DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Priority
Applicant’s claim to priority from Foreign Application EP16177973.1 filed 07/05/2016 and US Application No. 15/642,270 filed 07/05/2017 (now abandoned) is hereby acknowledged.
Acknowledgment is made of applicant’s claim for foreign priority under 35 U.S.C. 119 (a)-(d). The certified copy has been filed in parent Application No. 15/642,270, filed on 07/05/2017.
Election/Restrictions
Applicant’s election without traverse of Invention Group I (claims 1-13, drawn to an antisense oligonucleotide and a pharmaceutical composition with a pharmaceutically acceptable carrier) and Species Group A -SEQ ID NO: 6086 (claims 1-14) in the reply filed on 03/13/2026 is acknowledged.
Claim 14 is withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 03/13/2026.
Application Status
This Application is a DIV of US Application No. 15/642,270 filed 07/05/2017.
Amendments to claims filed 03/13/2026 are hereby acknowledged. Claims 1-9, 12 and 13 are currently amended. Claim 14 is withdrawn, therefore claims 1-13 are under consideration in this office action.
Information Disclosure Statement
The information disclosure statements (IDSs) submitted on 07/21/2023, 07/24/2023, 07/25/2023, 07/28/2023, 11/10/2023, 02/29/2024 and 03/13/2026 are hereby acknowledged. The submissions are in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statements are being considered by the examiner.
The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered.
Nucleotide and/or Amino Acid Sequence Disclosures
REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
the name of the ASCII text file;
the date of creation; and
the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or
In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
Specific deficiencies and the required response to this Office Action are as follows:
Specific deficiency – Nucleotide and/or amino acid sequences appearing in the specification (and specifically in claim 12) are not identified by sequence identifiers in accordance with 37 CFR 1.821(d).
Required response – Applicant must provide:
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter.
Drawings
The Drawing submitted on 03/06/2023 are hereby acknowledged and are acceptable.
Specification
The disclosure is objected to because of the following informalities: in the Abstract submitted on 03.06/2023, the abbreviated term “DMD” appears. Whenever a term appear for the first time, it is customary to spell the term in its entirety. The abbreviated term should be replaced by: “Duchenne Muscular Dystrophy (DMD)” .
Appropriate correction is required.
The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code (see [0178]). Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01.
The use of the term “Oligopilot” ([0334], [0341], [0346], [0351]), “Taqman” ([0337], [0344], [0349], [0354]), “Compat-Able”, “Pierce”, “Simple Western” ([0339]), “MagNa Lyser” ([0343]) which is a trade name or a mark used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
Claim Objections
Claim 12 is objected to because it contains a sequence without a sequence identifier number.
Furthermore, regarding claim 12, it is drawn to locked 5-methylcytosine as “C”, however, there is no “C”, i.e., locked 5-methylcytosine, in the enumeration of residues recited in the oligonucleotide sequence.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 1, 4-5 and 13 are rejected under 35 U.S.C. §102(a)(1) as being anticipated by Watanabe (Watanabe, N. et al. US 9,079,934 B2; published July 14, 2015; cited in IDS filed 03/13/2026).
Regarding claim 1, Watanabe teaches a sequence that comprises the base sequence of SEQ ID NO: 6087 (5’-GTTGCCTCCGGTTC-3’) (Qy), that is SEQ ID NO: 119 of Watanabe (Db), an RNA version and modified nucleotide sequence, as shown in the search result and alignment below:
RESULT 1
US-13-819-520A-119
(NOTE: this sequence has 10 duplicates in the database searched.
See complete list at the end of this report)
Sequence 119, US/13819520A
Patent No. 9079934
GENERAL INFORMATION
APPLICANT: NIPPON SHINYAKU CO., LTD.
