Prosecution Insights
Last updated: July 17, 2026
Application No. 18/178,470

OLIGONUCLEOTIDE COMPOSITIONS AND METHODS OF USE THEREOF

Non-Final OA §103§112§DP
Filed
Mar 03, 2023
Priority
Jun 02, 2017 — provisional 62/514,769 +4 more
Examiner
DACE DENITO, ALEXANDRA GERALDINE
Art Unit
1636
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Wave Life Sciences Ltd.
OA Round
1 (Non-Final)
57%
Grant Probability
Moderate
1-2
OA Rounds
3m
Est. Remaining
92%
With Interview

Examiner Intelligence

Grants 57% of resolved cases
57%
Career Allowance Rate
31 granted / 54 resolved
-2.6% vs TC avg
Strong +34% interview lift
Without
With
+34.5%
Interview Lift
resolved cases with interview
Typical timeline
3y 7m
Avg Prosecution
45 currently pending
Career history
103
Total Applications
across all art units

Statute-Specific Performance

§101
2.0%
-38.0% vs TC avg
§103
67.5%
+27.5% vs TC avg
§102
3.9%
-36.1% vs TC avg
§112
8.2%
-31.8% vs TC avg
Black line = Tech Center average estimate • Based on career data from 54 resolved cases

Office Action

§103 §112 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Priority Applicant’s claim to priority from US Application No. 16/618,001 filed 11/27/2019 (USPAT. No. 11,597,927), from PCT/US18/35721 filed 06/01/2018 and from Provisional Applications Nos. 62/670,698 filed 05/11/2018 and 62/514,769 filed 06/02/2017, is hereby acknowledged. Election/Restrictions Applicant’s election without traverse of Invention Group I (Claims 86-101, drawn to a composition comprising plurality of oligonucleotides) in the reply filed on 04/03/2026 is acknowledged. Applicant’s election of Species A, B and C in the reply filed on 04/03/2026 is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)). Elected Species are the following: Species Group A: (claims 86, 97-100): A composition comprising a plurality of oligonucleotides wherein the oligonucleotides has a common base sequence, wherein each U is optionally and independently replaced with T and vice versa: With over 50% identity with SEQ ID NO: 696, With 50%-100% of all oligonucleotides in the composition share the common base sequence, i.e. SEQ ID NO: 696. Species Group B: ( claims 92-94, 96): a targeting moiety RCD: PNG media_image1.png 239 487 media_image1.png Greyscale Species Group C: (claim 95): a linker selected from: PNG media_image2.png 42 73 media_image2.png Greyscale . Claims 100-104 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected species, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 04/03/2026. Applicant is reminded that upon the cancelation of claims to a non-elected invention, the inventorship must be corrected in compliance with 37 CFR 1.48(a) if one or more of the currently named inventors is no longer an inventor of at least one claim remaining in the application. A request to correct inventorship under 37 CFR 1.48(a) must be accompanied by an application data sheet in accordance with 37 CFR 1.76 that identifies each inventor by his or her legal name and by the processing fee required under 37 CFR 1.17(i). Application Status Preliminary claim amendments filed 04/03/2026 are hereby acknowledged. Claims 1-85 are cancelled. Claims 86-88, 92-93, and 100-101 are currently amended. Claims 100-104 are withdrawn from further consideration. Therefore claims 86-99 are under consideration in this office action. Information Disclosure Statement The information disclosure statements (IDSs) submitted on 12/22/2023 and 04/03/2026 are hereby acknowledged. The submissions are in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statements are being considered by the examiner. However, the listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered. Drawings The Drawings sheet submitted on 03/03.2023 are hereby acknowledged and are acceptable. Nucleotide and/or Amino Acid Sequence Disclosures REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES Items 1) and 2) provide general guidance related to requirements for sequence disclosures. 