DETAILED ACTION
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claims 1, 4, 8-10, 14,17, 19, 50, 54-56, 62-68 and 69 are pending in the instant application.
Election/Restrictions
Applicant' selection of species of bacterial replication origin in the reply filed on December 5, 2025 is acknowledged. During a telephone conversation with Ms. Nicole M Tepe on March 26, 2026 a provisional election was made without traverse to prosecute the invention of species of desmin promoter as set forth in SEQ ID NO: 10, desmin enhancer as set forth in SEQ ID NO: 6, MCK enhancer of SEQ ID NO: 1, bacterial origin of replication of SEQ ID NO: 19 and marker of SEQ IDNO 24. Upon further consideration election of species requirement between different species of desmin promoter, bacterial origin of replication and marker are hereby rejoined with the elected invention. Affirmation of this election must be made by applicant in replying to this Office action. Claims 1, 4, 8-10, 14, 19, 50, 54-56, 62-63, 65 and 67, read on the elected species.
Claims 17, 64, 66, 68 and 69 read on non-elected species and therefore are withdrawn from further consideration by the examiner, 37 CFR 1.142(b), as being drawn to a non-elected invention.
Priority
This application is a continuation of PCT/US2021/049914 filed on 09/10/2021 that claims priority from US non provisional application number 63/077,339 filed on 09/11/2020.
Information Disclosure Statement
The information disclosure statements (IDS) submitted on 03/10/2023, 08/22/2025 and 10/07/2025 are in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement has been considered by the examiner.
Claims 1, 4, 8-10, 14, 19, 50, 54-56 ,62-63, 65 and 67 are under consideration.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claim(s) 1, 4, 8-10, 14, 19, 62-63, 65 and 67, are rejected under 35 U.S.C. 103 as being unpatentable over Chuh et al (WO2018178067, dated ), Souza (WO2002095006, dated 11/28/2002) and Stanton (WO2020181168, dated 09/10/2020, filed 3/6/2020)/Salva (Molecular Therapy, 2007, 15, 320-329).
Claims are drawn to any muscle specific regulatory nucleic acid sequence, comprising
(i) any mammalian desmin promoter comprises a nucleic acid sequence having at least 80% identity to a nucleic acid sequence selected from the group consisting of SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: 10.
(ii) any mammalian desmin enhancer; and
(iii) one or more mammalian muscle creatine kinase (MCK) enhancers.
