DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on May 1st, 2026 has been entered.
Claims 1 and 20 are amended, and claims 2 and 14-16 are canceled. Claims 1, 5-9, 13, 18-24, 27-29, 34-39, 59, and 62-64 remain pending and are examined herein.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1, 5-9, 13, 18-24, 27-29, 34-39, 59, and 62-64 are newly rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention.
The amended claims require the applicator position to no more than 4 cm below, and no more than 10 cm above the average height; and wherein at least 98% of the corn plant are not damaged. The claims also require the corn plants to be at R1 stage or later. The claims define the average height as “measured as the distance between the soil and the ligule of the uppermost fully-expanded leaf”.
However, at R1 stage or later, corn plants have developed tassels (see below).
PNG
media_image1.png
329
600
media_image1.png
Greyscale
Average tassel length is 20-40 centimeters. See for example, CV995128 (US 8,319,066 B2) has a tassel length of 31 cm; and CV760185 40 cm (US8581076B2).
Thus, setting applicator height at no more than 10 cm above the height of the collar of the uppermost fully expanded leaf would be at least 10 or 30 cm below the tip of tassel.
It is not predictable that setting applicator height at30 cm below the tip of tassel would result in “at least 98% of the corn plant are not damaged.”
Therefore, the claims are not enabled.
Claim Rejections - 35 USC § 103
The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action.
Due to Applicant’s amendment of the claims, the rejections below are modified from the rejections as set forth in the Office action mailed February 2nd, 2026. Applicant’s arguments filed on May 1st, 2026 have been fully considered but they are not deemed persuasive. See response to Applicant’s argument at the end of the rejections.
Claims 1, 9, 13, 18-24, 27, 35-37, 39, 59 and 62-64 remain rejected under 35 U.S.C. 103 as being unpatentable over Barten (PCT Patent Application No. PCT/US2016/029492, the corresponding WIPO publication WO2016176286A1, published November 2016, is cited herein), in view Aguiar (WO2018129302A1, published in July 12, 2018, with US priority filing date of January 6, 2017), with evidence from Barten-2018 (WO2018119225A1, with US priority filing date of December 22, 2016).
Claim 1 is amended to recite a method of applying an agricultural composition to a plurality of corn plants in a corn field from above using a ground-based agricultural vehicle comprising an applicator,
wherein the corn plants comprise a mutation in a Br2 locus as compared to a wildtype Br2 locus and the mutation in the Br2 locus comprises the nucleotide sequence of SEQ ID NO:114 or SEQ ID NO:119,
wherein the corn plants comprise an average height of 0.7-1.1 meters at the V10 to V12 stage or 1.1-1.6 m at the V13 to R1 stage or later,
wherein said average height is measured as the distance between the soil and the ligule of the uppermost fully-expanded leaf,
wherein the applicator is positioned so that the lower surface of said applicator is not more than 4 centimeters below the average height of said plurality of corn plants and not more than 10 centimeters above the average height of said plurality of corn plants, and
wherein at least 98% of corn plants of said plurality of corn plants are not damaged by said applying.
Claim 1 is amended to recite the limitation of the plant height being an average of between 1.1 meters and 1.6 meters are at the R1 stage or later; and the applicator position to no more than 4 (from the previously 5) cm below, and no more than 10 cm above the average height; and wherein at least 98% (amended from the previous 95%) of the corn plant are not damaged.
It should be noted that “Corn plants generally develop up to the V18 stage before reaching maximum height at tassel emergence (VT) and transitioning into the reproductive (R) stages of growth.” (“Determining Corn Growth Stages”, retrieved from https://www.cropscience.bayer.us/articles/bayer/corn-growth-stages-and-gdu-requirements). Thus, the plant height at R1 stage is considered, by practitioners of the art, as the “mature height” or maximum height.
It should also be noted that claim 1 is amended to introduce a definition of plant height as “measured as the distance between the soil and the ligule of the uppermost fully-expanded leaf” which differs from the previously claimed “height is measured as the distance between the soil and the uppermost leaf surface of the leaf farthest from the soil” (Claim 2, previously presented). It should be noted that Applicant has not provided any comparison of the plant height measured with the two different methods, and with the other conventional methods employed by skilled artisans. For example, Applicant (Monsanto Technology LLC) has filed numerous patents in which the corn plant heights are defined as from soil to the tip of tassel (see e.g., US8319066B2). Since the plant heights measured as currently claimed (to the ligule of the uppermost fully-expanded leaf) would be substantially different from the measurement to the tip of tassel, the claimed plant height is interpreted based on the best estimate to compare with the prior art.