37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted: In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying: the name of the ASCII text file; ii) the date of creation; and iii) the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying: the name of the ASCII text file; the date of creation; and the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended). When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical. Specific deficiencies and the required response to this Office Action are as follows: Specific deficiency – Nucleotide and/or amino acid sequences appearing in the specification ( see [00356]-[00357], and Table 1A in [00362] from page 88 to page 157) are not identified by sequence identifiers in accordance with 37 CFR 1.821(d). Required response – Applicant must provide: A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers, consisting of: A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version); A copy of the amended specification without markings (clean version); and A statement that the substitute specification contains no new matter. Specification The disclosure is objected to because of the following informalities: [00298] has 1 character “I” and is otherwise empty. The Specification is objected to for sequence non-compliance issues as stated above (see [00356]-[00357] and [00362]). The use of the term “lipofectamine” ([001041]), which is a trade name or a mark used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term. Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks. Appropriate correction is required. Claim Rejections - 35 USC § 112(b) The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 86-89, and 97-99 are rejected under 35 U.S.C. §112(b) or 35 U.S.C. §112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Regarding claim 86, the term “substantially” in claim 86 is a relative term which renders the claim indefinite. The term “substantially” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. The Specification (see [00127]) provides a vague definition for the term “substantially” in the context of sequences. There is no definition for a “substantially racemic preparation of oligonucleotides” provided in the Specification, nor in the claim. Claim 86 also recites “a particular oligonucleotide type” and “optionally”. MPEP 2173.05(b) “Relative terminology” states (section III. Approximations) that the term “type” extends the scope of the expression so as to render it indefinite. Regarding claims 86 and 97-99, the term “optionally”, MPEP 2173.05(b) section II also states that “Reference to an object that is variable may render a claim indefinite”. MPEP 2173.05(h) II suggests that the term can lead to confusion, especially in this instance where the term “vice-versa” is also used. In this instance where the list of potential alternatives can vary and ambiguity arises. Substituting one “T” to “U” can give rise to a different species, and having all “U” of SEQ ID NO: 696 substituted to “T” reverts the molecule to a 100% DNA sequence. Regarding claims 87-89, The claims recite the term “independently”. It is not clear whether “independently” refers to one or multiple internucleotide linkages within the same molecule, or whether it refers to multiple oligonucleotides separately. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or non-obviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 86-91 and 97-99 are rejected under 35 U.S.C. § 103 as being unpatentable over Liu (Liu, W. et al. US Patent No. US 11,028,393 B2, published June 8, 2021, benefitting from priority of US Application Nos. 16/735,034 filed January 6, 2020, 16/026,609 filed July 03, 2018 (now US Patent No. 10, 526,605), 15/614,147 filed June 05, 2017 (now US Patent No. 10,036,024) and provisional Application No. 62/345,048 filed June 3, 2016), in view of Xu (Xu, L et al. “Structure-based design of novel chemical modification of the 3’-overhang for optimization of short interfering RNA performance”. Biochemistry, Vol. 54 (2015), pp: 1268-1277), and Butler ( Butler, D. et al. US 2015/0211006 A1, published July 30, 2015). Regarding claim 86, A search for sequence corresponding to instant SEQ ID NO: 696 lead to the identification of a target sequence used for designing an antisense oligonucleotide named SEQ ID NO: 173 in Liu, US Patent No. 11, 028, 393 with duplicate in US Patent No. 10, 526, 605 (see Table 