With respect to claims 1, 4, 62-63, 67, Chuh teaches a vector comprising a muscle specific regulatory nucleic acid sequence comprising human desmin promoter comprises SEQ ID NO: 91 that has 100% sequence identity to SEQ ID NO: 7 or comprises over 90% sequence identity to SEQ ID NO: 8, a human desmin enhancer comprising SEQ ID NO: 91 that has 100% sequence identity to SEQ ID NO: 6 and a muscle specific myosin light chain enhancer, wherein the human desmin promoter, human desmin enhancer, and human MCK enhancer are operably linked (see example 2, page 115). For SEQ ID NO: 7 (human desmin promoter) : Query Match 100.0%; Score 791; Length 1099; Best Local Similarity 100.0%; Matches 791; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 AGCTTATCAGACCCTTTCTGGAAATCAGCCCACTGTTTATAAACTTGAGGCCCCACCCTC 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 303 AGCTTATCAGACCCTTTCTGGAAATCAGCCCACTGTTTATAAACTTGAGGCCCCACCCTC 362
Qy 61 GACAGTACCGGGGAGGAAGAGGGCCTGCACTAGTCCAGAGGGAAACTGAGGCTCAGGGCT 120 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 363 GACAGTACCGGGGAGGAAGAGGGCCTGCACTAGTCCAGAGGGAAACTGAGGCTCAGGGCT 422
Qy 121 AGCTCGCCCATAGACATACATGGCAGGCAGGCTTTGGCCAGGATCCCTCCGCCTGCCAGG 180 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 423 AGCTCGCCCATAGACATACATGGCAGGCAGGCTTTGGCCAGGATCCCTCCGCCTGCCAGG 482
Qy 181 CGTCTCCCTGCCCTCCCTTCCTGCCTAGAGACCCCCACCCTCAAGCCTGGCTGGTCTTTG 240 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 483 CGTCTCCCTGCCCTCCCTTCCTGCCTAGAGACCCCCACCCTCAAGCCTGGCTGGTCTTTG 542
Qy 241 CCTGAGACCCAAACCTCTTCGACTTCAAGAGAATATTTAGGAACAAGGTGGTTTAGGGCC 300 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 543 CCTGAGACCCAAACCTCTTCGACTTCAAGAGAATATTTAGGAACAAGGTGGTTTAGGGCC 602
Qy 301 TTTCCTGGGAACAGGCCTTGACCCTTTAAGAAATGACCCAAAGTCTCTCCTTGACCAAAA 360 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 603 TTTCCTGGGAACAGGCCTTGACCCTTTAAGAAATGACCCAAAGTCTCTCCTTGACCAAAA 662
Qy 361 AGGGGACCCTCAAACTAAAGGGAAGCCTCTCTTCTGCTGTCTCCCCTGACCCCACTCCCC 420 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 663 AGGGGACCCTCAAACTAAAGGGAAGCCTCTCTTCTGCTGTCTCCCCTGACCCCACTCCCC 722
Qy 421 CCCACCCCAGGACGAGGAGATAACCAGGGCTGAAAGAGGCCCGCCTGGGGGCTGCAGACA 480 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 723 CCCACCCCAGGACGAGGAGATAACCAGGGCTGAAAGAGGCCCGCCTGGGGGCTGCAGACA 782
Qy 481 TGCTTGCTGCCTGCCCTGGCGAAGGATTGGCAGGCTTGCCCGTCACAGGACCCCCGCTGG 540 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 783 TGCTTGCTGCCTGCCCTGGCGAAGGATTGGCAGGCTTGCCCGTCACAGGACCCCCGCTGG 842
Qy 541 CTGACTCAGGGGCGCAGGCCTCTTGCGGGGGAGCTGGCCTCCCCGCCCCCACGGCCACGG 600 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 843 CTGACTCAGGGGCGCAGGCCTCTTGCGGGGGAGCTGGCCTCCCCGCCCCCACGGCCACGG 902
Qy 601 GCCGCCCTTTCCTGGCAGGACAGCGGGATCTTGCAGCTGTCAGGGGAGGGGAGGCGGGGG 660 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 903 GCCGCCCTTTCCTGGCAGGACAGCGGGATCTTGCAGCTGTCAGGGGAGGGGAGGCGGGGG 962
Qy 661 CTGATGTCAGGAGGGATACAAATAGTGCCGACGGCTGGGGGCCCTGTCTCCCCTCGCCGC 720 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 963 CTGATGTCAGGAGGGATACAAATAGTGCCGACGGCTGGGGGCCCTGTCTCCCCTCGCCGC 1022
Qy 721 ATCCACTCTCCGGCCGGCCGCCTGCCCGCCGCCTCCTCCGTGCGCCCGCCAGCCTCGCCC 780 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1023 ATCCACTCTCCGGCCGGCCGCCTGCCCGCCGCCTCCTCCGTGCGCCCGCCAGCCTCGCCC 1082
Qy 781 GCGCCGTCACC 791
|||||||||||
