DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Response to Amendment/Status of Claims
Receipt of Arguments/Remarks filed on 08/06/2026 is acknowledged. Claim 8 was cancelled. Claims 1,5,7,9,11-13,15,16,18,20,31,38,40 and 57-61 were amended.
Applicant elected Group I (claims 1,2,5,7-9,31,38,40,60 and 61) without traverse in the reply filed on 12/17/2025.
Claims 11-13,15,16,18,20,41,46 and 57-59 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 12/17/2025.
Claims 1,5,7,9,31,38,40,60 and 61 are under examination.
Priority
This application is a CON of PCT/US21/49871, filed 09/10/2021 which claims benefit of 63/077,272, filed 09/11/2020 and claims benefit of 63/214,742, filed 06/24/2021 as reflected by the most recent filing receipt.
Withdrawn Objections and Rejections
Applicant’s arguments and amendments, see page 33, filed 08/06/2026, with respect to the Sequences requirements for the Drawings have been fully considered and are persuasive due to the amendments to the drawings (FIG. 15A-15I) adding the appropriate SEQ ID NOs thereto. The objection to the Drawings has been withdrawn.
Applicant’s arguments and amendments, see page 34, filed 08/06/2026, with respect to the objection to claims 60 and 61 have been fully considered and are persuasive due to the amendments to claims 60 and 61 clarifying the chemical structures. The objection to claims 60 and 61 has been withdrawn.
Applicant’s arguments and amendments, see pages 34-35, filed 08/06/2026, with respect to the 35 U.S.C. 112(b) rejection of claims 31,38 and 40 have been fully considered and are persuasive due to the amendment to claim 31 reciting what Rz is and therefore the rejection has been withdrawn for these claims. However the 35 U.S.C. 112(b) rejection of claims 60 and 61 remains. See response below.
Applicant’s arguments and amendments, see pages 35-36, filed 08/06/2026, with respect to the 35 U.S.C. 102(a)(1) rejection of claims 1,8 and 9 as anticipated by WO 2020/028134 (Bradley et al.) and the 35 U.S.C. 103 rejection of claims 5 and 7 as obvious over Bradley et al. in view of Hu et al. have been fully considered and are persuasive due to the cancelation of claim 8 and amendment to claims 1 and 9 reciting specific sequences and chemical modifications not taught by the references. Therefore the rejections have been withdrawn.
Applicant’s arguments and amendments, see page 36, filed 08/06/2026, with respect to the rejection(s) of claim 1 under 35 U.S.C. 102(a)(2) as anticipated by WO 2022/051332 (Daugherty et al.) have been fully considered and are persuasive due to the amendment to claim 1. Therefore, the rejection has been withdrawn. However, upon further consideration, a new ground(s) of rejection is made in view of a case of obviousness based on the amendments.
Applicant’s arguments and amendments, see page 36, filed 08/06/2026, with respect to the rejection(s) of claims 5 and 7 under 35 U.S.C. 103 as obvious over Daugherty et al. in view of Hu et al. have been fully considered and are persuasive due to the amendment to claim 1, from which claims 5 and 7 depend. Therefore, the rejection has been withdrawn. However, upon further consideration, a new ground(s) of rejection is made based on the amendments.
Applicant’s arguments and amendments, see page 38, filed 08/06/2026, with respect to the rejection(s) of claims 8 and 9 under 35 U.S.C. 103 as obvious over Daugherty et al. in view of NCBI Ref. Seq ID NM_001306068 have been fully considered and are persuasive due to the cancelation of claim 8, and amendments to claims 1 and 9 which the cited references do not teach. Therefore, the rejection has been withdrawn. However, upon further consideration, a new ground(s) of rejection is made in view of a case of obviousness based on the amendments.