Applicant is reminded that simply employing a different measurement that the conventional measurement in the art and then insist that no prior art has actually recited the exact numbers, is a futile attempt to distinguish from the prior art.
Regarding claim 1, Barten teaches semi-dwarf corn plants comprising a recessive brachytic allele which comprises SEQ ID NO: 7 having a thymidine (T) at position 72 (the “T allele”, Example 3, [0092], and Claim 1,); and introgressed hybrid corn plants. Such introgressed hybrid corn plants are interpreted to be desirable for commercial planting in a field.
Barten, as Applicant indicated, teaches the br-2 alleles comprising the instant SEQ ID NO: 114 or 119 (referred to as SEQ ID NO: 92 or 95, respectively, in Example 8). Barten teaches breeding these br2 alleles and the brachytic traits into corn varieties (p. 40, Embodiments 1 and 8, e.g.) Therefore, Barten teaches, as Applicant admitted in the working example of the instant Application, hybrid corn plants comprising a corn field of corn plants that comprise a mutation in a br2 locus as compared to a wildtype br2 locus.
Barten teaches the height of said selected plant at maturity is reduced for about 10%, 20%, 30%, 40%, 50%, 60%, or 70% compared to a control plant not having said brachytic allele.
Barten teaches, in the context of BR2 experiment, in Table 1 (“Reference lines and the BR2P vl panel used for targeted sequencing of the Br2 (PGPl) genomic region”) a number of “reference lines”, such as CV995128, and CV760185. While Barten is silent regarding the plant height of these lines, Applicant has provided the plant height for corn variety CV995128 in US8319066B2 which is 196 cm (Table 1), and CV760185 in US8581076B2 having a plant height of 179cm. Applicant has also disclosed the tassel length of CV995128, and CV760185 as 30.9 and 39.7 cm, respectively. Since the “average height of the plant as measured from the soil to the tip of the tassel” in both US8319066B2 and US8581076B2, the converted height to the instant measurement method would be 196 minus 30.9 or 179 minus 39.7 cm, since the entire tassel is above the uppermost collar.
As such, at least one of the reference plants used in Barten is 179-39.7 = 140 cm at “R1 stage or later”, as “measured as the distance between the soil and the ligule of the uppermost fully-expanded leaf”, or 165 cm for another reference line.
Thus, even with br2 allele conferring a 10%, height reduction, Barten’s reference lines with the br2 allele would have a height (as defined in the instant claims) of, 126 or 148 cm, at “R1 stage or later”, which is well within the claimed range of 1.1-1.6 meter.
Therefore, Barten teaches: the same br2 mutant alleles as the instant claimed, AND the same plant height as the instantly claimed. Therefore, a prima facie obviousness stands.
Barten teaches corn plants disclosed therein can be grown as small grains with narrower rows of about 0.25m apart with a planting density of up to 200,000 plants per hectare (i.e., a field), corn plants disclosed therein provide excellent group structure, sufficient exposure to sunlight and high grain yield (i.e., suitable for planting in a commercial field).
Barten does not teach a ground- based agricultural vehicle and methods of applying agricultural compositions to such a corn field without damaging more than 2% of the crops, which is utterly obviously and taught in numerous prior arts.
For example, Aguiar (as cited in the instant Specification [0149]) taught a method and device for pollinating crop plants grown in rows, the device comprising:
a base mountable on a carriage for traveling along the rows of crop plants;
at least one pollination unit mounted on the base for delivering pollen from the crop plants, each pollination unit comprising: a pollen-releasing apparatus configured to contact male flowers of the crop plants and at least one nozzle adjacent the pollen-releasing apparatus such that the discharged air delivers at least some of the released pollen to the pollen-receiving rows of crop plants. (Claim 1)
Here, the “released pollen” with air reads on a “solid” (claim 35) “agricultural composition” or “gaseous” (claim 36) and “spraying” (claim 37)
Since the plants are being pollinated, they would be at R1 stage or later, which is also encompassed by V12 or later (the limitation in claims 1, 11, 12, etc).