Db 1083 GCGCCGTCACC 1093
FOR SEQ ID NO: 6 (human desmin enhancer)
Query Match 100.0%; Score 281; Length 1099;
Best Local Similarity 100.0%;
Matches 281; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GGTACCCCCTGCCCCCCACAGCTCCTCTCCTGTGCCTTGTTTCCCAGCCATGCGTTCTCC 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 22 GGTACCCCCTGCCCCCCACAGCTCCTCTCCTGTGCCTTGTTTCCCAGCCATGCGTTCTCC 81
Qy 61 TCTATAAATACCCGCTCTGGTATTTGGGGTTGGCAGCTGTTGCTGCCAGGGAGATGGTTG 120 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 82 TCTATAAATACCCGCTCTGGTATTTGGGGTTGGCAGCTGTTGCTGCCAGGGAGATGGTTG 141
Qy 121 GGTTGACATGCGGCTCCTGACAAAACACAAACCCCTGGTGTGTGTGGGCGTGGGTGGTGT 180 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 142 GGTTGACATGCGGCTCCTGACAAAACACAAACCCCTGGTGTGTGTGGGCGTGGGTGGTGT 201
Qy 181 GAGTAGGGGGATGAATCAGGGAGGGGGCGGGGGACCCAGGGGGCAGGAGCCACACAAAGT 240 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 202 GAGTAGGGGGATGAATCAGGGAGGGGGCGGGGGACCCAGGGGGCAGGAGCCACACAAAGT 261
Qy 241 CTGTGCGGGGGTGGGAGCGCACATAGCAATTGGAAACTGAA 281
|||||||||||||||||||||||||||||||||||||||||
Db 262 CTGTGCGGGGGTGGGAGCGCACATAGCAATTGGAAACTGAA 302
With respect to claim 8, Chuh teaches that the mammalian desmin enhance is a human desmin enhancer (see example 2, SEQ ID NO: 91)
With respect to claims 9-10, Chuh teaches that the muscle specific regulatory nucleic acid sequence, wherein the human desmin enhancer comprises SEQ ID NO: 91 that has 100% sequence identity to SEQ ID NO: 6 (see sequence alignment above and sequence search results, example 2).
Chuh differs from claimed invention by not disclosing muscle regulatory sequence comprises one or more muscle creatine kinase (MSK) enhancer is a MCK CK7 enhancer that has at least 80% sequence identity to SEQ ID NO: 1 (limitation of clam 1, 14, 19, 62, 65, 67).
However, before the effective filing date of instant application, use of different combinations of muscle-specific enhancer and promoter elements were known to be useful for achieving persistent expression in the muscle or myocytes. For instance, Souza teaches recombinant muscle-specific regulatory element for gene expression, comprising: (a) a promoter element of mammalian desmin (DES) promoter and at least one enhancer element selected from the group consisting of mammalian MCK enhancer, mammalian DES enhancer, and vertebrate troponin I IRE (FIRE) enhancer, wherein the promoter and enhancer elements are operably linked (see claim 1 of ‘006), wherein promoter is human desmin promoter (see claim 5 of ‘006). Souza teaches that the MCK enhancer comprises the mouse MCK enhancer of SEQ ID NO:20 and DES enhancer comprises the human DES enhancer of SEQ ID NO:21 (see claims 8 and 9 of ‘006). The combination of references differs from claimed invention by not disclosing the muscle creatine kinase (MSK) enhancer is a MCK CK7 enhancer that has at least 80% sequence identity to SEQ ID NO: 1.
