Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Applicant’s response and claim amendments filed on 7/6/2026 are received and entered.
In response to the most recent action, claims 1, 12, and 54 have been amended. Claims 26-31 and 33-50 have been withdrawn from consideration. No claims have been cancelled and no new claims have been added.
Claims 1-25, 32, and 51-54 are currently under examination.
Any rejections/objections NOT repeated/presented here are withdrawn.
New Objections
Specification
The disclosure is objected to because of the following informalities: Paragraph 0003, “Angleman” should be corrected to “Angelman”.
Appropriate correction is required.
Claim Objections
Claims 4-6, 12, and 18 is objected to because of the following informalities:
Regarding claims 4 and 6, applicant recites “the promotor” and “promoter”. “Promotor is misspelled”.
Regarding claim 12, “a RNA” should be “an RNA”.
Regarding claims 5 and 18, applicant recites “wherein neuron specific promoter…” which lacks “the” or an article before “neuron specific”.
Appropriate correction is required.
New Rejections
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1-25 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding claim 1, applicant recites “a polynucleotide sequence”. It is unclear if the claimed invention covers the DNA molecule or sequence information, rendering the metes and bounds unclear. In the event applicant intends to recite a “polynucleotide sequence”, a sequence is the order of nucleotides, or information describing the molecule. It is not itself a process, machine, manufacture, or composition of matter, wherein the claim, as drafted, reads on the information, not on the physical nucleic acid.
Applicant could amend claim 1 by removing “sequence” to recite “a polynucleotide comprising”.
Claim 17 recites the limitation " the promoter is a neuron specific promoter" in the first line. There is insufficient antecedent basis for this limitation in the claim as claim 17 depends on claim 14, and claim 14 depends on claim 12. Neither claim 12 or 14 makes a note of “a promoter”.
All claims dependent on 1, 12, and 17 have been rejected under 35 U.S.C. 112(b).
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 12, 14-17, 19-25, and 54 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Chamberlain et al. (WO 2020/061528, Published 3/26/2020).
Regarding claim 12, Chamberlain teaches a polynucleotide wherein the first nucleotide sequence encodes a shRNA that results in decreased expression of the UBE3A-ATS sequence SEQ ID NO: 1 (see paragraph 0025). Chamberlin further teaches SEQ ID NO: 191 with the sequence “GATATCACCTTACAGAAATTA” which has 100% sequence identity with SEQ ID NO: 3 of the instant application (shown below).
PNG
media_image1.png
231
651
media_image1.png
Greyscale
Regarding claim 14, Chamberlain teaches a novel treatment approach for Angelman Syndrome through gene therapy by inhibiting the silencing of paternal UBE3A and enabling the expression of paternal UBE3A from its native regulatory elements (see paragraph 0006).
Regarding claim 15, Chamberlain discloses where Fig. 4 shows shRNAs knockdown of UBE3A-ATS and activation of paternal UBE3A.
Regarding claim 16, Chamberlain teaches where the invention provides an expression vector comprising the polynucleotide and a promoter (see paragraph 0008).
Regarding claim 17, Chamberlain teaches where the selection of promoters can readily be accomplished. Suitable promoters can include animal transcriptional control regions, which exhibit tissue specificity and have been utilized in transgenic animals (see paragraph 0072). Chamberlain discloses the myelin basic protein gene control region which is active in oligodendrocyte cells in the brain (see paragraph 0072).
Regarding claim 19, Chamberlain teaches an example of a suitable promoter is an RNA polymerase II or III promoter, such as the U6 promoter (see paragraph 0072).
Regarding claim 20, Chamberlain teaches where a viral vector can be used in the invention (see paragraph 0071), and wherein the viral vector can be a lentiviral vector or an adeno-associated viral (AAV) vector (see paragraph 0059).
Regarding claim 21, Chamberlain teaches where AAVs may be readily selected from among any AAV serotype, including, without limitation, AAVs 1-10 (see paragraph 0086), or where the AAV serotype is AAV9 or AAV10 (see paragraph 0084).
Regarding claim 22, Chamberlain discloses where the expression vector of claim 14 (an expression vector comprising the polynucleotide of claim 1 and a promoter), wherein the polynucleotide is a DNA polynucleotide (see claim 16 of Chamberlain).