2, column 11). See alignment below (Qy = SEQ ID NO: 696 of instant Application; Db = SEQ ID NO: 173 of Liu): Result Query Filing No. Score Match Length ID Date ------------------------------------------------------------------------------------------------------------- c 43 20 87.0 20 US-15-614-147-173 2017-06-05 ALIGNMENT: Query Match 87.0%; Score 20; Length 20; Best Local Similarity 100.0%; Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 2 GCCACTGTAGAAAGGCATGA 21 |||||||||||||||||||| Db 20 GCCACTGTAGAAAGGCATGA 1 US-16-735-034-173 Filing date in PALM: 2020-01-06 Sequence 173, US/16735034 Patent No. 11028393 GENERAL INFORMATION APPLICANT: Purdue Research Foundation APPLICANT: Liu, Wanqing APPLICANT: Yeo, Yoon TITLE OF INVENTION: siRNA COMPOSITIONS THAT SPECIFICALLY DOWNREGULATE EXPRESSION OF TITLE OF INVENTION: A VARIANT OF THE PNPLA3 GENE AND METHODS OF USE THEREOF FOR TITLE OF INVENTION: TREATING A CHRONIC LIVER DISEASE OR ALCOHOLIC LIVER DISEASE(ALD) FILE REFERENCE: PURD-087/01US 28593/299 CURRENT APPLICATION NUMBER: US/16/735,034 CURRENT FILING DATE: 2020-01-06 PRIOR APPLICATION NUMBER: US 15/614,147 PRIOR FILING DATE: 2017-06-05 PRIOR APPLICATION NUMBER: US 62/345,048 PRIOR FILING DATE: 2016-06-03 NUMBER OF SEQ ID NOS: 554 SEQ ID NO 173 LENGTH: 20 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic Sequence Liu teaches siRNA compositions that specifically downregulates expression of a variant of the PNPLA3 gene and methods for treating a chronic liver disease (see Abstract). Regarding claim 86, it recites “wherein each U is optionally and independently replaced with T and vice versa”. It is interpreted that this limitation encompasses the sequences listed as SEQ ID NO: 173 and its target. Claim 86 also recites “wherein the common base sequence has over 50% identity with …(SEQ ID NO: 696)” and “ the common base sequence is complementary to a portion of the base sequence of an PNPLA3 transcript, wherein the portion comprises 15 or more nucleobases”. The sequence targeted by Liu’s SEQ ID NO:173 is 20 nucleotides in length and is 87% identical to SEQ ID NO: 696 (see table 2, column 11 and alignment above). Regarding claims 97-99, Liu’s SEQ ID NO: 173 has a sequence identity compared to instant’s SEQ ID NO: 696 that is over 60, 70 and 80%. Liu does not teach the extra “TU” present in 3’ of SEQ ID NO: 696. Liu also does not teach a composition comprising multiple oligonucleotides “ a) with a common base sequence; b) a common pattern of backbone linkages and a common pattern of backbone chiral centers; c) wherein the oligonucleotide comprises at least one internucleotide linkage comprising a linkage phosphorus in the Sp configuration” and “wherein the composition is chirally controlled in that it is enriched, relative to a substantially racemic preparation of oligonucleotides having the same common base sequence, for oligonucleotides of the particular oligonucleotide type”. However, Xu teaches that optimization of an antisense oligonucleotide by modifying the 3’ end with an overhang (see title). Xu teaches adding “dTdT” as an overhang at the 3’ end of the oligonucleotide (see Table 1). Xu teaches that the binding energy is more favorable when “dTdT” is added (see page 1272, left column, “Binding energy calculation of the chemical modification combinations” paragraph). Therefore, it would have been obvious to one with ordinary skills in the art, before the effective date of the claimed invention, to have modified the oligonucleotide targeting PNPLA3 taught by Liu, with the 3’ overhang as taught by Xu. One with ordinary skills in the art motivated in increasing stability and binding affinity of the oligonucleotide, could have performed this modification with a reasonable expectation of success and would arrived at the claimed invention. Butler teaches chiral controlled oligonucleotides, chirally controlled oligonucleotide compositions and composition comprising a plurality of oligonucleotides (see title and abstract). Butler teaches that naturally occurring nucleic acids for therapeutics can be limited because of instability against extra- and intracellular nucleases, poor penetration and distribution. Butler also