a host organism and survives within its cell. Chen disclose that the RNAi molecules remain intact after consumption of the algae by insects because the microalgal cell serves as a natural encapsulation material together with the relatively stable structure of the dsRNA to protect the RNAi molecule from being degraded within the digestive system of organism [0085]. Chen describes this approach to be an effective strategy due to its pathogen specificity, safety, ease of production, stability, long shelf-life etc. (abstract, [0083], [0021], [0018], [0086 - 0087]). Whyard et al (US 20170260528 A1) disclose a method comprising feeding to an arthropod, transgenic organisms expressing dsRNA to induce RNAi in a pathogen of the arthropod [0020, 0029, 0164]. The transgenic organism can be algae. Whyard’s method of protection of insect colonies such as bees includes feeding insects with compositions of dsRNAs targeting RNA of parasites such as viruses that naturally infect the arthropod [0029], which are important for such parasite survival (see paragraph [0045]). Whyard et al disclose that compositions for feeding bees can be provided in solid or liquid form (see paragraphs [0141-0142]). Whyard et al disclose that dsRNAs can be provided in a recombinant vector containing a promoter (see paragraphs [0149-0151]). Whyard does not teach the transgenic organism can be a prokaryotic microalgae. Conclusion No claims are allowed. Correspondence Any inquiry concerning this communication or earlier communications from the examiner should be directed to SHABANA MEYERING, Ph.D. whose telephone number is (703)756-4603. The examiner can normally be reached M - F: 9am to 5pm EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571) 272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. SHABANA S. MEYERING, Ph.D. Examiner Art Unit 1635 /SHABANA S MEYERING/ Examiner, Art Unit 1635 /CATHERINE KONOPKA/ Primary Examiner, Art Unit 1635
Read full office action

Prosecution Timeline

Feb 27, 2023
Application Filed
Feb 23, 2024
Non-Final Rejection — §103
May 29, 2024
Response Filed
Aug 15, 2024
Final Rejection — §103
Nov 20, 2024
Request for Continued Examination
Nov 22, 2024
Response after Non-Final Action
Dec 19, 2024
Non-Final Rejection — §103
Mar 28, 2025
Response Filed
May 30, 2025
Final Rejection — §103
Sep 05, 2025
Notice of Allowance
Sep 05, 2025
Response after Non-Final Action
Oct 31, 2025
Response after Non-Final Action
Dec 05, 2025
Request for Continued Examination
Dec 10, 2025
Response after Non-Final Action
Mar 01, 2026
Non-Final Rejection — §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12571038
DIGITAL COUNTING OF INDIVIDUAL MOLECULES BY STOCHASTIC ATTACHMENT OF DIVERSE LABELS
2y 5m to grant Granted Mar 10, 2026
Patent 12570979
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Mar 10, 2026
Patent 12565651
OLIGONUCLEOTIDES COMPRISING SEGMENTED GAP STRUCTURES
2y 5m to grant Granted Mar 03, 2026
Patent 12565657
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Mar 03, 2026
Patent 12565655
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Mar 03, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

5-6
Expected OA Rounds
70%
Grant Probability
99%
With Interview (+40.5%)
2y 3m
Median Time to Grant
High
PTA Risk
Based on 56 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month