Regarding claim 23, Chamberlain teaches where the viral particles comprising the desired coding sequences for the shRNA can be formulated for administration to a patient or human in need by any means suitable for administration. Such formulation involves the use of a pharmaceutically and/or physiologically acceptable vehicle or carrier, particularly one suitable for administration to the brain (see paragraph 0089).
Regarding claim 24, Chamberlain teaches where the invention provides an expression vector comprising the polynucleotide having the first nucleotide sequence encoding the shRNA that is capable of inhibiting the silencing of paternal UBE3A (see paragraph 0008).
Regarding claim 25, Chamberlain teaches where the vector used is derived from adeno-associated virus (i.e., AAV vector) (see paragraph 0063).
Regarding claim 54, Chamberlain teaches a polynucleotide sequence where the first nucleotide sequence may be SEQ ID NO: 2. The first nucleotide sequence may also be a modified SEQ ID NO: 2 having the bold matches in SEQ ID NO: 2 replaced by any of SEQ ID NOs: 9-508 (see paragraph 0027). SEQ ID NO: 191 of Chamberlain and SEQ ID NO: 3 of the instant application have 100% identity. Furthermore, SEQ ID NO: 2 of Chamberlain discloses a stem-loop structure of SEQ ID NO: 2 consisting of 6 nucleotides ‘CTCGAG’ (see paragraph 0035). This stem-loop structure that is 6 nucleotides long has 100% identity with SEQ ID NO: 490 of the instant application.
Response to Arguments
Applicant’s arguments have been fully considered but are not found persuasive. Applicant argues that the Office Action repeatedly states : “SEQ ID NO: 503 of Chamberlain and EQ ID NO: 7 of the instant application has 100% identity” wherein the two sequences are different, therefore cannot constitute a 100% match. The factual premise underlying the anticipation rejection is erroneous and cannot support anticipation. Applicant further argues that the amendment of claims 12 and 54 recites the target sequences as SEQ ID NOs. 3, and 173-196, which are neither taught nor suggested by Chamberlain.
Examiner acknowledges the error regarding SEQ ID NO: 503 of Chamberlain and SEQ ID NO: 7 of the instant application, however, that argument is rendered moot in view of claim amendments. However, to address the issue, examiner correctly points to SEQ ID NO: 189 of Chamberlain, recited as “CTCAATCCAATAACCTAATTT”, which absent evidence to the contrary, has 100% identity with SEQ ID NO: 7 of the instant application. Furthermore, the statement that SEQ ID NO: 3 is not taught by Chamberlain is factually incorrect as Chamberlain teaches SEQ ID NO: 191 (GATATCACCTTACAGAAATTA) which has 100% identity to SEQ ID NO: 3 of the instant application, as shown above in the rejection.
In view of the foregoing, Chamberlain anticipates the presented limitations of claims 12, 14-17, 19, and 20-25.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 1-4, 6-11, 13, 32, and 53 are rejected under 35 U.S.C. 102(a)(1) as anticipated by or, in the alternative, under 35 U.S.C. 103 as obvious over Chamberlain et al. (WO 2020/061528, Published 3/26/2020).
Regarding claim 1, Chamberlain teaches SEQ ID NO: 191 which has the nucleotide sequence “GATATCACCTTACAGAAATTA”. Furthermore, Chamberlain teaches the generation of shRNAs which comprise of the specific 21-nucleotide sequence to be targeted and its reverse complement, separated by a loop sequence of “CTCGAG” with a 5’ flank sequence of CCGG and a 3’ flank sequence of TTTTTG added for cloning into the plasmid vector (see paragraph 0101).
Regarding claim 2 and 3, Chamberlain teaches where the invention provides an expression vector comprising the polynucleotide and a promoter (see paragraph 0008).
Regarding claim 4, Chamberlain teaches where the selection of promoters can readily be accomplished. Suitable promoters can include animal transcriptional control regions, which exhibit tissue specificity and have been utilized in transgenic animals (see paragraph 0072). Chamberlain discloses the myelin basic protein gene control region which is active in oligodendrocyte cells in the brain (see paragraph 0072).
Regarding claim 6, Chamberlain teaches an example of a suitable promoter is an RNA polymerase II or III promoter, such as the U6 promoter (see paragraph 0072).