APPLICANT: NATIONAL CENTER OF NEUROLOGY AND PSYCHIATRY
TITLE OF INVENTION: ANTISENSE NUCLEIC ACID
FILE REFERENCE: PCT11-0042
CURRENT APPLICATION NUMBER: US/13/819,520A
CURRENT FILING DATE: 2013-02-27
PRIOR APPLICATION NUMBER: JP 2010-196032
PRIOR FILING DATE: 2010-09-01
NUMBER OF SEQ ID NOS: 123
SEQ ID NO 119
LENGTH: 18
TYPE: DNA
ORGANISM: Artificial
FEATURE:
OTHER INFORMATION: Synthetic Nucleic Acid
Query Match 100.0%; Score 14; Length 18;
Best Local Similarity 64.3%;
Matches 9; Conservative 5; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GTTGCCTCCGGTTC 14
|::|||:||||::|
Db 2 GUUGCCUCCGGUUC 15
SEQ ID NO: 119 of Watanabe can be found in Table 7, in column 41.
Watanabe also teaches another sequence, SEQ ID NO: 34 (Db), an oligonucleotide designated as the complementary sequence to be used as a target, with a sequence that is 100% identity to SEQ ID NO: 854 (Qy), as shown in the alignment below:
Query Match 100.0%; Score 20; DB 1; Length 20;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 CTCCGGTTCTGAAGGTGTTC 20
||||||||||||||||||||
Db 1 CTCCGGTTCTGAAGGTGTTC 20
The same sequence is also shared by other modified oligonucleotides of instant Application’s SEQ ID NOs: 855-860. SEQ ID NO: 34 of Watanabe can be found in Table 1, columns 9-10 and in column 55. SEQ ID NO: 34 of Watanabe is identified as a target sequence in exon 53 of Dystrophin pre-mRNA (see Table 1, column 9).
Watanabe also teaches antisense oligonucleotide with 18 nucleotides in length (see SEQ ID NO: 119, Table 7, column 41).
Watanabe teaches that the antisense oligonucleotides of the invention can comprise 5-methylcytosine (see column 11, lines 40-57).
Watanabe also teaches that the antisense oligonucleotide can be locked nucleic acids (see columns 11 (line 65-67) and 12 (lines 1-3)). Therefore, Examiner interprets that the oligonucleotide of Watanabe can comprise at least one bridged nucleic acid.
Watanabe teaches that the antisense oligonucleotides comprise modification that are phosphorothioate bonds (see column 12, lines 4-11). Watanabe teaches that the oligonucleotide of the invention is the oligomer containing units with the general formula having a phosphate-binding bond that is a phosphorothioate bond (see column 12, lines 49-67). Therefore, Examiner interprets the statement as meaning that the oligonucleotide can comprise a full phosphorothioate backbone.
Regarding claims 4 and 5, Watanabe teaches antisense oligonucleotides that can be 18 to 28 nucleotides in length, preferably from 21 to 25 nucleotides in length (see column 11, lines 25-30). SEQ ID NO: 119 is 18 nucleotides in length (see Table 7, column 41).
Regarding claim 13, Watanabe teaches a pharmaceutical composition comprising the antisense oligonucleotide and a pharmaceutically acceptable carrier (see column 25, lines 13-18 and lines 57-67, column 26, lines 1-21).
Therefore, claims 1, 4-5 and 13 are rejected.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1-13 are rejected under 35 U.S.C. §103, as being unpatentable over van Ommen (van Ommen, G-J.B. et al. US 2006/0099616 A1, published May 11, 2006), in view of Sazani (Sazani, P. et al. US 8,871,918 B2, published October 28, 2014, benefitting from priority of US Application No. 12/605,276 filed October 23, 2009 and publication (US2010/0130591 A1) on May 27, 2010), Kurreck (Kurreck, J. et al. “Design of antisense oligonucleotides stabilized by locked nucleic acids”. Nucleic Acids Research, Vol. 30, No. 9 (2002), pp: 1911-1918) and Mitsuoka (Mitsuoka, Y. et al. “A bridged nucleic acid, 2’, 4’-BNAcoc: synthesis of fully modified oligonucleotides bearing thymine, 5-methylcytosine, adenine and guanine 2’,4’-BNAcoc monomers and RNA-selective nucleic-acid recognition”. Nucleic Acids Research, Vol. 37, No. 4 (2009), pp: 1225-1238).
Regarding claim 1, van Ommen teaches at least two antisense oligonucleotides that comprise the base sequences of SEQ ID NOs: 452 and 6087 in Table 2 (see page 28 and below).