Stanton cures the deficiency by disclosing use of an MHCK promoter of SEQ ID NO: 248 that is about 99% identical to SEQ ID NO: 1, and a human DES promoter / enhancer region of SEQ ID NO: 252 as a muscle-specific promoter / enhancer region that comprises SEQ ID NO: 6 and at least about 99% identical to SEQ ID NO: 7 of the instant application (Table 7, pages 90-91). Likewise, Salva teaches use of MHCK7 (770 bp) and CK7, directs high-level expression comparable to cytomegalovirus and Rous sarcoma virus promoters in fast and slow skeletal and cardiac muscle, and low expression in the liver, lung, and spleen (see abstract, Fog. 3a). It is further disclosed that the CK7 enhancer incorporates three successive modifications including (i) a 63-bp deletion between the enhancer right E-box and MEF2 sites which eliminates a stretch of poorly conserved sequence (Figure 1a), and that brings the right E-box and MEF2 sites into close proximity, thus facilitating positive interactions between myogenic regulatory factors (MRFs) transcription factors bound to the E-box and MEF2 transcription factors bound to the MEF2 site.31 (ii) changing the sequence overlapping the transcription start site to as consensus initiator sequence (Inr) that synergizes with the TATA box by increasing the binding affinity of initiation factors IID and IIA.31 and (iii) inclusion of a highly conserved 50 bp from the MCK exon-1 50-UTR. These modifications enhance the cassette activity by 2-fold in MM14 skeletal myocytes, this modification also led to a 5-fold increase in activity in neonatal rat cardiomyocytes. The MCKC7 enhancer disclosed in Salva is same as claimed SEQ ID NO: 7 as evident from the table 1 of the instant specification (see fig. 1A and 321, col. 2 para. 1).
Therefore, it would have been prima facie obvious for a person of ordinary skill in the art to combine the teachings of Chuh by substituting muscle specific enhancer with another muscle specific enhancer such as MCK enhancer as disclosed by Souza, in order to use a muscle specific regulatory nucleic acid sequence for using vector for cell and gene therapy, as instantly claimed, with a reasonable expectation of success, before the effective filing date of instant invention. Said modification amounting to combining prior art elements according to known methods to yield predictable results. One of ordinary skill in the art would be motivated to do so as MCK works well with other muscle specific promoters as evident from the teaching of Souza . Absent evidence of any unexpected and/or superior results, one of skill in the art would have been expected to have a reasonable expectation of success in substituting one muscle specific enhancer with another as disclosed in Souza because the art teaches successful use of hybrid muscle specific regulatory cassette by combining human desmin promoter/enhancer with regulatory elements derived from MCK gene in gene therapy constructs suggesting the functional completability of their shared E-box and MEF-2 dependent transcriptional mechanism as suggested in Stanton/ Salva . It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness See the recent Board decision Ex parte Smith, --USPQ2d--, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925.pdf).
Claim(s) 50, 54-55 and 56 are rejected under 35 U.S.C. 103 as being unpatentable over Souza (WO2002095006, dated 11/28/2002) and Williams (WO2014077866, dated 05/22/2014).
The teaching of Souza has been described above and relied in same manner. Briefly,
With respect to claim 50, Souza teaches a plasmid (DC-318) comprising a muscle specific regulatory nucleic acid sequence for gene expression, comprising: (a) a promoter element of mammalian desmin (DES) promoter and at least one enhancer element selected from the group consisting of mammalian MCK enhancer, mammalian DES enhancer, and vertebrate troponin I IRE (FIRE) enhancer, wherein the promoter and enhancer elements are operably linked (see claim 1 of ‘006), wherein promoter is human desmin promoter (see claim 5 of ‘006). Souza teaches that the MCK enhancer comprises the mouse MCK enhancer of SEQ ID NO:20 and DES enhancer comprises the human DES enhancer of SEQ ID NO:21 (see claims 8 and 9 of ‘006, table 1 for DC-318).
The combination of references differs from claimed invention by not disclosing a spacer region that links the 5 and 3’ end of the eukaryotic region sequence and that comprises a bacterial replication origin and a RNA selectable marker.