Regarding claim 7, Chamberlain teaches where a viral vector can be used in the invention (see paragraph 0071), and wherein the viral vector can be a lentiviral vector or an adeno-associated viral (AAV) vector (see paragraph 0059).
Regarding claim 8, Chamberlain teaches where AAVs may be readily selected from among any AAV serotype, including, without limitation, AAVs 1-10 (see paragraph 0086), or where the AAV serotype is AAV9 or AAV10 (see paragraph 0084).
Regarding claim 9, Chamberlain teaches where the viral particles comprising the desired coding sequences for the shRNA can be formulated for administration to a patient or human in need by any means suitable for administration. Such formulation involves the use of a pharmaceutically and/or physiologically acceptable vehicle or carrier, particularly one suitable for administration to the brain (see paragraph 0089 and claim 22).
Regarding claim 10, Chamberlain teaches where the invention provides an expression vector comprising the polynucleotide having the first nucleotide sequence encoding the shRNA that is capable of inhibiting the silencing of paternal UBE3A (see paragraph 0008).
Regarding claim 11, Chamberlain teaches where the vector used is derived from adeno-associated virus (i.e., AAV vector) (see paragraph 0063).
Regarding claim 1, Chamberlain does not explicitly teach SEQ ID NO: 2 of the instant application.
It would have been obvious to one with ordinary skill in the art, before the effective filing date of the claimed invention, to modify the invention presented in Chamberlain, to arrive at a polynucleotide comprising SEQ ID NO: 2 of the instant application, wherein the polynucleotide is encompassed in a vector and a pharmaceutical composition.
One would expect a reasonable chance of success as Chamberlain teaches all the limitations of the recited claims such as the generation of shRNA, which comprises a 21-mer specific target sequence with its reverse complement separated by a loop sequence. While Chamberlain presents its own SEQ ID NO: 2, which is an shRNA targeting UBE3A-ATS (5’ TGCTCTTCTTTCTACTTTATTCTCGAGAATAAAGTAGAAAGAAGAGCA 3’) that does not relate to that of the instant application, Chamberlain teaches shRNA targeting UBE3A-ATS including SEQ ID NOs: 9-508 which includes SEQ ID NO: 191. SEQ ID NO: 191 of Chamberlain has 100% identity to the 21-mer target specific sequence of the instant SEQ ID NO: 2 (SEQ ID NO: 191 of Chamberlain is “GATATCACCTTACAGAAATTA”).
Therefore, simple substitution of known elements already taught by Chamberlain, such as substituting and using SEQ ID NO: 191 of Chamberlain with the loop sequence “CTCGAG” and the reverse complement of SEQ ID NO: 191, would yield predictable results, that is a polynucleotide with 100% identity to SEQ ID NO: 2 of the instant application. Furthermore, it would be “obvious to try” all sequences presented in Chamberlain (SEQ ID NOs: 9-508) in order to see which shRNA yielded enhanced UBE3A-ATS silencing. See MPEP § 2143 (I)(B) and (I)(E). In fact, Chamberlain explicitly teaches that the first and third (reverse complementary) nucleotide sequence may be replaced by any of SEQ ID NOs: 9-508 (see paragraph 0027).
One would be motivated to do so in order to generate a shRNA that silences UBE3A-ATS which allows for the paternal expression of the UBE3A gene for the treatment of Angelman Syndrome (see paragraph 0007).
In view of the foregoing, claims 1-4, 6-9, 13, 32, and 53 are rejected under 35 U.S.C. 102(a)(1) or 35 U.S.C. 103.
Response to Arguments
Applicant’s arguments have been fully considered but are not found persuasive. Applicant argues that Chamberlain does not teach, suggest, or provide motivation to modify the sequences disclosed therein into the specific sequences presently claimed. Furthermore, Bofill is a review article describing conventional shRNA design principles, however, it does not disclose Applicant’s target sequences, UBE3A-ATS target selection, activation of paternal UBE3A, and the treatment of Angelman syndrome. General design guidance cannot render Applicant’ particular sequences and the claims incorporating them obvious. Applicant discloses that merely recognizing the stem loop sequence is identical does nothing to suggest the present claimed flanking sequences. Applicant directs Examiner to Figs. 4 and 5 which disclose the unpredictable nature of shRNAs to reduce UBE3A-ATS and SNORD115 RNA levels while increasing UBE3A expression, and only shRNA2 (SEQ ID NO: 2) knocked down UBE3A-ATS and activated paternal UBE3A. Applicant further argues that Chamberlain teaches a large number of shRNA target sequence but only tests 5 sequences and nothing in Chamberlain would suggest that the Applicant’s specific successful sequences are preferred.