As discussed above, Aguiar teaches the position of the lower surface of the machine as required in the claims.
Regarding claim 13, Aguiar teaches detasseling ([002]).
With regard to damage, and the amendment to claims reciting “wherein the lower surface of said applicator is positioned no less than 5 centimeters lower than the average height of said corn plants of said corn field and equal to or less than 10 centimeters higher than the average height of said corn plants of said corn field”, it should be noted that since Aguiar teaches a machine that is capable of not damaging normal corn plants at flowering stage—which is taller than the dwarf maize plants at V12 stage, such a machine naturally would not damage the shorter corn plants of Barten (br2 semi-dwarf). Furthermore, as discussed above, Aguiar teaches pollination unit mounted on the base for delivering pollen from the crop plants, each pollination unit comprising a pollen-releasing apparatus configured to contact male flowers of the crop plants; and that (at para. [0044]) when the plants are ready for pollination, an operator installs the pollination device on the tractor and arranges the pollination units for pollinating the plants. The operator may, for example, measure or visually inspect the heights of the pollen bearing plants and adjust the height of the swing arm so that the pollen displacement chains are arranged for contacting the tassels. In addition, the operator may measure or visually inspect the heights of the pollen-receiving plants …… and adjust the positions of the air nozzles …… to optimally distribute the displaced pollen to the pollen-receiving plants. Alternatively, the heights of the pollination units may be automatically adjusted through use of the sensors, controller,……
Therefore, Aguiar teaches the contacting of the top of the corn plants with a lower surface of the machinery without damaging the plants, essentially teaching the distance between the lower surface of the machine to the top of the plants as zero, therefore well within the amendment range.
Therefore, it would have been prima facie obvious and within the scope of a person having ordinary skill in the art to have used any conventionally available ground-based agricultural vehicle such as those taught by Aguiar, for applying an agricultural composition to any corn field having corn plants at any stages of any height, such as the plants exemplified in Barten having a plant height of equal or less than 2.2m at V12 stages due to the br2 mutant allele. The PHOSITA would have had reasonable to do so since it is a conventional and routine practice to apply agricultural compositions to corn field at any growth stages as needed. The PHOSITA would have had reasonable expectation of success in practicing the claimed method.
Therefore, the claimed invention is prima facie obvious over the combined teachings of the prior art.
Alignment of the instant SEQ ID NO: 114 and Barten SEQ ID NO: 92, showing complete identity.
US-15-139-733A-92
(NOTE: this sequence has 10 duplicates in the database searched.
See complete list at the end of this report)
Sequence 92, US/15139733A
Publication No. US20160319375A1
GENERAL INFORMATION
APPLICANT: Monsanto Technology LLC
TITLE OF INVENTION: METHODS AND COMPOSITIONS FOR PRODUCING BRACHYTIC CORN PLANTS
FILE REFERENCE: P34302US02/0016517.00552
CURRENT APPLICATION NUMBER: US/15/139,733A
CURRENT FILING DATE: 2016-04-27
PRIOR APPLICATION NUMBER: US 62/153,831
PRIOR FILING DATE: 2015-04-28
PRIOR APPLICATION NUMBER: US 62/180,430
PRIOR FILING DATE: 2015-06-16
NUMBER OF SEQ ID NOS: 120
SEQ ID NO 92
LENGTH: 181
TYPE: DNA
ORGANISM: Zea mays
FEATURE:
NAME/KEY: misc_feature
LOCATION: (63)..(111)
OTHER INFORMATION: n is a, c, g, t, delection, or insertion
Query Match 100.0%; Score 132; Length 181;
Best Local Similarity 100.0%;
Matches 181; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TCGGTGCTGGCTCTGGTGCAGCGGTTCTACGAGCCCACGTCCGGGCGCGTGCTCCTGGAC 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 TCGGTGCTGGCTCTGGTGCAGCGGTTCTACGAGCCCACGTCCGGGCGCGTGCTCCTGGAC 60
Qy 61 GGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGGACGT 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 61 GGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGGACGT 120
Qy 121 GCGCAAGTACAACCTGCGGGCGCTGCGGCGCGTGGTGGCGGTGGTACCGCAGGAGCCGTT 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 121 GCGCAAGTACAACCTGCGGGCGCTGCGGCGCGTGGTGGCGGTGGTACCGCAGGAGCCGTT 180
Qy 181 C 181
|
Db 181 C 181
Alignment of the instant SEQ ID NO: 119 and Barten SEQ ID NO: 97, showing complete identity.