PNG
media_image1.png
677
594
media_image1.png
Greyscale
Instant Application’s SEQ ID NO: 6087 (Qy) is comprised within a modified sequence comprising Uracil, SEQ ID NO: 39 of van Ommen (Db); see alignment below:
Query Match 100.0%; Score 14; Length 18;
Best Local Similarity 64.3%;
Matches 9; Conservative 5; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GTTGCCTCCGGTTC 14
|::|||:||||::|
Db 3 GUUGCCUCCGGUUC 16
Also, instant Application’s SEQ ID NO: 452 (Qy) is identical to a modified sequence comprising Uracil, SEQ ID NO: 37 (Db) of van Ommen; see alignment below:
Query Match 100.0%; Score 20; DB 1; Length 20;
Best Local Similarity 70.0%;
Matches 14; Conservative 6; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TCAAGGAAGATGGCATTTCT 20
:|||||||||:||||:::|:
Db 1 UCAAGGAAGAUGGCAUUUCU 20
Van Ommen teaches that these two oligonucleotides are among those that are efficient in exon skipping (see Table 2 on page 28, and above).
Van Ommen teaches that these oligonucleotides were designed to have a length between 15 and 24 bp; SEQ ID NOs: 37 and 39 of van Ommen have a length of 20 bp (see table 2). Van Ommen teaches the oligonucleotides can have a length of 16 to 80 nucleotides (see page 30, claim 17) and be complementary to 14 to 50 nucleotides of target RNA (see page 29, claims 3 and 4).
Van Ommen teaches that these antisense oligonucleotides have at least one locked nucleic acid, i.e., a bicyclic nucleic acid, as locked nucleic acid displays a higher target affinity and reduced toxicity therefore a higher efficiency of exon skipping (see page 4, [0018]-[0019]), or can have a full-length phosphorothioate backbone and 2’-O-methyl modified ribose molecules (see pages 11-12, [0057], [0065]; see [0105], [0114], [0169]).
Van Ommen does not teach 5-methylcytosine or 5-methyluracil base in the antisense oligonucleotide.
However, Sazani teaches that antisense oligonucleotides can be modified with 5-methylcytosines and 5-alkyluridines (see column 11, lines 50-67 and column 25, lines 16-23).
Sazani also teaches an antisense oligonucleotide comprising the sequence of instant Application’s SEQ ID NO: 6087 (Qy), in the form of Sazani’s SEQ ID NO: 460
(CTGTTGCCTCCGGTTCTGAA) (Db) (see in Table, columns 71-72). See search result and alignment below:
RESULT 12
US-12-605-276A-460
(NOTE: this sequence has 14 duplicates in the database searched.
See complete list at the end of this report)
Sequence 460, US/12605276A
Patent No. 8871918
GENERAL INFORMATION
APPLICANT: Sazani, Peter
APPLICANT: Kole, RIchard
TITLE OF INVENTION: MULTIPLE EXON SKIPPING COMPOSITIONS FOR
TITLE OF INVENTION: DMD
FILE REFERENCE: 120178.410
CURRENT APPLICATION NUMBER: US/12/605,276A
CURRENT FILING DATE: 2010-01-19
PRIOR APPLICATION NUMBER: US 61/108,416
PRIOR FILING DATE: 2008-10-24
NUMBER OF SEQ ID NOS: 651
SEQ ID NO 460
LENGTH: 20
TYPE: DNA
ORGANISM: Artificial Sequence
FEATURE:
OTHER INFORMATION: Antisense sequence to target splice site of
proprocessed human dystrophin
Query Match 100.0%; Score 14; Length 20;
Best Local Similarity 100.0%;
Matches 14; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GTTGCCTCCGGTTC 14
||||||||||||||
Db 3 GTTGCCTCCGGTTC 16
Sazani teaches a similar sequence as h53AON1, i.e. SEQ ID NO: 610 (CTGTTGCCTCCGGTTCTG) that also comprises the sequence of instant Application’s SEQ ID NO: 6087 (see columns 79-80).
Therefore, Sazani teaches the same sequence claimed in claim 1 as SEQ ID NO: 6087 and that is also taught by van Ommen.