Furthermore, Applicant argues the Federal Circuit has repeatedly held that hindsight cannot substitute for evidence of obviousness.
In response to applicant's argument that the examiner's conclusion of obviousness is based upon improper hindsight reasoning, it must be recognized that any judgment on obviousness is in a sense necessarily a reconstruction based upon hindsight reasoning. But so long as it takes into account only knowledge which was within the level of ordinary skill at the time the claimed invention was made, and does not include knowledge gleaned only from the applicant's disclosure, such a reconstruction is proper. See In re McLaughlin, 443 F.2d 1392, 170 USPQ 209 (CCPA 1971).
In view of the new rejection, Chamberlain explicitly teaches a) shRNA targeting the UBE3A-ATS sequence for silencing UBE3A-ATS, b) the structure of a shRNA polynucleotide comprising a target sequence, the CTCGAG loop, and the reverse complement target sequence, and c) SEQ ID NO: 191 which is the 21-mer target sequence portion of SEQ ID NO: 2 in the instant application or 100% to SEQ ID NO: 3 of the instant application.
As the instant claims are directed to a composition, wherein all limitations of the composition is taught by Chamberlain, Examiner argues that Chamberlain anticipates SEQ ID NO: 2 of the instant application, wherein the function of silencing UBE3A-ATS is merely an inherent feature of the composition, see MPEP § 2112.01(I). Furthermore, with an anticipation rejection, Examiner does not need to provide an obvious or rationale to arrive at the instantly claimed inventions.
In an effort to be thorough, Examiner further argues that Chamberlin discloses a finite amount of sequences which can be substituted with the 21-mer target sequence presented in Chamberlin, which is SEQ ID NOs: 9-508. As this is a finite amount of sequences, it would have been obvious to a skill artisan to try all the sequences presented by substituting them into the shRNA polynucleotide, which would yield predictable results (see MPEP § 2143 (I)(B) and (E). In fact, Chamberlain explicitly discloses that substitution and testing of SEQ ID NOs: 9-508 is contemplated (see paragraph 0027).
In view of the foregoing, the rejection of claims 1-4, 6-11, 13, 32, and 53 is proper.
Claims 5 and 18 are rejected under 35 U.S.C. 103 as being unpatentable over Chamberlain et al. (WO 2020/061528 A1, Published 3/26/2020) in view of Nielsen et al. (Neuron-specific RNA interference using lentiviral vectors, The Journal of Gene Medicine, Volume 11, Issue 7, Pg. 559-569, 2009).
Regarding claims 5 and 18, Chamberlain teaches a polynucleotide comprising SEQ ID NO: 2 (recited in claim 1) or a polynucleotide encoding a shRNA comprising a nucleotide sequence that is at least 85% complementary to a RNA encoded by any of SEQ ID NOs: 3, 173-196 (recited in claim 12), wherein the polynucleotide can be inserted into an expression vector.
Chamberlain does not teach wherein the expression vector has a neuron specific promoter that is neuron-specific enolase (NSE), synapsin I (Syn), or Ca2+/CaM-activated protein kinase II alpha (CaMKIIalpha).
Nielsen teaches neuron-specific RNA interference using lentiviral vectors where pol II promoters have been used to construct vectors for RNA interference. Nielsen teaches that, traditionally, viral vectors have been ubiquitously-expressing polymerase III promoters such as H1 and U6 to drive the expression of shRNAs because of a strict requirement of precise transcriptional initiation and termination to ensure that the transcript obtained is efficiently processed into functional RNAi molecules (see introduction). Because a precisely defined transcriptional start site is not known for the majority of Pol II promoters, the usefulness of these promoters in such shRNA-designs may be limited. However, recently, shRNAs have been embedded into a micro-RNA context, thereby resembling the structure of naturally-occurring miRNA transcripts and, in this way, the endogenous miRNA processing machinery is used to obtain mature RNAi molecules, enabling the use of pol II promoters, including cell-specific promoters (see introduction).
