Prosecution Insights
Last updated: April 19, 2026
Application No. 18/181,311

RNAi Agents for Inhibiting Expression of DUX4, Compositions Thereof, And Methods of Use

Non-Final OA §102§103§112§DP
Filed
Mar 09, 2023
Examiner
SULLIVAN, STEPHANIE LAUREN
Art Unit
1635
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Arrowhead Pharmaceuticals, Inc.
OA Round
1 (Non-Final)
62%
Grant Probability
Moderate
1-2
OA Rounds
3y 6m
To Grant
98%
With Interview

Examiner Intelligence

Grants 62% of resolved cases
62%
Career Allow Rate
38 granted / 61 resolved
+2.3% vs TC avg
Strong +36% interview lift
Without
With
+35.7%
Interview Lift
resolved cases with interview
Typical timeline
3y 6m
Avg Prosecution
58 currently pending
Career history
119
Total Applications
across all art units

Statute-Specific Performance

§101
5.7%
-34.3% vs TC avg
§103
32.4%
-7.6% vs TC avg
§102
15.1%
-24.9% vs TC avg
§112
30.8%
-9.2% vs TC avg
Black line = Tech Center average estimate • Based on career data from 61 resolved cases

Office Action

§102 §103 §112 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Nucleotide and/or Amino Acid Sequence Disclosures REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES Items 1) and 2) provide general guidance related to requirements for sequence disclosures. 37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted: In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying: the name of the ASCII text file; ii) the date of creation; and iii) the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying: the name of the ASCII text file; the date of creation; and the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended). When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical. Specific deficiencies and the required response to this Office Action are as follows: Specific deficiency – Nucleotide and/or amino acid sequences appearing in the drawings are not identified by sequence identifiers in accordance with 37 CFR 1.821(d). Sequence identifiers for nucleotide and/or amino acid sequences must appear either in the drawings or in the Brief Description of the Drawings. See FIG. 15A-15I which show nucleotide sequences of the Duplexes and which are not identified by sequence identifiers in the drawings or in the Brief Description of the Drawings. Required response – Applicant must provide: Replacement and annotated drawings in accordance with 37 CFR 1.121(d) inserting the required sequence identifiers; AND/OR A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers into the Brief Description of the Drawings, consisting of: A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version); A copy of the amended specification without markings (clean version); and A statement that the substitute specification contains no new matter. Election/Restrictions Applicant’s election without traverse of Group I (claims 1,2,5,7-9,31,38,40,60 and 61) in the reply filed on 12/17/2025 is acknowledged. Claims 11-13,15,16,18,20,41,46 and 57-59 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 12/17/2025. Applicant’s election without traverse of the species of SEQ ID NO: 99 as the antisense strand sequence and SEQ ID NO: 147 as the sense strand sequence in the reply filed on 12/17/2025 is acknowledged. Claims 1,5,7-9,31,38,40,60 and 61 are under examination. Priority This application is a CON of PCT/US21/49871, filed 09/10/2021 which claims benefit of 63/077,272, filed 09/11/2020 and claims benefit of 63/214,742, filed 06/24/2021 as reflected by the most recent filing receipt. Claim Objections Claims 60 and 61 are objected to because of the following informalities: The chemical structures shown in claims 60 and 61 are not clear. The bonds are not clear, and the number in the first circle in claims 60 and 61 cannot be determined. It is noted that the structures shown in Fig. 16A-E, Fig. 17A-E, for example are clear and legible, and that the structures in the claims should look as clear as the figures. Appropriate correction is required. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 31,38,40,60 and 61 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 31 on page 19 recites the structure of the PK/PD modulator as “LP 29b” and includes an “Rz” group as part of the LP 29b compound but claim 31, nor the claims upon which it depends (Claims 1 and 8), define what “Rz” is. The claims are therefore indefinite, as it cannot be determined what is encompassed by “Rz”. Claim 31 additionally shows the structure of the second linker, C6-S, as well as text reciting “linkage towards 5’ end of oligonucleotide” and “linkage towards 3’ end of oligonucleotide”. The location of this text between the LP 29b compound and the second linker makes it unclear which of the molecules the text is pertaining to. Claims 38 and 40 depend from claim 31 and are included in the rejection as they do not correct the issue. Claims 60 and 61 recite chemical structures of the RNAi agent, and include circles with numbers in the circles, but neither the claims nor the specification explains what the numbers means in the circles. Therefore, claims 60 and 61 are indefinite, as it is not clear what is meant by the circles and numbers in the circles. Claim Interpretation Regarding the limitation in claim 1, “wherein the nucleotides comprise a modified nucleotide”, the examiner is interpreting this to mean that at least one nucleotide of the RNAi agent is a modified nucleotide. Regarding “substantially all” in claims 5 and 7, the instant specification discloses in paragraph [0122], In some embodiments, all or substantially all of the nucleotides of an RNAi agent are modified nucleotides. As used herein, an RNAi agent wherein substantially all of the nucleotides present are modified nucleotides is an RNAi agent having four or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides in both the sense strand and the antisense strand being ribonucleotides (i.e., unmodified). Therefore, these claims will be interpreted as “substantially” all as being 4 or less unmodified nucleotides in both the sense and antisense strands. Claim Rejections - 35 USC § 102 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claims 1,8 and 9 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Bradley et al. (WO 2020028134, Published 06 Feb 2020), cited on an IDS. Regarding claims 1,8 and 9, Bradley et al. teach a DUX4 nucleic acid inhibitor comprising a double-stranded siRNA wherein the sense strand of the double-stranded siRNA comprises a nucleic acid sequence at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% (or any derivable range therein) complementary to the antisense strand of the double-stranded siRNA (paragraph 0099). Bradley et al. teach an siRNA comprising the nucleic acid sequence of SEQ ID NO: 68: CAGGATTCAGATCTGGTTTCA (paragraph 0103). SEQ ID NO: 68 of Bradley (Db) is 100% identical to the sense strand sequence of instant SEQ ID NO: 181 (Qy) of claim 9, see below: PNG media_image1.png 150 513 media_image1.png Greyscale Therefore, as Bradley et al. teach an siRNA comprising the sequence of SEQ ID NO: 68 as being 100% identical to the instant sense strand sequence of SEQ ID NO: 181, Bradley et al. also teach the corresponding antisense sequence. SEQ ID NO: 68 (Db) is 100% complementary to instant SEQ ID NO: 162 (Qy): PNG media_image2.png 120 460 media_image2.png Greyscale Bradley et al. teach wherein the sense strand of the double-stranded siRNA comprises at least, at most, or exactly 1-25 modified nucleosides, and in some embodiments, each nucleoside of the sense strand comprises a modified nucleoside, (paragraph 0100). Therefore, an ordinary artisan could envision the siRNA comprising SEQ ID NO: 68 as comprising at least one nucleotide, and Bradley et al. anticipates claims 1,8 and 9. Claim 1 is rejected under 35 U.S.C. 102(a)(2) as being anticipated by Daugherty et al. (WO 2022051332, effectively filed 01 Sept 2020), cited on an IDS. Regarding claim 1, Daugherty et al. recites a double-stranded small interfering RNA (siRNA) comprising a sense strand and an antisense strand, wherein the antisense strand of the double-stranded siRNA comprises a nucleobase sequence of at least 12 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NOs:…446, and wherein the double-stranded siRNA comprises at least one modified nucleoside (claims 1 and 2). Daugherty et al. teach the sense strand of the dsRNA comprises a nucleobase sequence at least 85%, 90%,95% or 100% complementary to the antisense strand of the ds siRNA (paragraph 0016). Table 1, page 30 of Daugherty et al. shows double-stranded siRNA targeting human DUX4, and the antisense strand of SEQ ID NO: 446 and the corresponding sense strand of SEQ ID NO: 445 PNG media_image3.png 18 628 media_image3.png Greyscale As shown in the alignment below the antisense strand of SEQ ID NO: 446 of Daugherty et al. (Db) is 100% identical to the antisense strand comprising instant SEQ ID NO: 10 (Qy): PNG media_image4.png 171 513 media_image4.png Greyscale Therefore, Daugherty et al. anticipates claim 1. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 5 and 7 are rejected under 35 U.S.C. 103 as being unpatentable over Bradley et al. (WO 2020028134, Published 06 Feb 2020) as applied to claims 1,8 and 9 above and further in view of Hu et al. (Signal Transduction and Targeted Therapy, 19 June 2020, 5:101), cited on an IDS. The teachings of Bradley et al. as applied to claims 1,8 and 9 has been described above. Bradley et al. teach wherein the sense strand of the double-stranded siRNA comprises at least, at most, or exactly 1-25 modified nucleosides, and in some embodiments, each nucleoside of the sense strand comprises a modified nucleoside, and is selected from a 2’-F modified nucleoside or a 2’-OMe modified nucleoside (paragraph 0100). Bradley et al. does not explicitly teach wherein all or substantially all of the nucleotides are modified nucleotides, or wherein all or substantially all of the modified nucleotides are 2’-O-methyl nucleotides, 2’-fluoro nucleotides or combinations thereof. Before the effective filing date, Hu et al. taught to maximize potency and reduce or avoid the side effects of siRNA, researchers have made great efforts to investigate various chemical modification geometries, and a series of modification patterns have been proposed and evaluated with respect to effects on activity, stability, specificity and biosafety (page 2, left column). Hu et al. taught chemically modified siRNAs with substitution of the 2’-OH with a 2’-O-methyl group or 2’-methoxyethyl group can efficiently suppress immunostimulatory siRNA-driven innate immune activity, enhance activity and specificity and reduce off-target-induced toxicity, and to enhance potency and reduce potential toxicity of siRNA, numerous chemical modification geometries have been established and tested (page 2, right column). Hu et al. taught the combination of 2’-OMe and 2’-F has been used for ONPATTRO (Figs. 2,3 and page 4, left column). Hu et al. taught various chemical modification designs for siRNA, including siRNAs with all or substantially all nucleotides being 2’-F or 2’-OMe in Figure 3 shown below. PNG media_image5.png 898 798 media_image5.png Greyscale Hu et al. teach the standard template chemistry (STC) design has proven to remarkably enhance siRNA stability and affinity without compromising intrinsic RNAi activity (pages 6-7). Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date, to have provided any of the double-stranded siRNA’s of Bradley et al. wherein all of the nucleotides in the siRNA are modified and wherein the modifications are a combination of 2’F and 2’OMe sugar modification with a reasonable expectation of success because Bradley et al. suggests 2’F and 2’-OMe sugar modifications, and this would amount to applying a known technique of chemical modification to a known product (siRNA), ready for improvement to yield predictable results. One of ordinary skill in the art would have been motivated to do so because Bradley et al. suggest 2’-F and 2’-OMe sugar modifications and Hu et al. teach the benefits of 2’-OMe sugar modifications efficiently suppress immunostimulatory siRNA-driven innate immune activity, enhance activity and specificity and reduce off-target-induced toxicity, and enhance potency and reduce potential toxicity of siRNA and that 2’-OMe and 2’-F modifications for siRNAs including that the standard template chemistry (STC) design has proven to remarkably enhance siRNA stability and affinity without compromising intrinsic RNAi activity (pages 6-7) and teach the design of many siRNAs having all or substantially all of the nucleotides as 2’-OMe or 2’-F nucleotides as shown in Figure 3, and would make obvious the limitations of claims 5 and 7. Therefore, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art before the effective filing date. Claims 5 and 7 are rejected under 35 U.S.C. 103 as being unpatentable over Daugherty et al. (WO 2022051332, effectively filed 01 Sept 2020), as applied to claim 1 above. The teachings of Daugherty et al. as applied to claim 1 has been described above. Daugherty et al. does not explicitly teach wherein all or substantially all of the nucleotides are modified nucleotides, or wherein all or substantially all of the modified nucleotides are 2’-O-methyl nucleotides, 2’-Fluoro nucleotides or combinations thereof in the double-stranded siRNA targeting human DUX4 comprising the antisense strand of SEQ ID NO: 446. However, as stated above, claims 1 and 2 of Daugherty et al. recite a double-stranded siRNA comprising at least one modified nucleotide, and teaches embodiments wherein each nucleoside of