teaches that binding affinity can be affected by absolute stereochemical configurations of the phosphorus atoms, thus the need for new and improved oligonucleotides compositions (see page 1, [0002]). Butler teaches in some embodiments compositions comprising a plurality of oligonucleotides of at least one type, wherein each type is defined by: 1) base sequence; 2) pattern of backbone linkages; 3) pattern of backbone chiral centers; and 4) pattern of backbone P-modifications (see page 20, [0222]). Butler provides example of oligonucleotide that is chirally controlled comprising at least one internucleotide linkage phosphorus in the Sp configuration , e.g., (rp/Sp, Rp/Sp, Rp/Sp, Rp, Rp, Sp, Sp, Sp, Sp, SpSp, Sp, Sp, Sp, Rp, Rp, Rp, Rp, Rp)-d [GsCsCsTsCsAsGsTsCsTsGsCsTsTsCsGs1Cs1As1CsC] (see page 21, [0224]). Therefore, it would have been obvious to one with ordinary skills in the art, before the effective date of the claimed invention, to have modified the composition comprising the oligonucleotide targeting PNPLA3 taught by Liu modified by Xu, to include a plurality of chirally controlled oligonucleotides designed with internucleotide linkages with modified phosphorus, as taught by Butler. One with ordinary skills in the art, motivated in enhancing stability, penetration and distribution of the oligonucleotides targeting PNPLA3 mRNA, could have performed this modification with a reasonable expectation of success as taught by Butler, and arrived at the claimed invention. Regarding claims 87 and 88, Butler teaches that oligonucleotides of a common designated “type” are structurally identical to one another (see page 15, [0108]). Butler also teaches that in some embodiments, compositions comprising or consisting of a plurality of oligonucleotides molecules (e.g., chirally controlled oligonucleotide composition), wherein all such molecules are of the same type (see [0109]). Butler also teaches that in some embodiments, a provided chirally controlled oligonucleotide is over 50% pure, to over 99.9% pure (see [0610]-[0611]). The obviousness of the combination of Liu, Xu and Butler is described above. The elements of claim 87 is encompassed within the embodiments taught by Butler. Therefore, the combination of Liu, Xu and Butler also renders elements of claim 87 obvious. Regarding claim 89, it is interpreted that the claim is drawn to oligonucleotides comprised within a same composition, having in common the same modification pattern as far as internucleotide linkages are concerned. Butler teaches “types” of oligonucleotides, wherein each type is defined by: 1) base sequence; 2) pattern of backbone linkages; 3) pattern of backbone chiral centers; and 4) pattern of backbone P-modifications (see page 20, [0222]). Therefore, it is interpreted that the oligonucleotides belonging to the same type, also share the common base sequence and same pattern of internucleotide linkage and phosphorus stereochemistry. The obviousness of the combination of references, Liu, Xu and Butler, is discussed above. Regarding claim 90, it is interpreted that the term “constitution” is equivalent to the terms “structure” or “type”. Butler also teaches that in some embodiments, compositions comprising or consisting of a plurality of oligonucleotides molecules (e.g., chirally controlled oligonucleotide composition), wherein all such molecules are of the same type (see [0109]). The obviousness of the combination of references, Liu, Xu and Butler, is discussed above. Regarding claim 91, Liu teaches administering pharmaceutically acceptable dosage forms that can be liquid (see column 28, lines 51-58). Butler teaches a pharmaceutical composition that can be a liquid (see page 188, [1403]-[1404]). The obviousness of the combination of references, Liu, Xu and Butler is discussed above. Claims 92-96 are rejected under 35 U.S.C. § 103 as being unpatentable over Liu (Liu, W. et al. US Patent No. US 11,028,393 B2, published June 8, 2021, benefitting from priority of US Application Nos. 16/735,034 filed January 6, 2020, 16/026,609 filed July 03, 2018 (now US Patent No. 10, 526,605), 15/614,147 filed June 05, 2017 (now US Patent No. 10,036,024) and provisional Application