Nielsen further teaches that with the use of a smiRNA vector with the neuron-specific enolase (NSE) promoter. Nielsen was able to express the smiRNA cassette in neurons only, and hence neuron-specific knockdown should be possible (see section ‘Neuron-specific knockdown’). When tested, Nielsen shows that the NSE promoter shown high neuronal specificity and is useful in reducing the off-target effects of AAV-mediated shRNA vectors, such as toxicity and cell death (see conclusion).
It would have been obvious to one of ordinary skill in the art, at the time of the invention, to combine the expression vector comprising a polynucleotide recited in Chamberlain with a neuron-specific promoter disclosed in Nielsen.
One would expect a reasonable expectation of success as Nielsen shows that they developed a lentiviral vector with a NSE promoter that exhibits a knockdown of neuronal gene expression, but remain fully normal in adjacent glial cells (see conclusion). As Chamberlain already discloses the use of an expression vector (AAV and lentiviral vector (see paragraph 0059 of Chamberlain)) comprising a shRNA polynucleotide and a promoter to target Angelman Syndrome neurons, and Nielsen teaches the use of a neuron-specific promoter NSE to inhibit a target in neurons, the use of a NSE promoter with the composition of Chamberlain is merely combining prior art elements according to known methods to yield predictable results (see MPEP § 2143 (I)(A)).
One would be motivated to do so in order to achieve greater or an improvement in the levels of target silencing in tissue-specific cells, specifically neurons. Nielsen explicitly discloses because a precisely defined transcriptional start site is not known for the majority of Pol II promoters, the usefulness of these promoters U6 and H1) in such shRNA-designs may be limited (see introduction).
In view of the foregoing, claims 5 and 18 are rejected under 35 U.S.C. 103 as being prima facie obvious before the effective filing date.
Response to Arguments
Applicant's arguments filed 7/6/2026 have been fully considered but they are not persuasive.
Applicant argues that the argument is on the disproven premise that Chamberlain and Bofill teach some embodiments of the claims as described above and that Nielsen is used tot each the use of neuron-specific promoters. Applicant does not dispute that neuron-specific promoters, including NSE, synapsin I (Syn), and CaMKIIa, were known for directing gene expression in neuronal cells. However, the existence of neuron-specific promoters does not render Applicant’s claimed subject matter obvious, which is a specific polynucleotide encoding shRNAs that target UBE3A-ATS to activate the paternal UBE3A expression for treatment of Angelman syndrome. The inventive contribution lies with the identification of particular shRNA sequences, not the routine selection of a promoter.
In light of the new rejection presented here, Examiner argues that Chamberlain explicitly teaches all the limitations of the claimed invention. As described above, Chamberlain teaches the structure of the polynucleotide and the loop sequence, and SEQ ID NO: 191, which has 100% identity to SEQ ID NO: 3 of the instant application. Substitution of SEQ ID NO: 191 with the shRNA presented in SEQ ID NO: 2 of Chamberlain would result in a polynucleotide with 100% sequence identity with SEQ ID NO: 2 of the instant application. Therefore, the inventive contribution has already been solved by the teachings of Chamberlain. As the Applicant admits, the use of neuron-specific promoters is well known and routine in the art, and the combination of the teachings of Chamberlain and Nielsen would render the claimed instant invention obvious with a predictable outcome, that being combining the prior art elements of tissue specific promoters in an expression vector.
Claims 51 and 52 are rejected under 35 U.S.C. 103 as being unpatentable over Chamberlain et al. (WO 2020/061528 A1, Published 3/26/2020) in view of Ge et al. (Minimal-length short hairpin RNAs: The relationship of structure and RNAi activity, RNA Society, Volume 16, Pg. 106-117, 2010).
Regarding claims 51, Chamberlain teaches a shRNA encoded by a portion of SEQ ID NO: 2 (SEQ ID NO: 3 of the instant application or SEQ ID NO: 191 of Chamberlain).
Regarding claim 52, Chamberlain teaches SEQ ID NO: 191 which is GATATCACCTTACAGAAATTA. The recited SEQ ID NO: 498 of the instant application is GATATCACCTTACAGAAATT (see paragraph 0047) which is 1 nucleotide sequence removed from SEQ ID NO: 191 of Chamberlain.