US-15-139-733A-97
(NOTE: this sequence has 10 duplicates in the database searched.
See complete list at the end of this report)
Sequence 97, US/15139733A
Publication No. US20160319375A1
GENERAL INFORMATION
APPLICANT: Monsanto Technology LLC
TITLE OF INVENTION: METHODS AND COMPOSITIONS FOR PRODUCING BRACHYTIC CORN PLANTS
FILE REFERENCE: P34302US02/0016517.00552
CURRENT APPLICATION NUMBER: US/15/139,733A
CURRENT FILING DATE: 2016-04-27
PRIOR APPLICATION NUMBER: US 62/153,831
PRIOR FILING DATE: 2015-04-28
PRIOR APPLICATION NUMBER: US 62/180,430
PRIOR FILING DATE: 2015-06-16
NUMBER OF SEQ ID NOS: 120
SEQ ID NO 97
LENGTH: 141
TYPE: DNA
ORGANISM: Zea mays
FEATURE:
NAME/KEY: misc_feature
LOCATION: (71)..(71)
OTHER INFORMATION: n is a, c, g, t, delection, or insertion
Query Match 100.0%; Score 140; Length 141;
Best Local Similarity 100.0%;
Matches 141; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TTAGCGCATTAATCTGAGGATGTCCAGTTCGCTTGCTTGCCAATCGCCATTGCCATCGCA 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 TTAGCGCATTAATCTGAGGATGTCCAGTTCGCTTGCTTGCCAATCGCCATTGCCATCGCA 60
Qy 61 ACAACAATACNTCGCCAACTGCCATTGCTGGGTAGACTAGTACAGTAGCAGTTAGAAGAA 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 61 ACAACAATACNTCGCCAACTGCCATTGCTGGGTAGACTAGTACAGTAGCAGTTAGAAGAA 120
Qy 121 GCCTCCACTGTACATTGCATT 141
|||||||||||||||||||||
Db 121 GCCTCCACTGTACATTGCATT 141
Claim 8 remains rejected under 35 U.S.C. 103 as being unpatentable over Barten (PCT Patent Application No. PCT/US2016/029492, the corresponding WIPO publication WO2016176286A1, published November 2016, is cited herein), in view Aguiar (WO2018129302A1, published in July 12, 2018, with US priority filing date of January 6, 2017) as applied to claims 1 and 52 as discussed above, and further in view of Choulet (US20080264312A1).
8 is drawn to the method wherein the composition is cover crop seed.
Choulet teaches an agricultural machine apt for crop interseeding, of the type that is self-propelled, comprising a unit with a drawing drive unit and a draw unit, both operatively linked to each other. The drawing drive unit comprises a land vehicle including an elevated chassis disposed at a substantial height for passing over tall mature crops such as corn (Abstract), and the methods of applying.
Therefore, it would have been prima facie obvious and within the scope of a person having ordinary skill in the art to have used any conventionally available ground-based agricultural vehicle such as those taught by Aguiar and/or Choulet, for applying an agricultural composition such as interseeding cover crop seeds to any corn field having corn plants at any stages of any height, such as the plants exemplified in Barten having a plant height of equal or less than 2.2m at V12 stages due to the br2 mutant allele. The PHOSITA would have had reasonable to do so since it is a conventional and routine practice to apply agricultural compositions to corn field at any growth stages as needed. The PHOSITA would have had reasonable expectation of success in practicing the claimed method.
Therefore, the claimed invention is prima facie obvious over the combined teachings of the prior art.
Claims 1, 5-7, 9, 18-24, 27, 34-37, 39, 59, and 62-64, remain rejected under 35 U.S.C. 103 as being unpatentable over Barten (PCT Patent Application No. PCT/US2016/029492, the corresponding WIPO publication WO2016176286A1, published November 2016, is cited herein) as discussed above, in view of “R4038 Sprayer” by John Deere (“R4038” hereinafter).