No. 62/345,048 filed June 3, 2016), in view of Xu (Xu, L et al. “Structure-based design of novel chemical modification of the 3’-overhang for optimization of short interfering RNA performance”. Biochemistry, Vol. 54 (2015), pp: 1268-1277), and Butler ( Butler, D. et al. US 2015/0211006 A1, published July 30, 2015), as applied to claim 87 above, and in further view of Prakash (Prakash, T. et al. WO 2015/168589 A2, published November 5, 2015) and Hinkle ( Hinkle, G. et al. WO 2017/048620 A1, published March 23, 2017; cited on IDS filed 12/22/2023). The rejection of claim 87 is described above. The combination of references Liu, Xu and Butler renders elements of claim 87 obvious. However, the combination of references does not render obvious a targeting moiety RCD (claim 92), wherein the oligonucleotides comprise a N-acetyl galactosamine moiety (claim 93), wherein RCD is linked to the oligonucleotide or oligonucleotides through a linker (claim 94), wherein the linker has the specific structure: PNG media_image2.png 42 73 media_image2.png Greyscale (claim 95), and wherein RCD is PNG media_image1.png 239 487 media_image1.png Greyscale (claim 96). Regarding claims 92-94, Prakash also teaches targeting siRNA compounds to liver cells and states that certain N-acetyl galactosamine (GalNAc)-containing conjugates increase uptakes into the liver and increase activity of duplex siRNAs compounds in liver cells in vivo (see page 4, lines 26-28). Prakash teaches a Formula : A----B----C-----D----(--E----F)q ; wherein A is the antisense oligonucleotide, B is the cleavage moiety, C is the conjugate linker, D is the branching group, each E is a tether, and each F is a ligand (i.e., a targeting moiety), and q is an integer between 1 and 5. (see page 7, lines 24-34). Prakash teaches a formula when q = 3, as follows: PNG media_image3.png 208 296 media_image3.png Greyscale . Prakash further teaches examples of cell targeting moiety, branching group , conjugate linker and cleavable moiety as follows (see page 12, lines 1-5): PNG media_image4.png 487 528 media_image4.png Greyscale Therefore, Prakash teaches a targeting moiety RCD (claim 92), wherein the oligonucleotides comprise a N-acetyl galactosamine moiety (claim 93), wherein RCD is linked to the oligonucleotide or oligonucleotides through a linker (claim 94). Regarding claim 95, Prakash teaches that a “substituent group” can be an alkynyl group, i.e., a straight or branched hydrocarbon radical containing up to twenty four carbon atoms and having at least one carbon-carbon triple bond (see page 29, lines 3-4). Prakash teaches that in some embodiments, the 5’-terminal end of the antisense oligonucleotide comprises a modified phosphate moiety stabilized with a linking group that can be an alkynyl group, or have the formula (see page 101, lines 14-18): PNG media_image5.png 63 93 media_image5.png Greyscale . Therefore Prakash teaches that the oligonucleotide can be linked via a conjugate linker comprising a group with triple bonds. Regarding claim 96, Prakash also teaches a targeting moiety and branching group similar to the RCD claimed in claim 96 (see page 578, claim 119; page 597, claim 168). See example below (claim 168 of Prakash): PNG media_image6.png 316 622 media_image6.png Greyscale Regarding claims 92-96, Hinkle also teaches antisense oligonucleotides targeting PNPLA3 mRNA (see title and abstract). Hinkle teaches using the oligonucleotides to treat Nonalcoholic Fatty Liver Disease or any PNPLA3-associated disorder (see abstract). Hinkle teaches modifications to optimize the molecule, i.e., increasing serum stability, half-life, thermal stability, transmembrane delivery and targeting of specific cell type (see page 18, lines 10-24). Regarding claims 92-93 and 96, Hinkle teaches “Ligands” that can alter the distribution, targeting or lifetime of an antisense polynucleotide agent (see page 35, lines 20-37; page 36, lines 1-37; page 37, lines 1-9). Hinkle teaches that Ligands include targeting groups such as N-acetyl-galactosamine (see page 35, lines 26-29, page 36, lines 7 and 26-30). Hinkle’s formula II is comprised within claimed RCD of instant invention (see page 45). Hinkle’s formula