Williams reported art recognized limitation of using plasmid therapies that included (i) transfer and replication in endogenous bacterial flora, (ii) use of plasmid encoded selection marker expression in human cells, or endogenous bacterial flora and (iii) presence of non-essential sequences in a vector (see page 2lines 15-30). Williams emphasizes need to develop eukaryotic expression vectors that contain short spacer regions preferably less than 500 bp that can be efficiently manufactured. These vectors should not encode a protein-based selection marker and should be minimalized to eliminate all non-essential sequences (see pages 3, line 35 to page 4, lines 1-2). Specifically, Williams teaches a eukaryotic replicative pUC-free minicircle expression vector, i) a eukaryotic region encoding a gene of interest and 5' and 3' ends, with ii) a spacer region linking the 5' and 3' ends of the eukaryotic region, said spacer comprising a bacterial replication origin that is not the pUC origin and a RNA selectable marker, said spacer region less than 500 base pairs in length (claim 1 of 866) (limitation of claim 50).
With respect to claim 54-56, Williams teaches vector, wherein thar the bacterial replication origin is a R6K bacterial replication origin (see ) as set forth in sequence ID NO: 70-72 that has 100% sequence identity to SEQ ID NO: 19 (see sequence search results Below).
Query Match 100.0%; Score 281; Length 454;
Best Local Similarity 100.0%;
Matches 281; Conservative 0; Mismatches 0; Indels 0; Gaps 0Qy 1 GGCTTGTTGTCCACAACCGTTAAACCTTAAAAGCTTTAAAAGCCTTATATATTCTTTTTT 60 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 26 GGCTTGTTGTCCACAACCGTTAAACCTTAAAAGCTTTAAAAGCCTTATATATTCTTTTTT 85
Qy 61 TTCTTATAAAACTTAAAACCTTAGAGGCTATTTAAGTTGCTGATTTATATTAATTTTATT 120 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 86 TTCTTATAAAACTTAAAACCTTAGAGGCTATTTAAGTTGCTGATTTATATTAATTTTATT
Qy 121 GTTCAAACATGAGAGCTTAGTACGTGAAACATGAGAGCTTAGTACGTTAGCCATGAGAGC 180 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 146 GTTCAAACATGAGAGCTTAGTACGTGAAACATGAGAGCTTAGTACGTTAGCCATGAGAGC
205Qy 181 TTAGTACGTTAGCCATGAGGGTTTAGTTCGTTAAACATGAGAGCTTAGTACGTTAAACAT 240 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 206 TTAGTACGTTAGCCATGAGGGTTTAGTTCGTTAAACATGAGAGCTTAGTACGTTAAACAT 265
Qy 241 GAGAGCTTAGTACGTACTATCAACAGGTTGAACTGCTGATC 281
|||||||||||||||||||||||||||||||||||||||||
Db 266 GAGAGCTTAGTACGTACTATCAACAGGTTGAACTGCTGATC 306
Regarding claim 56, Williams teaches vector, wherein the RNA selectable marker as set forth in in sequence ID NO: 20 that has 100% sequence identity to SEQ ID NO: 24(see sequence search results Below).
Query Match 100.0%; Score 139; Length 139;
Best Local Similarity 100.0%;
Matches 139; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GTAGAATTGGTAAAGAGAGTCGTGTAAAATATCGAGTTCGCACATCTTGTTGTCTGATTA 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 GTAGAATTGGTAAAGAGAGTCGTGTAAAATATCGAGTTCGCACATCTTGTTGTCTGATTA 60
Qy 61 TTGATTTTTGGCGAAACCATTTGATCATATGACAAGATGTGTATCTACCTTAACTTAATG 120 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 61 TTGATTTTTGGCGAAACCATTTGATCATATGACAAGATGTGTATCTACCTTAACTTAATG 120
Qy 121 ATTTTGATAAAAATCATTA 139
|||||||||||||||||||
Db 121 ATTTTGATAAAAATCATTA 139
Therefore, it would have been prima facie obvious for a person of ordinary skill in the art to combine the teachings of prior art to incorporate the muscle specific regulatory sequence into to vectors t disclosed by Williams, as instantly claimed, with a reasonable expectation of success, before the effective filing date of the instant invention. Said modification amounting to combining prior art elements according to known methods to yield predictable results. One of ordinary skill in the art would be motivated to do so as Williams recognized that limitation of using plasmid of prior art that could be overcome by using the eukaryotic replicative pUC-free minicircle expression vector for improved transgene expression (see above) . One of skill in the art would have been expected to have a reasonable expectation of success in using a eukaryotic replicative pUC-free minicircle expression vector because the art teaches the successful use of this vector in gene therapy or genetic immunization . It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness See the recent Board decision Ex parte Smith, --USPQ2d--, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR, 82 USPQ2d at 1396) (available at http: www. uspto.gov/web/offices/dcom/bpai/prec/fd071925.pdf).