Sazani teaches performing a scan for exon skipping and Dystrophin exons 51 and 53 targeting oligonucleotides (see Fig. 2A and 2D, 4A and 4B).
Kurreck teaches that antisense oligonucleotides are stabilized by locked nucleic acids, and are more effective in mRNA cleavage (see title, abstract and Table 1).
Mitsuoka teaches that constructing Bridged/bicyclic nucleic acids that confers specific RNA-selectivity in nucleic acid recognition, it is necessary to use thymine, 5-methylcytosine, adenine and guanine (see title and abstract). This specific nucleic acid recognition suggests avoiding possible off-target genomic modifications.
It would have been obvious to one with ordinary skills in the art, before the effective filing date of the claimed invention to have combined the teachings of van Ommen with the teachings of Sazani and modified the antisense sequence with 5-methylcytosines as taught by Sazani. One with ordinary skills in the art motivated in synthesizing an antisense oligonucleotide that is specific to target RNA and that is highly stable, could have modified the antisense oligonucleotides taught by van Ommen and Sazani and incorporated the 5-methylcytosine into the locked nucleic acid as taught by Kurreck and Mitsuoka with a predictable and reasonable expectation of success and would arrived at the claimed invention.
Regarding claims 2, 10 and 11, van Ommen teaches one sequence that comprises SEQ ID NO: 452; instant Application’s SEQ ID NO: 452 (Qy) is identical to a modified sequence comprising Uracil, SEQ ID NO: 37 (Db) of van Ommen, as shown in the alignment above. Van Ommen’s SEQ ID NO: 37 is shown in Table 2 (see page 28, and above).
Sazani also teaches a sequence that comprises instant Application’s SEQ ID NO: 4568 (Qy), in the form of Sazani’s SEQ ID NO: 332 (Db) (GTCGGTAAGTTCTGTCCAAGCCCGG) (see columns 65-66). See alignment below:
Query Match 100.0%; Score 18; DB 1; Length 25;
Best Local Similarity 100.0%;
Matches 18; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GGTAAGTTCTGTCCAAGC 18
||||||||||||||||||
Db 4 GGTAAGTTCTGTCCAAGC 21
Sazani’s SEQ ID NO: 332 was designed to target exon 51 in human DMD gene.
Sazani’s SEQ ID NO: 332 (Db) also comprises a sequence 100% identical to instant Application’s SEQ ID NO: 6086 (Qy); see alignment below:
Query Match 100.0%; Score 14; DB 1; Length 18;
Best Local Similarity 100.0%;
Matches 14; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TAAGTTCTGTCCAA 14
||||||||||||||
Db 3 TAAGTTCTGTCCAA 16
In KSR Int 'l v. Teleflex, the Supreme Court, indicated that “The principles underlying [earlier] cases are instructive when the question is whether a patent claiming the combination of elements of prior art is obvious. When a work is available in one field of endeavor, design incentives and other market forces can prompt variations of it, either in the same field or a different one. If a person of ordinary skill can implement a predictable variation, § 103 likely bars its patentability.” KSR Int'l v. Teleflex lnc., 127 S. Ct. 1727, 1740 (2007).
Therefore, it would have been obvious to one with ordinary skills in the art, before the effective filing date of the claimed invention to have tried all published antisense oligonucleotides targeting exons 51 and 53, as taught by Sazani and van Ommen, and modified them according to Sazani, Kurreck and Mitsuoka. One with ordinary skills in the art, motivated in increasing and comparing the efficiency of modified oligonucleotides targeting these exons 51 and 53 in DMD gene, and producing a highly specific and efficient gene therapy medicament, could have modified the known oligonucleotides targeting these exons and performed a systematic screen. One motivated in targeting exons 51 and 53 of DMD gene to find an efficient gene therapy medicament, using already known oligonucleotide sequences as taught by van Ommen and Sazani, could have performed this screen and arrived at the claimed invention with a reasonable expectation of success.
Regarding claim 3, Sazani teaches 5-methylcytosines (see column 25, lines 16-23). Mitsuoka teaches cytosines that are all 5-methylcytosines (see title and abstract).