Applicant’s arguments and amendments, see page 39, filed 08/06/2026, with respect to the obviousness type Double Patenting rejection of claims 1,5,7-9,31,38,40,60 and 61 as unpatentable over claims 25-27,112,133,135 and 136 of App. 18/178,242 in view of WO 2020028134, US 20190010494 and WO 2018/085415 have been fully considered and are persuasive due to the amendments to App. 18/178,242 which no longer recite the compound of formula LP29b and therefore no case of obviousness exists. Therefore, the rejection has been withdrawn.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 60 and 61 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claims 60 and 61 recite chemical structures of the RNAi agent, and include circles with numbers in the circles, but neither the claims nor the specification explains what the numbers mean in the circles. Therefore, claims 60 and 61 are indefinite, as it is not clear what is meant by the circles and numbers in the circles.
Response to Arguments
Applicant’s arguments, see page 35, filed 08/06/2026 have been fully considered but are not persuasive. Applicant argues that amended claims 60 and 61 clarify the chemical structures, and recite the full chemical structure of the claimed RNAi agents, which are too large to view on one sheet. Thus, the structures were cut into multiple pieces on separate sheets and the numbers within the circles indicate how each piece connects (i.e. 1 connects to 1, 2 connects to 2, etc.).
This is not found persuasive, as while the claims were amended so that the structure is clear (which was what the Examiner previously objected to and withdrew), the issue remains that neither the claims nor specification define what the numbers in the circles mean. While Applicant has explained what it means in the response, the claims themselves are still indefinite since this is not clear in the claims themselves, or defined in the specification.
Claim Interpretation
Regarding the limitation in claim 1, “wherein the nucleotides comprise a modified nucleotide”, the examiner is interpreting this to mean that at least one nucleotide of the RNAi agent is a modified nucleotide.
Regarding “substantially all” in claims 5 and 7, the instant specification discloses in paragraph [0122], In some embodiments, all or substantially all of the nucleotides of an RNAi agent are modified nucleotides. As used herein, an RNAi agent wherein substantially all of the nucleotides present are modified nucleotides is an RNAi agent having four or fewer (i.e., 0, 1, 2, 3, or 4) nucleotides in both the sense strand and the antisense strand being ribonucleotides (i.e., unmodified). Therefore, these claims will be interpreted as “substantially” all as being 4 or less unmodified nucleotides in both the sense and antisense strands.
Claim Rejections - 35 USC § 103
The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action.
Claims 1,5 and 7 are rejected under 35 U.S.C. 103 as being unpatentable over Daugherty et al. (WO 2022051332, effectively filed 01 Sept 2020) in view of Li et al. (US 20190010494, Published 10 Jan 2019), both cited on an IDS.
Regarding claim 1, Daugherty et al. teach double-stranded siRNAs that modulate DUX4 gene expression for use in research, diagnostics and/or therapeutics (paragraph 0003) and a need in the art for agents for treatment of FSHD (paragraph 0007) and recites a double-stranded small interfering RNA (siRNA) comprising a sense strand and an antisense strand, wherein the antisense strand of the double-stranded siRNA comprises a nucleobase sequence of at least 12 contiguous nucleotides of a sequence selected from the group consisting of SEQ ID NOs:…446, and wherein the double-stranded siRNA comprises at least one modified nucleoside (claims 1 and 2). Daugherty et al. teach the sense strand of the dsRNA comprises a nucleobase sequence at least 85%, 90%,95% or 100% complementary to the antisense strand of the ds siRNA (paragraph 0016).
Table 1, page 30 of Daugherty et al. shows double-stranded siRNA targeting human DUX4, and the antisense strand of SEQ ID NO: 446 and the corresponding sense strand of SEQ ID NO: 445
PNG
media_image1.png
18
628
media_image1.png
Greyscale
Based on the broadest reasonable interpretation, “a nucleotide sequence” in i. and ii. in instant claim 1 only requires 2 of the nucleotides of the recited sequence, and therefore does not require the entire sequence.