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1, 4, 8-10, 14, 19, 50, 54-56 ,62-63, 65 and 67 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
The claims embrace any muscle specific regulatory nucleic acid sequence, comprising
(i) any mammalian desmin promoter comprises a nucleic acid sequence having at least 80% identity to a nucleic acid sequence selected from the group consisting of SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, and SEQ ID NO: 10.
(ii) any mammalian desmin enhancer; and
(iii) one or more mammalian muscle creatine kinase (MCK) enhancers.
Dependent claims limit the mammalian desmin enhancer to a human desmin enhancer that has 80% sequence identity to SEQ ID NO: 6 and mammalian MCK enhancer to a CK promoter that has at least 80% sequence identity to SEQ ID NO: 1.
Vas-Cath Inc. v. Mahurkar, 19USPQ2d 1111 (Fed. Cir. 1991), clearly states that “applicant must convey with reasonable clarity to those skilled in the art that, as of the filing date sought, he or she was in possession of the invention. The invention is, for purposes of the ‘written description’ inquiry, whatever is now claimed.” Vas-Cath Inc. v. Mahurkar, 19USPQ2d at 1117. The specification does not “clearly allow persons of ordinary skill in the art to recognize that [he or she] invented what is claimed.” Vas-Cath Inc. v. Mahurkar, 19USPQ2d at 1116.
The DNA sequences of all the mammalian desmin promoter, mammalian desmin enhancer and mammalian MCK enhancers, other than the SEQ ID NO: 7-10, 6 and 1 , encompassed within the genus of mammalian desmin promoter, mammalian desmin enhancer and mammalian MCK enhancers have not been disclosed. Based upon the prior art there is expected to be sequence variation among the different species of DNA sequences of mammalian sequences of desmin promoter, desmin enhancer and MCK enhancer. The specification has provided the sequences of the SEQ ID NO: 7-10 (desmin promoter), 6 (desmin enhancer) and 1 (MCK enhancer). The specification however has not disclosed the sequences of any of the other mammalian sequences embraced by the claims. There is no evidence on the record of a relationship between the structures of the DNA molecules of any of the embraced mammalian desmin promoter, mammalian desmin enhancer and mammalian MCK enhancers that would provide any reliable information about the structure of DNA molecules within the genus. There is no evidence on the record that embraced mammalian desmin promoter and mammalian MCK enhancers had known structural relationships to each other; the art indicated that there is variation between DNA sequences of various species of mammalian promoter and enhancers. Villar (Cell, 2015, 160, 554-566) teaches “rapid evolution of enhancers is a universal feature of mammalian genomes. Most of the recently evolved enhancers arise from ancestral DNA exaptation, rather than lineage-specific expansions of repeat elements” (abstract). The teaching of Villar shows low sequence conservation across different mammalian species. In the instant case, claims embrace a genus that comprises mammalian desmin promoter comprises a nucleic acid sequence having at last 80% identity to (i) a nucleic acid sequence set forth in SEQ ID NO: 7-10, (ii) a mammalian desmin enhancer comprises a nucleic acid sequence having at least 80% identity to the nucleic acid sequence of SEQ ID NO: 6 or (iii) one or more mammalian MCK enhancers each have a nucleic acid sequence with at least 80% identity to the nucleic acid sequence of SEQ ID NO: 1. Harrison (Skeletal Muscle 2011, 1:5, 1-9) teaches despite highly conserved upstream regulatory regions, the mouse and human MyHC-IIb genes exhibit dramatically different basal transcriptional activities in both mouse and human muscle cells (Figure 1). Harrison states “much of the difference in transcriptional activity between the mouse and human MyHC-IIb genes can be attributed to a single nucleotide difference between the two species that effectively eliminates SRF binding to the proximal human MyHC-IIb promoter region (Figure 2) (see page 5, col. 2, last para). In view of foregoing, it is apparent that a single nucleotide sequence differences can disrupt transcription factor binding sites such as E-box and MEF2. In the instant case, the claimed invention as a whole is not adequately described if the claims require essential or critical elements which are not adequately described for the entire genus in the specification and which is not conventional in the art as of applicants effective filing date. Possession may be shown by actual reduction to practice, clear depiction of the invention in a detailed drawing, or by describing the invention with sufficient relevant identifying characteristics such that a person skilled in the art would recognize that the inventor had possession of the claimed invention. Pfaff v. Wells Electronics, Inc., 48 USPQ2d 1641, 1646 (1998).