XXVII is a variant of the RCD of instant invention (see page 51). Hinkle’s general formulas XXXII-XXXVI propose alternatives that comprise the targeting moieties in RCD of instant invention (see pages 53-54). Regarding claims 94-95, Hinkle also teaches linkers, or linking groups that can be any of many alternatives, including alkynyl groups (i.e., comprising triple bonds) (see page 47, lines 15-38). In KSR Int 'l v. Teleflex, the Supreme Court, indicated that “The principles underlying [earlier] cases are instructive when the question is whether a patent claiming the combination of elements of prior art is obvious. When a work is available in one field of endeavor, design incentives and other market forces can prompt variations of it, either in the same field or a different one. If a person of ordinary skill can implement a predictable variation, § 103 likely bars its patentability”. KSR Int'l v. Teleflex lnc., 127 S. Ct. 1727, 1740 (2007). Therefore, it would have been obvious to one with ordinary skills before the effective filing date of the claimed invention, to have combined the teachings of Liu, modified Xu and Butler, obtaining a composition comprising a plurality of antisense oligonucleotides conjugated with a liver-targeting moiety comprising a trivalent GalNAc targeting moiety, including the claimed RCD as one of the alternatives for testing, and linked to the oligonucleotides via linkers as taught by Prakash and Hinkle. One with ordinary skills in the art, motivated in efficiently targeting the liver, could have made and obtained these modifications in their library of molecules, with a reasonable expectation of success, as disclosed by Prakash and Hinkle, and arrived at the claimed invention. Double Patenting The non-statutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A non-statutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on non-statutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a non-statutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 86-99 are rejected on the ground of non-statutory double patenting as being unpatentable over claims 1-11 and 13-14 of U.S. Patent No. 11,597,927 B2. Although the claims at issue are not identical, they are not patentably distinct from each other because: Regarding claims 86 and 97-99, claims 1, and 13-14 of USPAT’927 are drawn to the same composition comprising a chirally controlled oligonucleotide with at least 50% to 80% identity with a sequence of SEQ ID NO:153, which has 78.9% local similarity and is 75.7% identical to instant application’s SEQ ID NO: 696. See alignment below: Query Match 75.7%; Score 17.4; DB 1; Length 21; Best Local Similarity 78.9%; Matches 15; Conservative 3; Mismatches 1; Indels 0; Gaps 0; Qy 5 ACTGTAGAAAGGCATGATT 23 ||:|:|||||||||:|| | Db 2 ACUGUAGAAAGGCAUGAAT 20 Regarding claims 87-96, claims 2-11 of USPAT’927 are drawn to the same elements and same structures. Conclusion No claim is allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to ALEXANDRA G DACE DENITO whose telephone number is (703)756-4752. The examiner can normally be reached Monday-Friday, 8:30-5:00EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /A.D./Examiner, Art Unit 1636 /NANCY J LEITH/Primary Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Mar 03, 2023
Application Filed
May 22, 2026
Non-Final Rejection mailed — §103, §112, §DP (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12680098
Modified antisense oligonucleotide for inhibition of FoxP3 expression
4y 0m to grant Granted Jul 14, 2026
Patent 12655421
NOVEL CRISPR DNA TARGETING ENZYMES AND SYSTEMS
5y 9m to grant Granted Jun 16, 2026
Patent 12570996
Circular RNA For Translation In Eukaryotic Cells
1y 12m to grant Granted Mar 10, 2026
Patent 12529048
DOUBLE KNOCK-OUT CHO CELL LINE METHOD OF ITS GENERATION AND PRODUCING THERAPEUTIC PROTEINS THEREFROM
5y 0m to grant Granted Jan 20, 2026
Patent 12516376
OPTIMIZING BAG3 GENE THERAPY
5y 1m to grant Granted Jan 06, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
57%
Grant Probability
92%
With Interview (+34.5%)
3y 7m (~3m remaining)
Median Time to Grant
Low
PTA Risk
Based on 54 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month