As shown in the alignment below the antisense strand of SEQ ID NO: 446 of Daugherty et al. (Db) is 100% identical to nucleotides 1-19 of the antisense strand of instant SEQ ID NO: 99 (Qy), and therefore 19 of the 21 nucleotides of SEQ ID NO: 446 of Daugherty et al. are the same as instant SEQ ID NO: 99 which meets the structural limitations of “a nucleotide sequence”.
PNG
media_image2.png
80
308
media_image2.png
Greyscale
Daugherty et al. also teach chemically modified sense and antisense strands of the siRNAs (Example 5, Table 5, pages 45-47) with various motifs comprising 2’-Fluoro modifications, 2’-O-methyl modifications, and phosphorothioate internucleotide linkages at various positions.
Daugherty et al. do not teach 2 or more of nucleotides of the antisense sequence of SEQ ID NO: 446 having the modification pattern recited in instant claim 1.
However, Li et al. teach double-stranded RNAi agents for inhibition of alpha-ENaC gene expression (paragraph 0003). Li et al. teach antisense strand modification motifs (Table 3, pages 19-20), including an antisense strand comprising cPrpusAfsusUf…” (See AMO7170 and AMO7174 in Table 3, page 20). Therefore, Li et al. teach antisense strands where the first 4 nucleotides on the 5’ end have the same modification pattern as instant SEQ ID NO: 99.
Li et al. teach the structure of cPrpus in Table 6, page 27 which is the same structure in instant claim 1 as:
PNG
media_image3.png
303
205
media_image3.png
Greyscale
Therefore, the combination of Daugherty et al. and Li et al. teach an antisense strand sequence and modification pattern of “cPrpusGfsasAf” which reads on “an antisense strand comprising a nucleotide sequence…SEQ ID NO: 99”.
Regarding claims 5 and 7, Daugherty et al. recite a double-stranded siRNA comprising at least one modified nucleotide, and teaches embodiments wherein each nucleoside of the sense strand comprises a modified nucleoside, and the modified nucleoside comprises a 2’-F modified sugar and/or a 2’-OMe modified sugar (paragraphs 0020,0021), and that the double-stranded siRNA of the invention may comprise one or more (e.g., two, three, four, five, or more) modified nucleic acid monomers (paragraph 0075), including 2’-OMe and 2’F (paragraph 0076).
Daugherty et al. teach siRNAs with chemically modified sense and antisense strand sequences in Table 5 (page 46) which are fully modified (See the last three siRNAs, UGNX1985-Full, UGNX2130-Full and UGNX2206-Full in Table 5 which are fully modified with 2’F and 2’OMe sugar modifications in the sense strand). Table 6 shows these compounds were highly stable and potent.
Li et al. also show motifs of modified sense strands in Table 4, pages 20-22 which are fully modified, and wherein all of substantially all of the modified nucleotides are 2’-O-methyl and 2-fluoro nucleotides.
Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date, to have provided an antisense strand comprising a nucleotide sequence of SEQ ID NO: 446 of the siRNA of Daugherty et al. and the corresponding sense strand comprising a modified nucleotide, and to modify the antisense strand of Daugherty et al. to comprise a modification pattern taught by Li et al. in the first four nucleotides thereof (cPrpusAfsusUf) to arrive at an antisense strand comprising a nucleotide sequence “cPrpusGfsasAf” with a reasonable expectation of success. One of ordinary skill in the art would have been motivated to do so to provide an optimized siRNA targeting DUX4 with specific chemical modifications for use in research or therapeutics pertaining to DUX4 gene expression and diseases. Likewise, it would have been obvious to provide the corresponding sense strand of Daugherty et al. wherein all of the nucleotides in the sense strand are modified and wherein the modifications are a combination of 2’F and 2’OMe sugar modifications with a reasonable expectation of success based on the teachings of Daugherty et al. and Li et al. One of ordinary skill in the art would have been motivated to do so because Daugherty et al. teach wherein each nucleoside of the sense strand comprises a modified nucleoside including 2’-F and/or 2’-OMe modified sugars and were highly potent, and Li et al. taught motifs of modified sense strands which are fully modified, and wherein all of substantially all of the modified nucleotides are 2’-O-methyl and 2-fluoro nucleotides.