the sense strand comprises a modified nucleoside, and the modified nucleoside comprises a 2’-F modified sugar and/or a 2’-OMe modified sugar (paragraphs 0020,0021), and that the double-stranded siRNA of the invention may comprise one or more (e.g., two, three, four, five, or more) modified nucleic acid monomers (paragraph 0075), including 2’-OMe and 2’F (paragraph 0076). Daugherty et al. teach siRNAs with chemically modified sense and antisense strand sequences in Table 5 (page-46) which are fully modified (See the last three siRNAs, UGNX1985-Full, UGNX2130-Full and UGNX2206-Full in Table 5 which are fully modified with 2’F and 2’OMe sugar modifications). Table 6 shows these compounds were highly stable and potent. Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date, to have provided any of the double-stranded siRNA’s of Daugherty et al. wherein all of the nucleotides in the siRNA are modified and wherein the modifications are a combination of 2’F and 2’OMe sugar modification with a reasonable expectation of success because Daugherty et al. teach wherein each nucleoside of the sense strand comprises a modified nucleoside including 2’-F and/or 2’-OMe modified sugars, and wherein the siRNA of the invention may comprise one or more modified nucleic acid monomers. One of ordinary skill in the art would have been motivated to provide the siRNA comprising the antisense strand of SEQ ID NO: 446 of Daugherty et al. with all chemically modified nucleotides, and wherein the modified nucleotides are 2’-O-methyl or 2’-fluoro nucleotides because Daugherty et al. teach fully modified siRNA’s which had high potency and stability, and would make obvious the limitations of claims 5 and 7. Therefore, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art before the effective filing date. Claims 8 and 9 are rejected under 35 U.S.C. 103 as being unpatentable over Daugherty et al. as applied to claim 1 above, and further in view of NCBI Reference Sequence ID NM_001306068 (Publicly available 14 April 2015). The teachings of Daugherty et al. as applied to claim 1 has been described above. Daugherty et al. teach the antisense sequence includes nucleotides 1-19 of instant SEQ ID NO: 162. Daugherty et al. teach duplex 21-mer siRNAs from the sequences listed in Table 1 (paragraph 00114). Daugherty et al. does not teach the antisense sequence comprises the entire sequence of SEQ ID NO: 162, which includes 2 additional nucleotides ‘tg’, or the sense sequence comprises the entire sequence of SEQ ID NO: 181, which includes 2 additional nucleotides, ‘ca’. However, a blast search of the antisense sequence of instant SEQ ID NO: 162 shows that nucleotides 1-21 of Instant SEQ ID NO: 162 are complementary to nucleotides 428-408 of Homo sapiens double homeobox 4 (DUX4), transcript variant 1, mRNA of NM_001306068. PNG media_image6.png 212 610 media_image6.png Greyscale A blast search of the sense sequence of instant SEQ ID NO: 181 shows that nucleotides 1-21 of the sense strand sequence of instant SEQ ID NO: 181 align with nucleotides 408-428 of Homo sapiens double homeobox 4 (DUX4), transcript variant 1, mRNA NM_001306068. PNG media_image7.png 207 606 media_image7.png Greyscale The human DUX4 transcript variant 1 mRNA sequence was publicly available before the effective filing date, and is shown below. PNG media_image8.png 499 533 media_image8.png Greyscale Therefore, it would have been prima facie obvious to one of ordinary skill in the art before the effective filing date to modify the double stranded siRNA targeting DUX4 as taught by Daugherty et al. comprising an antisense strand of SEQ ID NO: 446 and sense strand of SEQ ID NO: 445 by adding ‘TG’ to the antisense sequence and ‘CA’ to the sense sequence based on the publicly available mRNA sequence of homo sapiens DUX4 of NM_001306068 with a reasonable expectation of success. An ordinary artisan would be motivated to use the known mRNA sequence of NM_001306068 and siRNA sequences of Daugherty et al. to obtain a 21-mer and arrive at the instant sequence of SEQ ID NOs: 162 and 181, as the mRNA sequence of NM_001306068 was publicly available and nucleotides 1-21 of Instant SEQ ID NO: 162 are complementary to nucleotides 428-408 of Homo sapiens double homeobox 4 (DUX4), transcript variant 1, mRNA of NM_001306068 and nucleotides 1-21 of the sense strand sequence of instant SEQ ID NO: 181 align with nucleotides 408-428 of Homo sapiens double homeobox 4 (DUX4), transcript variant 1, mRNA NM_001306068. Therefore, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art before the effective filing date. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1,5,7-9,31,38,40,60 and 61 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-22 of U.S. Patent No. 11,845,937 (Patent ‘937), Issued 19 Dec 2023. Although the claims at issue are not identical, they are not patentably distinct from each other because claim 1 of Patent ‘937 recites an RNAi agent for inhibiting expression of a double homeobox 4 (DUX4) gene comprising: PNG media_image9.png 107 390 media_image9.png Greyscale The sequences and chemical modifications in claim 1 of Patent ‘937 are a specific species of RNAi agent, and instant claims 1,5,7-9 recites an RNAi agent which is a genus, wherein the antisense strand sequence is SEQ ID NO: 10 which is comprised in the sequence of SEQ ID NO: 99 of Patent ’937, and instant SEQ ID NO: 162 which is the unmodified antisense sequence but the same nucleotide sequence as SEQ ID NO: 99, and the sense strand sequence of instant SEQ ID NO: 181 is the unmodified sequence but the same sequence as SEQ ID NO: 147 of claim 1 of Patent ‘937. Instant claim 31 recites the same sequences and chemical modifications (SEQ ID NOs: 99 and 147) as claim 1 of Patent ‘937. Therefore, claim 1 of Patent ‘937 anticipates instant claims 1,5,7-9 and 31. Claim 2 of Patent ‘937 recites the sense strand comprises a targeting ligand peptide (Peptide 1) having the same structure as that of instant claims 31,60 and 61, and claim 3 recites the targeting ligand is linked to the 5’ terminal of the sense strand, as do instant claims 31,60 and 61. Claims 4-6 of Patent ‘937 recite the RNAi agent is further linked to a PK/PD modulator at the 3’ terminal of the sense strand and claim 7 shows the same modulator as instant claims 30,60 and 61 as LP29b. Claim 8 of Patent ‘937 again recites the RNAi agent comprises the antisense strand of SEQ ID NO: 99 and comprises the sense strand of SEQ ID NO: 236 and which shows the arrangement of the same targeting peptide, linkers and PK/PD modulator (LP29b), invAb which is the same as instant claims 30,60 and 61. Claims 9-10 of Patent ‘937 recite the RNAi agent is a pharmaceutically acceptable salt, specifically sodium salt form, and claim 12 recites a pharmaceutical composition comprising the RNAi agent of claim 1 wherein the composition further comprises a pharmaceutically acceptable excipient, and instant claim 38 recites the RNAi agent is in sodium salt form and instant claim 40 recites a pharmaceutical composition and therefore Patent ‘937 anticipates instant claims 38 and 40. Claims 12-19 of Patent ‘937 recite a method of inhibiting expression of a DUX4 gene in a cell by introducing into a cell an effective amount of the RNAi agent of claim 1, and claims 20-22 recite a method of treating one or more symptoms or diseases that can be ameliorated at least in part by a reduction in DUX4 proteins levels or a reduction in DUX4 mRNA levels comprising administering to a human subject in need thereof a therapeutically effective amount of the composition of claim 11; wherein the disease is FSHD, and therefore recite a method of using the species of instant claims 1,5,7-9. Claims 1,5,7-9,31,38,40,60 and 61 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 25-27,112, 133,135 and 136 of copending Application No. 18/178,242 (App ‘242), (Filing date 09/10/2021) in view of Bradley et al. (WO 2020028134), cited on an IDS, Li et al. (US 20190010494, Published 10 Jan 2019), and Almeida et al. (WO 2018085415, Published 11 May 2018), cited on an IDS. Claim 25 of App ‘242 recites a compound having the structure of LP29a wherein R is LA-Rz and LA is a bond or bivalent moiety connecting Rz to the rest of the compound and Rz is an oligonucleotide-based agent, with claims 26 and 133 reciting the compound is LP29b and Rz comprises an oligonucleotide based agent, with claims 27 and 112 reciting the oligonucleotide based agent is an RNAi agent. Claims 135-136 recite a pharmaceutical composition comprising the compound of claim 25. App ‘242 does not recite that the oligonucleotide based agent comprises an antisense strand comprising SEQ ID NO: 10 and a sense strand that is at least partially complementary to the antisense strand, wherein the nucleotides comprising a modified nucleotide, or wherein all or substantially all of the nucleotides are modified nucleotides, or wherein all or substantially all of the modified nucleotides are 2’-O-methyl, 2’-fluoro or combinations thereof, or wherein the antisense strand comprises SEQ ID NO: 162 and wherein the sense strand