Claims 5-7, and 34 are drawn to the method wherein the composition is a liquid, such as a herbicide, etc;
“R4038” teaches the agricultural sprayer comprising a boom with automatically adjustable ground height any distance of 05.-2.45 meters above the soil level (see above) and Wheel tread spacing 305 to 406 cm (120 to 160 inch). a nozzle (above); and the compositions could be sprayed as (agro)chemicals.
As evidenced from this internet capture, R4038 has been on sale to the public prior to 2017:
Additionally, the instant application states (para. [0220]) that “the John Deere R4038” is an “exemplary ground-based agricultural vehicles”.
PNG
media_image2.png
987
1027
media_image2.png
Greyscale
It would have been prima facie obvious and within the scope of a person having ordinary skill in the art to have used any conventionally available ground-based agricultural vehicle comprising an applicator such as those provided by Deere, for applying an agricultural composition to any corn field having corn plants at any stages of any height, such as the plants exemplified in Barten as discussed above. Such a method would have been routine, conventional, and obvious, since the machines of Deere—as well as many similar products commercially available-- have applicators at adjustable height from 0.5 to 2.45 meters. The PHOSITA would have had reasonable to do so since it is a conventional and routine practice to apply agricultural compositions to corn field at any growth stages as needed. The PHOSITA would have had reasonable expectation of success in practicing the claimed method, such as avoiding damaging more than 20% or 10% of his valuable crop, given the fact that the boom could have been adjusted to any height with sufficient clearance over the crop. Since a PHOSITA would reasonably expect that R4038 does not significantly damage his crop of conventional corn plants, any PHOSITA would not reasonably expect the R4038 machine to damage the dwarf or semi-dwarf corn plants of the prior art.
Therefore, the claimed invention is prima facie obvious over the combined teachings of the prior art.
Response to Applicant’s Remarks:
To the extent that Applicant’s arguments have been raised previous and responded previous, those are not repeated here. Only new arguments pertinent to the amended claims are discussed below.
Applicant argued that the prior art does not teach the recited height ranges at the specified growth stages.
This issue has been addressed in the revised rejection above.
Briefly, as discussed above, Barten has taught reference plants, and Applicant has provided in previously filed patents the plant height of the reference plant lines. Thus, it is not “assumed by the Examiner” regarding the relative wild type control plant height. As Applicant admitted, the instantly recited br2 alleles (SEQ ID NO: 114/119) are the ones taught by Barten. Genetically, the br2 alleles would confer –inherently—the height reduction that are determined by the br2 alleles. As illustrated above, either of the exemplary reference lines taught by Barten, combined with the br2 alleles br2 alleles, would reach a height reduction that falls within the instantly claimed ranges.
Applicant argued that Aguiar does not teach applicator positioning relative to average plant height.
Applicant argued that Aguiar does not teach applicator positioning relative to average plant height; that Aguiar teaches no height measurement methodology. This is deemed false. Aguiar teaches, for example, “each crop height sensor 3 transmits a crop height signal representative of a sensed height of the plants PB”—plant height is measured with sensors.
Applicant argued that the claimed combination is not routine optimization
Applicant argued that the “inventive insight that semi-dwarf br2 corn plants have a sufficiently reduced and uniform height profile” to permit ground-based application of agricultural compositions from a specific proximity to the canopy without damaging the plants.
This argument has been fully considered but not deemed persuasive. As discussed above, the “semi-dwarf br2 corn plants have a sufficiently reduced and uniform height profile” is not inventive. It has been taught by Barten. Applicant further assert that adjusting applicator heights according to the plant heights is “inventive”, yet fail to offer any evidence, in view of evidence presented in the rejection, that no one has ever thought about that. If that idea is so inventive, why not claiming it with any corn plant lines? Why br2? If br2 plants are inventive, whatever method goes with it could be inventive. However, as established above, br2 has been disclosed by Barten. The applicators are commercially available. Applicant has not offered anything inventive.
Applicant argued that the R4038 Sprayer and Choulet do not cure the deficiencies.
Since there is no deficiencies, this argument is moot.
At least for these reasons, the rejections are maintained.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to WEIHUA FAN whose telephone number is (571)270-0398. The examiner can normally be reached Monday-Friday, 9-5.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad A Abraham can be reached at (571) 270-7058. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
WEIHUA . FAN
Primary Examiner
Art Unit 1663
/WEIHUA FAN/Primary Examiner, Art Unit 1663
Prosecution Insights