Accordingly, the limitations of claims 1,5 and 7 would have been prima facie obvious to one of ordinary skill in the art before the effective filing date.
Claim 9 is rejected under 35 U.S.C. 103 as being unpatentable over Daugherty et al. in view of Li et al. as applied to claims 1,5 and 7 above, and further in view of NCBI Reference Sequence ID NM_001306068 (Publicly available 14 April 2015), Arrowhead (US 20180195069, Published 12 July 2018) and Haringsma et al. (Nucleic Acids Research, 2012, Vol. 40, No. 9 4125-4136).
The teachings of Daugherty et al. in view of Li et al. as applicable to claims 1,5 and 7 have been described above. Daugherty et al. teach a DUX4 sense strand of SEQ ID NO: 445 (GGAUUCAGAUCUGGUUUCA).
In addition, Li et al. teach modified sense and antisense strand sequences and motifs, and teach a sense strand motif of Strand ID AM6162-SS (Table 4, page 21) as:
PNG
media_image4.png
33
415
media_image4.png
Greyscale
This sense strand modification pattern is the same as the instant modification pattern in claim 9 other than it is missing the phosphorothioate on the 5’ and 3’ end after the invAb.
Daugherty et al. in view of Li et al. do not teach the entire sequence of instant SEQ ID NO: 132 (the sequence of Daugherty et al. is missing “ca” from the 5’ end) and do not teach the sense strand as having a phosphorothioate linkage between the (invAb) and adjacent nucleotide on the 5’ and 3’ ends.
A blast search of the sense sequence of instant SEQ ID NO: 132 shows that nucleotides 1-21 of the sense strand sequence of instant SEQ ID NO: 132 align with nucleotides 408-428 of Homo sapiens double homeobox 4 (DUX4), transcript variant 1, mRNA NM_001306068.
PNG
media_image5.png
207
606
media_image5.png
Greyscale
The human DUX4 transcript variant 1 mRNA sequence was publicly available before the effective filing date, and is shown below.
PNG
media_image6.png
499
533
media_image6.png
Greyscale
In addition, Arrowhead taught RNAi agents having various modifications in the antisense and sense strands. Arrowhead taught that (invAb)s= inverted (3’-3’ linked) abasic deoxyribonucleotide-5’-phosphorothioate (page 29, paragraph 0236), and taught sense strands of the RNAi agent having (invAb)s modifications on the 5’ and 3’ ends (Table 5, page 32-33).
PNG
media_image7.png
391
674
media_image7.png
Greyscale
Haringsma et al. taught modifications patterns for siRNA, and that inverted abasic modifications present at the 5’ and 3’ of the passenger strand serve to block loading into Ago2 (page 4126, right column), which prevents the passenger strand competition with the guide strand (page 4128, right column).
Therefore, it would have been prima facie obvious to one of ordinary skill in the art before the effective filing date to modify the double stranded siRNA targeting DUX4 as taught by Daugherty et al. comprising an antisense strand of SEQ ID NO: 446 and sense strand of SEQ ID NO: 445 by adding ‘CA’ to the sense sequence based on the publicly available mRNA sequence of homo sapiens DUX4 of NM_001306068 to arrive at the sense sequence comprising “CAGGATTCAGATCTGGTTTCA”, and to apply the sense strand chemical modification patterns of Li et al. and Arrowhead et al. with a reasonable expectation of success. An ordinary artisan would be motivated to use the known mRNA sequence of NM_001306068 and siRNA sequences of Daugherty et al. to obtain a 21-mer and arrive at the instant sequence of SEQ ID NO: 132, as the mRNA sequence of NM_001306068 was publicly available and nucleotides 1-21 of Instant SEQ ID NO: 132 align with nucleotides 408-428 of Homo sapiens double homeobox 4 (DUX4), transcript variant 1, mRNA NM_001306068. One of ordinary skill in the art would have been motivated to apply chemical modification patterns to the sense strand that were known in the art, such as
PNG
media_image4.png
33
415
media_image4.png
Greyscale
as taught by Li et al. and the above (invAb)s modifications at the 5’ and 3’ ends of the sense strand of Arrowhead, and the teachings of Haringsma et al. that inverted abasic modifications present at the 5’ and 3’ of the passenger strand serve to block loading into Ago2, which prevents the passenger strand competition with the guide strand in order to optimize the RNAi activity.