comprises SEQ ID NO: 181. App ‘242 does not teach the specific chemical modification pattern, the targeting ligand, first linker, or second linker recited in instant claim 31. Before the effective filing date, Bradley et al. taught DUX4 was a novel regulator of antigen presentation and immune modulation, and that inhibition of DUX4 can be used in therapeutic methods for treating DUX4+ cancer (paragraph 0006). Bradley et al. taught a DUX4 nucleic acid inhibitor comprising a double-stranded siRNA wherein the sense strand of the double-stranded siRNA comprises a nucleic acid sequence at least 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100% (or any derivable range therein) complementary to the antisense strand of the double-stranded siRNA (paragraph 0099). Bradley et al. teach an siRNA comprising the nucleic acid sequence of SEQ ID NO: 68: CAGGATTCAGATCTGGTTTCA (paragraph 0103). SEQ ID NO: 68 of Bradley (Db) is 100% identical to the sense strand sequence of instant SEQ ID NO: 181 (Qy) of claim 9, see below: PNG media_image1.png 150 513 media_image1.png Greyscale Therefore, as Bradley et al. teach an siRNA comprising the sequence of SEQ ID NO: 68 as being 100% identical to the instant sense strand sequence of SEQ ID NO: 181, Bradley et al. also teach the corresponding antisense sequence. SEQ ID NO: 68 (Db) is 100% complementary to instant SEQ ID NO: 162 (Qy): PNG media_image2.png 120 460 media_image2.png Greyscale Bradley et al. teach wherein the sense strand of the double-stranded siRNA comprises at least, at most, or exactly 1-25 modified nucleosides, and in some embodiments, each nucleoside of the sense strand comprises a modified nucleoside, and is selected from a 2’-F modified nucleoside or a 2’-OMe modified nucleoside (paragraph 0100). Li et al. teach double-stranded RNAi agents for inhibition of alpha-ENaC gene expression (paragraph 0003). Li et al. teach antisense strand modification motifs (Table 3, pages 19-20), including those with cPrpus at the 5’ end of the antisense strand (See AMO5916, AMO5917, AMO6462 in Table 3, page 19), and various positions within the antisense strand as having 2’-O-methyl and 2’-F modifications and phosphorothioate linkages. Li et al. teach the structure of cPrpus in Table 6, page 27 which is the same structure in instant claims 31,60 and 61 as: PNG media_image10.png 303 205 media_image10.png Greyscale Li et al. teach modified sense and antisense strand sequences and motifs, and teach a sense strand motif of Strand ID AM6162-SS (Table 4, page 21) as: PNG media_image11.png 33 415 media_image11.png Greyscale This is the exact same sense strand modification pattern as in instant claim 31, and also shows an inverted abasic residue at the 3’ terminal end and 5’ terminal end of the nucleotide sequence of the sense strand which is also recited in instant claim 31. Li et al. teach the RNAi agents contains or is conjugated to one or more non-nucleotide groups, including a targeting group, a linking group, a pharmacokinetic (PK) modulator, and which can enhance targeting, delivery or attachment of the RNAi agent, and which can be covalently linked to the 3’ and/or 5’ end of the sense strand or antisense strand, and which targeting groups and linking groups are provided in Table 6 (paragraph 0258). Li et al. teach targeting groups or moieties enhance the pharmacokinetic or biodistribution properties of a conjugate or RNAi agent to which they are attached to improve cell specific distribution and cell specific uptake of the conjugate or RNAi agent, and that a targeting group can be linked to an RNAi agent using a linker (paragraph 0260). Li et al. teach suitable linkers in Table 6 which includes the below linkers on pages 29 and 30. PNG media_image12.png 145 436 media_image12.png Greyscale PNG media_image13.png 122 305 media_image13.png Greyscale Li et al. teaches the targeting group comprises an αvβ6 integrin targeting ligand, which facilitates cell-specific targeting to cells having αvβ6 on its respective surface which can facilitate entry of the RNAi gent to which it is linked into cells (paragraph 0263). Li et al. teaches αvβ6 integrin targeting ligands are described in WO 2018085415 (Almeida et al.) and is incorporated herein in its entirety (paragraph 0263). Li teach RNAi agent as a sodium salt (0115,0116,0117 and 0140) and pharmaceutical compositions thereof (paragraphs 0273-0280). Almeida et al. teach peptide-based alpha-v beta-6 integrin ligands useful in targeting αvβ6 integrin and/or targeting cells that express αvβ6 integrin (Field