Chamberlain does not teach a shRNA encoded by a portion of SEQ ID NO: 2, wherein the portion of SEQ ID NO: 2 defined by bold nucleotides is shortened by one, two, three, or four nucleotides of either end of the first segment, and wherein the second segment defined by italicized nucleotides is shortened by one, two, or three nucleotides at either end of the italicized nucleotide.
Regarding claim 51 and 52, Ge teaches where shRNAs typically consist of a stem of 19-29 base pairs and a loop of at least 4 nucleotides, however, shRNAs with 19-bp or shorter stems (sshRNAs) possess some unique structure-activity features that depend on whether the antisense strand is positioned 5’ or 3’ to the loop. Ge teaches where a series of active L sshRNAs have been identified with a stem length of 19 bp or less and a minimal loop (see discussion section). Ge further discloses where the finding that highly potent shRNAs can be designed with short stems and very small or no added loops suggest considerable flexibility on the part of the RNAi machinery, and is encouraging for the development of shRNA therapeutics where high potency is critical and small size is important to keep the cost of manufacture manageable (see discussion section).
It would have been obvious to one of ordinary skill in the art, at the time of the invention, to combine the teachings of Chamberlain with the teachings of Ge to arrive at an shRNA encoded by a portion of SEQ ID NO: 2 that is shortened by one to four nucleotides
One would expect a reasonable chance of success as Ge teaches how shRNA stem length can be shortened sub 19 nucleotides, which would account for SEQ ID NO: 191 of Chamberlain being shortened by 1-4 nucleotides at either end of the bold first segment and italicized second segment and identifies shortened shRNAs can still maintain high potency. As Ge is directed to improving shRNA RNAi flexibility for high potency, the shortening of the shRNA sequence is merely applying a known technique to improve similar devices (methods or product) in the same way, which would yield predictable results (See MPEP § 2143 (I)(C).
One would be motivated to do so as Ge teaches that highly potent and flexible, shortened shRNAs are encouraging for shRNA therapeutics where the small size is important to keep the cost of manufacture manageable.
In view of the foregoing, claims 51 and 52 are rejected under 35 U.S.C. 103 as being prima facie obvious before the effective filing date.
Response to Arguments
Applicant's arguments filed on 7/6/2026 have been fully considered but they are not persuasive.
Applicant argues that the teachings of Ge does not cure the deficiencies of Chamberlain, Bofill, and Bi as the rejection is disproven by the premise that Chamberlain and Bofill combined does not teach the shRNA encoded by SEQ ID NO: 2, as described above. Furthermore, applicant argues that Ge does not recite the use of shRNA for targeting UBE3A-ATS, and merely describes a general concept of modifying the stem length where arriving at such reasoning would be impermissible hindsight as nothing in the art would have directed a person of ordinary skill to Applicant’s specific sequence.
In response to applicant's argument that the examiner's conclusion of obviousness is based upon improper hindsight reasoning, it must be recognized that any judgment on obviousness is in a sense necessarily a reconstruction based upon hindsight reasoning. But so long as it takes into account only knowledge which was within the level of ordinary skill at the time the claimed invention was made, and does not include knowledge gleaned only from the applicant's disclosure, such a reconstruction is proper. See In re McLaughlin, 443 F.2d 1392, 170 USPQ 209 (CCPA 1971).
Furthermore, in light of the new rejection presented above, Examiner argues that Chamberlain alone teaches all the limitations of SEQ ID NO: 2 in its entirety where it anticipates the invention or it would have been obvious to one skilled in the art through simple substitution of known elements presented in Chamberlain to arrive at the instantly claimed invention of SEQ ID NO: 2 (see above). As Chamberlain alone cures the deficiencies recited by the applicant, the addition of Ge would have been the application of a known technique for the improvement of a similar device (see MPEP § 2143 (I)(C). Ge broadly recites improving shRNA, regardless of the target, wherein the instant invention is still drawn to a shRNA for targeted silencing. Absent evidence to the contrary, applying the teachings of Ge would have been predictable to a skilled artisan looking to improve the teachings of Chamberlain as improving shRNA design was well known since 2010.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to DAVID YU whose telephone number is (571)272-1118. The examiner can normally be reached Monday-Friday 7:30 am -5 pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at 571-272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/D.T.Y./Examiner, Art Unit 1635
/RAM R SHUKLA/Supervisory Patent Examiner, Art Unit 1635
Prosecution Insights