In the instant case, the claimed embodiments of mammalian desmin promoter, mammalian desmin enhancer and mammalian MCK enhancers, other than the SEQ ID NO: 7-10, SEQ ID NO: 6 and SEQ ID NO: 1 encompassed within the genus of mammalian desmin promoter, mammalian desmin enhancer and mammalian MCK enhancers respectively lack a written description. The specification fails to describe what DNA molecules fall into this genus. The skilled artisan cannot envision the detailed chemical structure of the encompassed mammalian desmin promoter, mammalian desmin enhancer and mammalian MCK enhancers, and therefore conception is not achieved until reduction to practice has occurred, regardless of the complexity or simplicity of the method of isolation. Adequate written description requires more than a mere statement that it is part of the invention and reference to a potential method of isolating it. See Fiers v. Revel, 25 USPQ2d 1601, 1606 (Fed. Cir. 1993) and Amgen Inc. v. Chugai Pharmaceutical Co. Ltd., 18 USPQ2d 1016 (Fed. Cir. 1991).
One cannot describe what one has not conceived. See Fiddes v. Baird, 30 USPQ2d 1481, 1483. In Fiddes, claims directed to mammalian FGF’s were found to be unpatentable due to lack of written description for that broad class. The specification provided only the bovine sequence.
In view of the above considerations, one of skill in the art would not recognize that applicant was in possession of the necessary common features or attributes possessed by member of the genus of mammalian desmin promoter, mammalian desmin enhancer and mammalian MCK enhancers, other than the SEQ ID NO: 7-10 (desmin promoter), SEQ ID NO: 6 (desmin enhancer) and SEQ ID NO: 1 (MCK enhancer). . Moreover, the art has recognized that there would be variation among the species of the genus of DNA sequences of mammalian desmin promoter, mammalian desmin enhancer and mammalian MCK enhancers. Therefore, Applicant was not in possession of the genus of egg-directing sequences as encompassed by the claims. University of California v. Eli Lilly and Co., 43 USPQ2d 1398, 1404, 1405 held that to fulfill the written description requirement, a patent specification must describe an invention and do so in sufficient detail that one skilled in the art can clearly conclude that "the inventor invented the claimed invention."
Conclusion
No claims allowed.
The prior art made of record and not relied upon is considered pertinent to applicant's disclosure. Jaynes (Molecular & Cellular Biology, 1988, 62-70) teaches MCK enhancer that has t least 80% sequence identity to SEQ ID NO: 1 (see fig. 5).
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ANOOP K. SINGH whose telephone number is (571)272-3306. The examiner can normally be reached Monday-Friday, 8AM-5PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Peter Paras can be reached at (571)272-4517. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/ANOOP K SINGH/ Primary Examiner, Art Unit 1632
Prosecution Insights