DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Preliminary Amendment
The preliminary amendment dated 05/16/2023 has been entered. Claims 187-198 are pending and under examination.
Priority
Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. The earliest possible effective filing date for the instant claims is May 12, 2017 based on the filing date of the provisional application 62/505,649
Objections
Specification
The disclosure is objected to because of the following informalities:
Example 25 on page 204 should be Example 20.
The use of the term(s), e.g., 2x Kapa HiFi Hotstart Mastermix which are a trade name or a mark used in commerce, has been noted in this application. The terms should be accompanied by the generic terminology; furthermore, the terms should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM, and/or ® following the term.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks. Note that ‘2x Kapa HiFi Hotstart Mastermix’ is merely an example and all improper uses of trademarks in the specification should be identified by applicant and properly addressed.
Appropriate correction is required.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
1. Claims 196-198 are rejected under 35 U.S.C. 101 because the claims recite “nature-based products” as a limiting element or step without having markedly different characteristics than the nature-based product itself. The claimed inventions are directed to a judicial exception without significantly more. This judicial exception is not integrated into a practical application because, a partial DNA sequence is not markedly different from its naturally occurring counterpart because it conveys the same genetic information and the claims do not include additional elements that are sufficient to amount to significantly more than the judicial exception for the reasons set forth below. See MPEP § 2106 for patent subject matter eligibility analysis.
A claim that focuses on use of a natural product must also include additional elements or steps to show that the inventor has practically applied, and added something significant to, the natural product itself. See Mayo, 101 USPQ2d at 1966. Patents cannot be obtained on subject matter identified by the courts as being exempted from eligibility (i.e., laws of nature, natural phenomenon, and abstract ideas).
The recent Interim Eligibility Guidance addresses the subject matter eligibility analysis for all claims (i.e., machine, composition of matter, manufacture and process claims). The analysis is to be used for evaluating whether a claim is drawn to patent-eligible subject matter.
Step 1 determines whether the claim is directed to a process, machine, manufacture, or composition of matter. If the claim is directed to a statutory category, proceed to Step 2.
Step 2 is the two-part analysis from Alice Corp. (also called the Mayo test) for claims directed to laws of nature, natural phenomena, and abstract ideas (the judicially recognized exceptions).
In Step 2A, determine whether the claim is directed to a law of nature, a natural phenomenon, or an abstract idea (judicial exceptions) – Prong 1. “Directed to” means the exception is recited in the claim, i.e., the claim sets forth or describes the exception. If yes, determine if the claim recite additional elements that integrate the judicial exception into a practical application – Prong 2. If no, proceed to step 2B.
In Step 2B determine whether the claim as a whole amounts to significantly more than the exception.
Claim 196 is drawn to a kit for detecting integration of a nucleic acid encoding a CAR into a TRAC locus, comprising: (i) a DNA polymerase, (ii) a forward primer comprising AGAAGGATAAGATGGCGGAGG (SEQ ID NO: 1554) and (iii) a reverse primer comprising GCTTTCTGGCGTCCTTAGAA (SEQ ID NO: 1555).
Claim 197 is drawn to the kit further comprising a probe comprising (iv) TCTACCCTCTCATGGCCTAGAAGG (SEQ ID NO: 1556).
Claim 198 is drawn to the kit further comprising:( v) a control forward primer comprising TGGAGTGATTAGGAACATGAGCT (SEQ ID NO: 1557), (vi) a control reverse primer comprising the nucleotide sequence of AAGCTCAAGCACTTCTAGTTAGAAAC (SEQ ID NO: 1558), and (vii) a control probe comprising ATTCCACCCCACCTTCACTAAG (SEQ ID NO: 1559).
Claims are directed to a process, machine, manufacture, or composition of matter. (Step 1- YES).
Claims 196-198 recite primer or probe sequences that are found in nature. In Association for Molecular Pathology v. Myriad Genetics Corp. See 133 S.Ct. 2107, 2120 (2013); (Previous Federal Circuit cases: 689 F.3d 1303 (Fed.Cir. 2012); 653 F.3d 1329 (Fed. Cir. 2011), the Supreme Court ruled that a naturally occurring DNA segment is not patent-eligible merely because it has been isolated from the rest of the genetic material. The Court's reasoning was that isolating a segment of DNA does not create something new; it simply discovers something that already exists in nature. Isolated, naturally occurring DNA is therefore a "product of nature," which is a long-held exception to patent eligibility. The Federal Circuit court, which handles U.S. patent appeals, later applied the Supreme Court's reasoning directly to PCR primers, even though primers are synthetically manufactured (in re BRCA1- and BRCA2-
Based Hereditary Cancer Test Patent Litigation, No. 2014-1361, -1366, December 17, 2014). The Court held that the claimed primers are structurally identical to DNA strands found in nature and, therefore, are not distinguishable from the isolated DNA found patent ineligible under Myriad. Id. at 7-8.