Accordingly, the limitations of claim 9 would have been prima facie obvious to one of ordinary skill in the art before the effective filing date.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1,5,7,9,31,38,40,60 and 61 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-22 of U.S. Patent No. 11,845,937 (Patent ‘937), Issued 19 Dec 2023.
Although the claims at issue are not identical, they are not patentably distinct from each other because claim 1 of Patent ‘937 recites an RNAi agent for inhibiting expression of a double homeobox 4 (DUX4) gene comprising:
PNG
media_image8.png
107
390
media_image8.png
Greyscale
The antisense sequence and chemical modifications of the antisense strand of claim 1 of Patent ‘937 are the same as the antisense sequence and chemical modifications of instant claims 1 and 31, and the sequences and chemical modifications in claim 1 of Patent ‘937 are a specific species of the sense strand of instant claim 1 and are also have the same sequence of the instant sense strand of claims 9 and 31 with almost the exact same modifications.
Claim 2 of Patent ‘937 recites the sense strand comprises a targeting ligand peptide (Peptide 1) having the same structure as that of instant claims 31,60 and 61, and claim 3 recites the targeting ligand is linked to the 5’ terminal of the sense strand, as do instant claims 31,60 and 61. Claims 4-6 of Patent ‘937 recite the RNAi agent is further linked to a PK/PD modulator at the 3’ terminal of the sense strand and claim 7 shows the same modulator as instant claims 30,60 and 61 as LP29b. Claim 8 of Patent ‘937 again recites the RNAi agent comprises the antisense strand of SEQ ID NO: 99 and comprises the sense strand of SEQ ID NO: 236 and which shows the arrangement of the same targeting peptide, linkers and PK/PD modulator (LP29b), and chemical modification pattern. The sense strand sequence and chemical modifications of claim 8 of the Patent are the same as in instant claims 9 and 31.
Claims 9-10 of Patent ‘937 recite the RNAi agent is a pharmaceutically acceptable salt, specifically sodium salt form, and claim 12 recites a pharmaceutical composition comprising the RNAi agent of claim 1 wherein the composition further comprises a pharmaceutically acceptable excipient, and instant claim 38 recites the RNAi agent is in sodium salt form and instant claim 40 recites a pharmaceutical composition.
Claims 12-19 of Patent ‘937 recite a method of inhibiting expression of a DUX4 gene in a cell by introducing into a cell an effective amount of the RNAi agent of claim 1, and claims 20-22 recite a method of treating one or more symptoms or diseases that can be ameliorated at least in part by a reduction in DUX4 proteins levels or a reduction in DUX4 mRNA levels comprising administering to a human subject in need thereof a therapeutically effective amount of the composition of claim 11; wherein the disease is FSHD, and therefore recite a method of using the same RNAi agent of instant claims.
Response to Arguments
Applicants request that the Examiner hold the rejection in abeyance until allowable subject matter is found.
Therefore, as claim 1 is still not allowable, and the rejection still applies to the claims as amended, the rejection is maintained.
Conclusion
Claims 1,5,7,9,31,38,40,60 and 61 are rejected.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to STEPHANIE L SULLIVAN whose telephone number is (703)756-4671. The examiner can normally be reached Monday-Friday, 7:30-3:30 EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram R Shukla can be reached at 571-272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/STEPHANIE L SULLIVAN/Examiner, Art Unit 1635
/ABIGAIL VANHORN/ Primary Examiner, Art Unit 1636
Prosecution Insights