Therefore, it would have been obvious to one with ordinary skills in the art, before the effective filing date, to have tried all the known antisense oligonucleotides targeting exons 51 and 53, as taught by Sazani and van Ommen, and modified them according to Mitsuoka. One with ordinary skills in the art, motivated in increasing specificity and comparing the efficiency of modified oligonucleotides targeting these exons 51 and 53 in DMD gene, and producing highly specific and efficient gene therapy medicaments, could have modified the known oligonucleotides and incorporated 5-methylcytosines instead of cytosine in the oligonucleotides. One motivated in increasing specificity of nucleic acid recognition and stability, using already known oligonucleotide sequences
as taught by van Ommen and Sazani, could have performed this modification with a reasonable expectation of success and arrived at the claimed invention.
Regarding claims 6, 7, 8 and 9, van Ommen teaches full length locked nucleic acids (see [0167], [0170], [0188]).
Kurreck teaches Locked monomers at different positions; see Table 1:
PNG
media_image2.png
793
587
media_image2.png
Greyscale
Kurreck teaches best results for oligonucleotides with at least 4 locked nucleic acid monomers providing they are not located in the middle of the complementary sequence, since the ones located at 5’ and 3’ ends forming end-blocks lead to more stable oligonucleotides (see page 1913, right column, “Results” section, fourth paragraph). Kurreck teaches 2, 3, 4 or 5 locked monomers at each 5’ and 3’ end of the oligonucleotides (end blocks) (see Table 1 and above).
Therefore, it would have been obvious to one with ordinary skills in the art, before the effective filing date of the claimed invention, to have modified the antisense oligonucleotides taught by van Ommen and Sazani and substituted the 5’ and 3’ end residues with a locked nucleic acid monomer as taught by Kurreck. One with ordinary skills in the art, motivated in improving the stability and efficiency of the antisense oligonucleotides as medicaments for Duchenne Muscular Dystrophy, could have performed these modifications and screened for efficient exon skipping, with a reasonable expectation of success and would arrived at the claimed invention.
Regarding claim 12, Sazani teaches the unmodified sequence of SEQ ID NO: 4568 which correspond to the sequence claimed in claim 12.
Therefore, it would have been obvious to one with ordinary skills in the art, before the effective filing date of the claimed invention, to have modified the antisense oligonucleotides taught by Sazani and systematically substituted each residue with a locked nucleic acid (LNA) monomer as taught by Kurreck and obtained a series of antisense oligonucleotides with multiple LNA monomers at different positions. One with ordinary skills in the art, motivated in improving the stability and efficiency of the antisense oligonucleotides as medicaments for Duchenne Muscular Dystrophy, could have performed these modifications and screened for efficient exon skipping, as taught by van Ommen, Sazani, with a reasonable expectation of success and would arrived at the claimed invention.
Regarding claim 13, van Ommen teaches a pharmaceutical composition comprising the antisense oligonucleotide (see Abstract; see page 30, claims 24 and 39; see ). Sazani also teaches a composition and a pharmaceutically acceptable carrier (see column 27, lines 42-54; column 28, lines 45-67; and columns 29-34).
Therefore, it would have been obvious to one with ordinary skills in the art, before the effective filing date of the claimed invention, to have modified the antisense oligonucleotides taught by van Ommen and Sazani, modified by Kurreck and Mitsuoka, and formulated a composition comprising the nucleic acid molecule. One with ordinary skills in the art, motivated in providing a stable composition comprising the antisense oligonucleotides as medicaments for Duchenne Muscular Dystrophy, could have performed these modifications with a reasonable expectation of success and would arrived at the claimed invention.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1-3, and 6-13 are rejected on the ground of non-statutory double patenting as being unpatentable over claims 1, 5-11, 13 of U.S. Patent No.12,331,293 B2. Although the claims at issue are not identical, they are not patentably distinct from each other because:
Regarding instant claims 1, 2, 10, 11 and 12, USPAT.’293’s claim 1 is drawn to oligonucleotides with sequence of SEQ ID NO: 14 and SEQ ID NO: 198, which has the same sequences of instant SEQ ID NOs: 4568 and 456/4528 respectively. USPAT.’293 teaches a sequence identical to the sequence claimed in instant claim 12, i.e., SEQ ID NO: 14 of USPAT.’293, corresponding to instant claims 1, 2, 10 and 11’s SEQ ID NO: 4568.