As such, claims196-198 recite judicial exceptions in the form of a natural phenomenon (product of nature) (Step 2A, Prong 1- YES). See some sequence alignments examples below (Figure 1).
The core of the claims is partial DNA sequences but the instant claims do not recite any additional elements that integrate this judicial exception into a practical application. Rather, the instant claims merely recite natural product that are partial DNA sequences. As such, the instant claims do not recite additional elements that integrate the judicial exception into a practical application (Step 2A, Prong 2- NO).
The claimed partial nucleotide sequences are naturally occurring sequences as demonstrated in Figure 1 and do not reasonably provide an inventive concept or recite any elements beyond the judicial exceptions themselves. As such, the instant claims do not recite any additional elements that amount to significantly more than the judicial exception (Step 2B- NO).
Accordingly, claims 196-198 do not constitute patent eligible subject matter under 35 U.S.C. § 101.
FIGURE 1: SEQUENCE ALIGNMENT EXAMPLES:
SEQ ID NO: 1555: GCTTTCTGGCGTCCTTAGAA reverse primer
Reverse sequence: TTCTAAGGACGCCAGAAAGC binds to GenBank sequence coding the TRAC gene (nucleotide positions 1077-1096). https://www.ncbi.nlm.nih.gov/nuccore/NC_000014.9?report=genbank&from=22547506&to=22552132 Nature 441 (7091), 315-321 (2006).
PNG
media_image1.png
569
1180
media_image1.png
Greyscale
PNG
media_image2.png
148
935
media_image2.png
Greyscale
SEQ ID NO: 1556: TCTACCCTCTCATGGCCTAGAAGG probe
Reverse sequence: CCTTCTAGGCCATGAGAGGGTAGA binds to GenBank sequence coding the TRAC gene (nucleotide positions 1048-1071). https://www.ncbi.nlm.nih.gov/nuccore/NC_000014.9?report=genbank&from=22547506&to=22552132 Nature 441 (7091), 315-321 (2006)
PNG
media_image3.png
100
891
media_image3.png
Greyscale
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary.
Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 187-194 and 196-198 are rejected under 35 U.S.C. 103 as being unpatentable over MacLeod (Mol Ther. 2017 Feb 23;25(4):949–96, cited in 05/16/2023 IDS, Other Art line 5 ) in view of Ye (BMC Bioinformatics 2012, 13:134)
MacLeod teaches the Integration of a CD19 CAR into the TCR Alpha Constant (TRAC) Locus (title, entire article), (instant claim 187). To confirm site-specific integration (as required by instant claim 187), PCR primers were designed to amplify products spanning the homology arms on the 5’ and 3’ sides of the CAR transgene so that PCR products could only be generated by properly targeted integration events (Targeted Insertion of an Anti-CD19 CAR Transgene into the TRAC Locus section, page 952, figure 3B), (instant claim 187 (c)), and the PCR reactions were performed containing 200 mM dNTP mix, Q5 reaction buffer, Q5 high GC enhancer, 0.5 mM of each primer, and Q5 hot start high-fidelity DNA polymerase (instant claim 187 (a) and (b)). Both primer sets used the same PCR conditions as follows (instant claim 189): 980C for 4 min for initial denaturation (i), 30 cycles at 980C for 10, 650C for 20 s, 720C for 1:35 min. (ii), and then a final elongation at 720C for 5 min (iii), (CAR Insertion PCR section, page 959). In addition, MacLeod teaches the use of probes to detect the CAR transgene inserted in TRAC and another probe to detect FXN (an unrelated gene used as control) and serve as a reference standard for genomic DNA (figure 4), as required in instant claims 188. MacLeod also developed a digital droplet assay (ddPCR) (Figure 4A, first column, third paragraph, page 952). This assay includes the PCR primer sets and a second set that amplifies an unrelated gene sequence (in the FXN gene) and serves as a control sequence (instant claims 191 and 193). Digital PCR was performed on a QX200 droplet digital PCR system (instant claim 192 and 193) with 50 ng of purified genomic DNA combined with ddPCR Supermix for Probes (that is, the probes are contained in the PCR mixture), (instant claim 190 and 192) and 900 nM of each primer (Digital PCR section, page 959). Samples were partitioned into droplets using a QX200 droplet generator, PCR was performed on a C1000 Touch thermal cycler and droplets were analyzed individually on a QX200 droplet reader (Digital PCR section, page 959), (instant claims 192 and 193). The method developed by MacLeod also consists of isolating and activating T cells from a healthy donor (Abstract, Discussion, first paragraph and second paragraph, page 956), (instant claim 194)
MacLeod does not teach the specific sequences; SEQ ID NOs: 1554-1559
Ye teaches what Primer-BLAST is, its capabilities and how to use it: Primer blast is a tool to design target-specific primers for polymerase chain reaction (title). It is a software tool called to alleviate the difficulty in designing target-specific primers. This tool combines BLAST with a global alignment algorithm to ensure a full primer-target alignment and is sensitive enough to detect targets that have a significant number of mismatches to primers. Primer-BLAST allows users to design new target-specific primers in one step as well as to check the specificity of pre-existing primers (entire article).