of Invention, page 1). Almeida et al. teach the ligand consists of the structure of Fig 4 (page 10), shown below, and that the ligands can be linked to oligomeric compounds, such as one or more RNAi agents to be delivered to a cell in vivo (page 11, lines 14-17). PNG media_image14.png 256 655 media_image14.png Greyscale Therefore, it would have been obvious to one of ordinary skill in the art, to modify claims 25-27,112,133,135 and 136 of App ‘242 by substituting the RNAi agent attached to the structure of LP29a of App ‘242 with an RNAi agent targeting DUX4 of Bradley et al. and provide the chemical modification motifs and linkers attached according to the teachings of Li et al., and the αvβ6 targeting ligand of Li et al. and Almeida et al., to arrive at the instant claims with a reasonable expectation of success. There would be a reasonable expectation of success, as App ‘242, Bradley et al., Li et al and Almeida et al. all pertain to double-stranded RNAi, and would amount to substituting one RNAi for another known RNAi as well as applying known techniques of conjugation to RNAi ready for improvement, to yield predictable results. One of ordinary skill in the art would have been motivated to use the RNAi agent of Bradley et al. comprising the nucleic acid sequence of SEQ ID NO: 68 (which is 100% identical to the sense strand sequence of instant SEQ ID NO: 181) as the RNAi agent attached to the PK modulator (LP 29b) of App ‘242 because Bradley et al. teach DUX4 as a novel regulator of antigen presentation and immune modulation, and that inhibition of DUX4 can be used in therapeutic methods for treating DUX4+ cancer (paragraph 0006). One of ordinary skill in the art would have been motivated to provide the chemical modification motifs of the sense and antisense strands as taught by Li et al., and to provide the αvβ6 targeting ligand and first linker linked to the inverted abasic residue at the 5’ end of the sense strand, as taught by Li et al. and Almeida et al. and wherein the sense strand is attached to the PK modulator (LP 29b) of App ‘242 and a second linker of Li et al. linked to the inverted abasic residue at the 3’ terminal end of the sense strand to provide an RNAi conjugate targeting DUX4 because Li et al. teach targeting groups or moieties enhance the pharmacokinetic or biodistribution properties of a conjugate or RNAi agent to which they are attached to improve cell specific distribution and cell specific uptake of the conjugate or RNAi agent, and that a targeting group can be linked to an RNAi agent using a linker and because Almeida et al. teach peptide-based alpha-v beta-6 integrin ligands useful in targeting αvβ6 integrin and/or targeting cells that express αvβ6 integrin and that the ligands can be linked to oligomeric compounds, such as one or more RNAi agents to be delivered to a cell in vivo. Accordingly, the limitations of claims 1,5,7-9,31,38,40,60 and 61 would have been prima facie obvious to one of ordinary skill in the art before the effective filing date. This is a provisional nonstatutory double patenting rejection. Conclusion Claims 1,5,7-9,31,38,40,60 and 61 are rejected. Any inquiry concerning this communication or earlier communications from the examiner should be directed to STEPHANIE L SULLIVAN whose telephone number is (703)756-4671. The examiner can normally be reached Monday-Friday, 7:30-3:30 EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram R Shukla can be reached at 571-272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /STEPHANIE L SULLIVAN/Examiner, Art Unit 1635 /ABIGAIL VANHORN/Primary Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Mar 09, 2023
Application Filed
Mar 05, 2026
Non-Final Rejection — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12565648
MICRORNA-MEDIATED METHODS FOR REJUVENATING CNS GLIAL POPULATIONS
2y 5m to grant Granted Mar 03, 2026
Patent 12534727
NOVEL TARGET TO TREAT A METABOLIC DISEASE IN AN INDIVIDUAL
2y 5m to grant Granted Jan 27, 2026
Patent 12522830
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Jan 13, 2026
Patent 12522826
THERAPEUTICS FOR THE TREATMENT OF NEURODEGENERATIVE DISORDERS
2y 5m to grant Granted Jan 13, 2026
Patent 12496347
NUCLEIC ACID, COMPOSITION AND CONJUGATE CONTAINING NUCLEIC ACID, PREPARATION METHOD THEREFOR AND USE THEREOF
2y 5m to grant Granted Dec 16, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
62%
Grant Probability
98%
With Interview (+35.7%)
3y 6m
Median Time to Grant
Low
PTA Risk
Based on 61 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month