Regarding instant claims 1 and 3, USPAT.’293’s claim 5 and 7 are drawn to a compound comprising a 5-methycytosine and/or a 5-methyluracil base.
Regarding instant claim 1, USPAT.’293’s claims 5 and 6 are drawn to a compound comprising phosphorothioate backbone.
Regarding instant claims 1 and 6-9, USPAT.’293’s claim 5 and 8-11 are drawn to compound comprising at least 1, 2, 3, or 4 BNA monomers, and 1, 2 , 3 or 4 LNA monomers at 5’ and/or 3’ end.
Regarding instant claim 13, USPAT.’293’s claim 13 is drawn to a composition comprising a compound according to claim 1 and a pharmaceutically acceptable carrier.
Claims 1, 2, 10-13 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 7, 15, 16, 23, 24 and 29 of copending Application No. 17/449,290 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because:
Regarding instant claims 1, 2, 10-12, claims 1 and 15 of co-pending App. ‘290 is drawn to an antisense oligonucleotide having the same base sequence of instant SEQ ID NO: 4568, also depicted in instant claim 12. See alignment below:
Title: US-17-449-290A-22333
Perfect score: 18
Sequence: 1 gguaaguucuguccaagc 18
Scoring table: IDENTITY_NUC
Gapop 10.0 , Gapext 1.0
Searched: 1 seqs, 18 residues
Total number of hits satisfying chosen parameters: 2
Minimum DB seq length: 0
Maximum DB seq length: inf
Post-processing: Minimum Match 0%
Maximum Match 100%
Listing first 50 summaries
Database : US-18-179-064-4568.fasta:*
SUMMARIES
%
Result Query
No. Score Match Length DB ID Description
----------------------------------------------------------------------------
1 18 100.0 18 1 US-18-179-064-4568 Oligomers Having B
c 2 4.4 24.4 18 1 US-18-179-064-4568 Oligomers Having B
ALIGNMENTS
RESULT 1
US-18-179-064-4568
Query Match 100.0%; Score 18; DB 1; Length 18;
Best Local Similarity 72.2%;
Matches 13; Conservative 5; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GGUAAGUUCUGUCCAAGC 18
||:|||::|:|:||||||
Db 1 GGTAAGTTCTGTCCAAGC 18
Regarding instant claim 1, copending App.’290’s claims 7 and 23 are drawn to a compound comprising phosphorothioate backbone.
Regarding instant claim 13, copending App.’290’s claims 16, 24 and 29 are drawn to a composition comprising a compound comprising the antisense oligonucleotide and a pharmaceutically acceptable carrier.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Conclusion
The prior art made of record and not relied upon is considered pertinent to applicant's disclosure:
Instant Application’s SEQ ID NO: 6087 is also found as SEQ ID NO: 29 in US Application No. 11/233,495, now patented as US Patent No. 9,896,687 (cited on IDS filed 07/25/2023).
Instant Application’s SEQ ID NO: 6087 is also found as SEQ ID NOs: 125, 126, 128, 129 and 162 in US Application No. 15/232,493, now patented as US Patent No. 10,179,912 (cited in IDS filed on 07/25/2023).
Instant Application’s SEQ ID NO: 6087 is also found as SEQ ID NOs: 225, 226 in US Application 14/214,567, now patented as US Patent No. 9,506,058.
Instant Application’s SEQ ID NO: 6087 is also found as SEQ ID NO:192 in US Application No. 11/570,691, now patented as US Patent No.7,807,816.
Instant Application’s SEQ ID NO: 6087 is also found as SEQ ID NO:29 in US Application No. 13/219,401, now patented as US Patent No.8,741,863.
This list of prior art is not exhaustive regarding some claimed sequences. Each of these references are considered to be cumulative to those applied in the rejections under 35 U.S.C. §103.
No claim is allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ALEXANDRA G DACE DENITO whose telephone number is (703)756-4752. The examiner can normally be reached Monday-Friday, 8:30-5:00EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/A.D./Examiner, Art Unit 1636
/NANCY J LEITH/Primary Examiner, Art Unit 1636