It would be obvious to one of ordinary skill in the art to combine the teachings of MacLeod (a PCR method for detecting the integration of a nucleic acid encoding a CAR into a TRAC locus) with Ye to find different nucleic acid primers, probes and control sequences for the detection of the specific integration event. One of ordinary skill in the art would have been motivated to do so because MacLeod already teaches the primers, probes and control sequences to detect such integration event and using tools like Primer BLAST are useful to find different sequences that the ones taught by MacLeod but that would have the same function (detection of the specific integration event). There would be a reasonable probability of success because Primer Blast has been specifically developed for the purpose of primer optimization and are known to make the process of designing highly specific primers very simple and effective. It would further be obvious to select primer pairs (forward and reverse primers), probes and controls using this type of tools as recited in claims 187-188, 191 and 196-198.
It would be further obvious to optimize the PCR conditions (primer set and probe concentrations, cycle numbers, denaturalization, annealing and elongation steps times and temperatures, etc.) to the particular commercial PCR kit that is being used and to optimize it based on the primers, probes and control sequences employed. Optimization of parameters in a PCR method is a routine practice that would be obvious for a person of ordinary skill in the art to employ. It would have been customary for an artisan of ordinary skill to determine the optimal amount of each ingredient needed to achieve the desired results. The principle of law states from MPEP 2144.05: "The normal desire of scientists or artisans to improve upon what is already generally known provides the motivation to determine where in a disclosed set of percentage ranges is the optimum combination of percentages." (Peterson, 315 F.3d at 1330, 65 USPQ2d at 1382); Generally, differences in concentration or temperature will not support the patentability of subject matter encompassed by the prior art unless there is evidence indicating such concentration or temperature is critical. "[W]here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation." In re Aller, 220 F.2d 454, 456, 105 USPQ 2.
It would further be obvious to one of ordinary skill in the art to combine the teachings of MacLeod and Ye as described above to design a kit to detect the specific integration event, wherein the kit contains the primer, probes and control sets mixture as required in claims 196-198. The artisan would have been motivated to do so because these are the reagents needed to run a PCR reaction to detect the specific integration event. There would have been a reasonable expectation of success because there are many similar type of commercial PCR kits for the various types of PCR that are carried out in molecular biology laboratories worldwide.
From the combined teachings of the references, it is apparent that one of ordinary skill in the art would have had a reasonable expectation of success in producing the claimed invention. Therefore, the invention as a whole was prima facie obvious to one of ordinary skill in the art at the time the invention was made, as evidenced by the references, especially in the absence of evidence to the contrary.
Claims 187 and 195 are rejected under 35 U.S.C. 103 as being unpatentable over MacLeod in view of Ye and Ren (Clin Cancer Res. 2017 May 01; 23(9): 2255–2266, e-Pub Nov 4, 2016, cited in 05/16/2023 IDS, Other Art line 11).
The teachings of MacLeod and Ye have been discussed above and incorporated herein.
MacLeod and Ye do not teach the T cells having a disrupted B2M gene as required by instant claim 195.
Ren teaches multiplex genome editing to generate universal CAR T cells resistant to PD1 inhibition (title, entire article). Ren teaches that B2M is essential for the assembly and expression of HLA-I complex and disrupting the B2M gene will eliminate HLA-I expression in the T cells and thus sharply reduce the alloreactivity (TCR and B2M double disruption was developed to generate gene-disrupted T cells section, page 8). In addition, Ren teaches methods how to disrupt B2M using CRISPR/gRNAs (Generation of gene-disrupted and PD1 deficient CART cells section, page 4). Therefore, Ren teaches T cells comprising a disrupted B2M gene as required by instant claim 195.
It would be obvious to one of ordinary skill in the art to combine the teachings of MacLeod and Ye as described above and Ren to obtain genomic DNA from T cells (with or without a disrupted B2M gene) to be introduced with the CAR DNA and run a PCR reaction to detect the integration. The artisan would have been motivated to do so because a disrupted B2M gene can provide some advantages to the CAR T cells, including but not limited to reduced alloreactivity. There would have been a reasonable expectation of success because the CAR T cells developed by Ren have shown to have a disruption in the B2M gene .
From the combined teachings of the references, it is apparent that one of ordinary skill in the art would have had a reasonable expectation of success in producing the claimed invention. Therefore, the invention as a whole was prima facie obvious to one of ordinary skill in the art at the time the invention was made, as evidenced by the references, especially in the absence of evidence to the contrary.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to IMMA BARRERA whose telephone number is (571) 272-0674. The examiner can normally be reached Monday - Friday 9 to 5.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Janet Andres can be reached on (571) 272-0867. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/IMMA BARRERA/
Examiner, Art Unit 1671
/JANET L ANDRES/Supervisory Patent Examiner, Art Unit 1671